CN107574264B - Application of the NF- κ B1 gene rs230530 SNP in preparation detection hepatitis C neurological susceptibility product - Google Patents

Abstract

The invention discloses the application of a kind of NF- κ B1 gene rs230530 single nucleotide polymorphism (single nucleotide polymorphism, SNP) of NF- κ B access in human genome or genotype in preparation detection or screening hepatitis C neurological susceptibility product or the product of single nucleotide polymorphism relevant to hepatitis C；In practical applications, the polymorphism (i.e. allele) or genotype substance that can will test rs230530 to other substances (as detected other single nucleotide polymorphism relevant with hepatitis C or genotype substance) are united the product for preparing screening hepatitis C susceptible person.

Description

NF- κ B1 gene rs230530 SNP is in preparation detection hepatitis C neurological susceptibility product Application

Technical field

The present invention relates to biomedicine field, the NF- κ B1 gene of NF- κ B access in especially a kind of human genome Rs230530 single nucleotide polymorphism (single nucleotide polymorphism, SNP) detects hepatitis C in preparation Application in neurological susceptibility product.

Background technique

SNP refers to the change of nucleic acid sequence caused by single nucleotide acid mutation.There are two equipotential bases for one SNP site Cause, in human genome, being averaged in every 100-300 nucleotide there are a SNP, SNPs is that the most common heredity of the mankind becomes Foreign peoples's type.The code area of human genome and noncoding region are distributed with SNPs, and most of SNPs are present in noncoding region.Coding The SNPs in area has nonsynonymous mutation and same sense mutation, and the amino acid sequence of protein can be changed in SNPs non-synonymous, and same sense mutation is then Do not influence protein coding.The SNPs of noncoding region may influence the shearing of gene, transcription factor combines, mRNA degrades etc..People The distribution of class SNPs has difference, results in not agnate, crowd DNA sequence with diversity, also results in human body To the neurological susceptibility of disease, disease progression, lapse to and medication effect has differences.SNPs has been considered as a kind of biology at present Marker is widely used in the relationship of research hereditary variation and human diseases.

Viral hepatitis type C is a kind of virus hepatitis caused by Hepatitis C Virus (HCV) infection.The whole world is shared 1.85 hundred million HCV infection persons, Chinese HCV infection rate is about 1.6%, and blood transfusion, Injecting Drug User, organ transplant and haemodialysis are As the domestic main route of transmission HCV.HCV acute infection can be there are two types of different final results: viral self limiting is removed and is continued Sexuality dye.It is body untreated, automatic clear in after infection 12 months after self limiting removing person refers to HCV infection human body Except HCV, to show as HCV RNA feminine gender, HCV antibody positive from persistent infection.Persistent infection refers to that HCV feels After contaminating human body, body untreated cannot remove HCV in after infection 12 months, show as the HCV RNA positive, HCV antibody It is positive.HCV infection person more than 70% can develop as persistent infection, and a portion patient is also possible to develop into liver hard Change, hepatocellular carcinoma (HCC).

The progression of the disease of HCV infection person and lapse to and can be influenced by many factors, including virus, host immune and heredity because Element.In the past few years, in the multinomial large-scale clinical trials in the whole world, new direct antiviral drugs (direct-acting Antiviral agents, DAAs) cure rate of chronic hepatitis C improved significantly to 95% or more, it has also become traditional poly- second two Alcohol interferon+ribavirin therapy scheme is more preferably selected.However, constantly thering is new problem to emerge in large numbers with the application of DAAs drug: HBV/HCV combined infection can cause HBV reactivation using DAA drug；It is hard in the liver that part obtains persistent virus response (SVR) Change in patient, the application of DAAs can not reduce the incidence of HCC；DAAs treatment can also result in drug resistant generation, really at present The site drug resistance related mutation (resistance associated variants, RAVs) recognized include NS3/4A target spot it is related, NS5A target spot correlation and relevant tens RAVs of NS5B target spot.

In view of the matter of utmost importance for preventing HCV from propagating is screening, identification Susceptible population.Therefore, Chinese population heredity is carried out The research of the relationship of background and HCV infection, for further investigation inherent cause hepatitis disease progression mechanism of action, be and When, effective prevention and control hepatitis prevalence effective target spot, tool and theoretical basis are provided, have important practical significance.

NF- κ B is nuclear factor, have and certain genes on promoter region specific nucleotide sequence in conjunction with and start Genetic transcription, the function of adjusting cell Proliferation, apoptosis, inflammatory process and immune response.NF- κ B can be by bacterium/viral antigen, thin Many stimulant activation such as intracellular cytokine, then adjust the expression of 150 several genes.NF- κ B/ReL family member has c-ReL, NF- κB1(P50),NF-κB2(P52),RelA(P65),ReLB.The ammonia that these albumen are about made of 300 amino acid by one Base end, referred to as ReL homologous region, including DNA binding site, Dimerized position and with NF- κ B inhibit albumen (I κ B) bound site Point.The NF- κ B that active DNA is combined is P50 and P65 dimer.Homologous or heterodimeric can be formed between ReL protein member Body, different NF- κ B/ReL albumen dimers has different binding sequences, and respectively has characteristic, and homodimer not can recognize Different DNA target targets, and the ability to express of different adjustment gene is improved.NF- kB protein P50/P65, P50/c- ReL, P65/c-ReL complex have transcriptional activation, and then there is P50/P50 and P52/P52 homodimer transcription to press down Production is used.

Existing research shows that NF- κ B family gene (NF- κ B1, NF- κ B2, RelA, RelB, ReL) and its suppressor I κ B may have an impact host to the neurological susceptibility of HCV and the immune response of interior resisting virus by related SNP s.2014, have Research shows that NF- κ B ε (IkB ε) rs2233437-A significantly improves host HCV from Scavenging activity is limited, NF- κ B access phase has been prompted Correlation gene polymorphism may be lapsed to exist with HCV infection and is associated with.But at present only studies have reported that, rs11820062 and chronic kidney disease Neurological susceptibility (O ' Brown, Z.K., Van Nostrand, E.L., Higgins, J.P.&Kim, S.K.The inflammatory transcription factors NFκB,STAT1and STAT3drive age-associatedtranscriptional Changes in the human kidney.PLoS genetics 11, e1005734 (2015)) and schizophrenia (Hashimoto,R.et al.Variants ofthe RelA gene are associated with schizophrenia And their startle responses.Neuropsychopharmacology 36,1921-1931 (2011)) it is related, Rs230530 and liver cancer (Gao, J.et al.Genetic polymorphism ofNFKB1andNFKBIA genes and liver cancer risk:a nested case–control study in Shanghai,China.BMJ open 4, E004427 (2014)) and alcohol dependence (Edenberg, H.J.et al.Association ofNFKB1, which encodes a subunit ofthe transcription factorNF-κB,with alcohol Dependence.Human molecular genetics 17,963-970 (2008)) it is related.However, closing both at home and abroad at present It is not yet reported that in the research of the polymorphism and hepatitis C infection neurological susceptibility in NF- κ B1 gene rs230530 mononucleotide site.

Summary of the invention

The object of the present invention is to provide a kind of NF- κ B access NF- κ B1 gene mononucleotide polymorphism rs230530 to prepare Application in detection or screening hepatitis C neurological susceptibility product.

Specifically, present invention firstly provides following any purposes:

(1) NF- κ B1 gene rs230530 single nucleotide polymorphism (i.e. allele) or genotype are being made in human genome Application in standby detection or screening hepatitis C neurological susceptibility product.

(2) NF- κ B1 gene rs230530 single nucleotide polymorphism (i.e. allele) or genotype are being made in human genome Application in the product of standby detection or screening single nucleotide polymorphism relevant to hepatitis C.

Secondly, the present invention also provides following any purposes:

(1) NF- κ B1 gene rs230530 single nucleotide polymorphism (i.e. allele) or genotype in human genome are detected Substance preparation detection or screening hepatitis C neurological susceptibility product in application.

(2) NF- κ B1 gene rs230530 single nucleotide polymorphism (i.e. allele) or genotype in human genome are detected Substance preparation detection or screening single nucleotide polymorphism relevant to hepatitis C product in application.

In the present invention, the substance of NF- κ B1 gene rs230530 single nucleotide polymorphism or genotype in human genome is detected Reagent or kit including can be used for detecting genotype in the prior art.Specifically, these substances are that this field is normal Reagent and reagent involved in detection methods rule, can be used for detecting NF- κ B1 gene rs230530 single nucleotide polymorphism Box.

The detection method of currently used human genome SNP parting includes: single-strand conformation polymorphism (SSCP), denaturation ladder Degree gel electrophoresis (DGGE), digestion amplification polymorphism sequence (CAPS), ApoE gene (including the present invention used TaqMan-PCR method parting) detection, gene direct Sequencing (Sanger method), DNA chip method, denaturing high-performance chromatography (DHPLC) and mass spectrography etc..Reagent used by different SNP classifying methods is had nothing in common with each other；And same class detection method, then root According to the study different testing goals, site and parting effect and select the primer of different designs, probe etc., obtain different detections The reagent or kit of genotype.

In the present invention, detection or screening hepatitis C neurological susceptibility product include NF- κ B1 gene in above-mentioned detection human genome The substance of rs230530 single nucleotide polymorphism or genotype can be reagent or kit, can also be reagent, kit The product obtained is combined with the combination product of instrument, such as primer and DNA sequencer, by TaqMan-PCR reagent, DNA sequencing reagent Detection or screening hepatitis C neurological susceptibility product are used for what DNA sequencer combination obtained.

In the present invention, the product of detection or screening single nucleotide polymorphism relevant to hepatitis C equally includes above-mentioned inspection The substance of NF- κ B1 gene rs230530 single nucleotide polymorphism or genotype in human genome is surveyed, can be reagent or reagent Box can also combine the product obtained for reagent, the combination product of kit and instrument, such as primer and DNA sequencer, by The detection or screening monokaryon relevant to hepatitis C that TaqMan-PCR reagent, DNA sequencing reagent and DNA sequencer combination obtain The product of nucleotide polymorphism.

The present invention also provides a kind of TaqMan PCR reagents, contain NF- κ B1 gene in amplification human genome The PCR primer and TaqMan MGB probe of genomic DNA fragment including rs230530.

Further, in TaqMan PCR reagent provided by the present invention, the PCR primer sequence is respectively such as SEQ ID Shown in NO.1 and SEQ ID NO.2；The TaqMan MGB probe sequence is respectively such as SEQ ID NO.3 and SEQ ID NO.4 institute Show, and 5 ' the equal mark fluorescent reporter groups in end of SEQ ID NO.3 and SEQ ID NO.4,3 ' ends mark non-fluorescence quenching Group and DNA minor groove binders MGB group.

In the present invention, rs230530 is the SNP site of a two equipotential polymorphisms on human chromosomal 4q23-q24, should Variation is conversion (A → G is then T → C on its complementary strand).The rs230530 genotype is AA, AG or GG.The AA is The site rs230530 is the wild-type genotype of A, and the GG is the homozygous mutant genotypes that the site rs230530 is G, and the AG is The site rs230530 is the heterozygous mutant gene type of A and G.The polymorphism or genotype of rs230530 in the detection human genome Concretely detect the nucleotide type of rs230530.Present specification embodiment shows: carrying rs230530AG genotype Ratio of the individual in hepatitis C infection person group, higher than corresponding genotype in the ratio being uninfected by HCV crowd, therefore Think, the risk of rs230530AG genotype carriers' HCV infection increases, and relative risk is 1.324 times, has statistics meaning Adopted (P=0.017)；And in dominant models, rs230530G allele and HCV neurological susceptibility to still remain statistics related, Relative risk is 1.346 times (P=0.005).

Further, NF- κ B1 gene rs230530 single nucleotide polymorphism in the above-mentioned detection human genome of the present invention is (i.e. etc. Position gene) or the substance of genotype include TaqMan-PCR reagent, which includes including expanding NF- κ B1 gene rs230530 Genomic DNA fragment PCR primer and TaqMan probe.

Further, the present invention in, the PCR primer refers to: forward primer nucleotide sequence as shown in SEQ ID NO.1, Reverse primer nucleotide sequence is as shown in SEQ ID NO.2；The TaqMan probe includes detecting the probe of wild allele A (Probe-A): holding mark fluorescent reporter group FAM the 5 ' of SEQ ID NO.3 sequence, 3 ' ends mark non-fluorescence quenching NFQ base Group and DNA minor groove binders MGB group；And the probe (Probe-G) of detection mutation allele G: in SEQ ID NO.4 sequence 5 ' end mark fluorescent reporter group VIC of column, 3 ' ends mark non-fluorescence quenching NFQ group and DNA minor groove binders MGB group.

In the present patent application, hepatitis C that the hepatitis C is refered in particular to as Chinese han population.

HCV infection person described in the present patent application (case group) is the merging of HCV self limiting removing and persistent infection Crowd, it may be assumed that treated without HCV-Ab IgG, and the crowd of HCV antibody positive (HCV RNA is negative or positive).It is as described herein to be uninfected by HCV crowd's (control group) is the non-HCV infection crowd of HCV negative antibody and HCV RNA feminine gender.

The end 5' for the TaqMan-MGB probe that the present invention uses is connected with fluorescent reporter group: 6- Fluoresceincarboxylic acid (FAM) Or chlordene -6- methylfluorescein (VIC), the end 3' be connected with non-fluorescence quenching group (non-fluorescent quencher, NFQ), fluorescence itself is not generated, but has the function of the emitted fluorescence of quenching fluorescence reporter group.It is also connected on probe DNA minor groove binders (minor groove binder, MGB) modification group, can ditch in intercalation of DNA double-spiral structure, shape At Non-covalent binding, the stability of hybridization chain is improved.TaqMan-MGB probe has higher sensitivity than conventional TaqMan probe Property and specificity, be detect single base mutation effective tool.

When PCR amplification just starts, probe is complete, and fluorescent reporter group is very close with quenching group, and fluorescence signal is quenched Go out group absorptions, can't detect fluorescence intensity at this time.When product to be measured carries out PCR amplification, Taqman probe elder generation and DNA profiling Sequence complementary portion combines, and with the progress of extension, Taq DNA polymerase is moved along template strand, row to fluorescent reporter group Position when, play 5 ' → 3 ' digestion activities probe is cut off, at this moment fluorescent reporter group is separated with quenching group, and generation can be examined The fluorescence signal measured.Release of the synthesis of the new chain of each PCR along with a fluorescence signal, signal strength and PCR product Quantity it is proportional.With being continuously increased for amplification number, the fluorescence signal intensity of release constantly enhances.It is examined by dynamic in real time Genotyping can be carried out to PCR product in sample well by surveying the fluorescence intensity emitted in reaction.

In the present invention, in the case group being made of 1456 HCV infection persons, and by 1125 it is uninfected by what crowd formed In control group, ratio of the individual of rs230530AG genotype in case group is carried, is higher than corresponding genotype in control group Ratio.That is, the risk of rs230530AG genotype carriers' HCV infection increases, relative risk is 1.324 times, With statistical significance (P=0.017)；And in dominant models, rs230530G allele is still deposited with HCV neurological susceptibility In statistics correlation, relative risk is respectively 1.346 times (P=0.005).In practical applications, rs230530 can be will test Polymorphism (i.e. allele) or genotype substance to other substances (as detected other monokaryon glycosides relevant with hepatitis C Sour polymorphism (i.e. allele) or genotype substance) it is united the product of preparation screening hepatitis C susceptible person.

In one embodiment of the present of invention, the genome including rs230530 is expanded using TaqMan-MGB sonde method DNA fragmentation uses ABI 7900HT type with two kinds of allele on two kinds of Taqman fluorescence probe label same gene sites Fluorescence quantitative PCR instrument detects the relative intensity of fluorescence of each sample well middle probe on 384 orifice plates, with terminal read plate program Interpretation genotyping result determines genotype according to the type of fluorescence signal and intensity, it can be achieved that high throughput etc. to great amount of samples Position Genotyping.

The present invention separately designs two different probes and positive, reverse primer, respectively according to the site SNPs to be detected Fluorescent marker is carried out to probe with FAM and VIC, and analyzes its specificity, it is ensured that other mankind's bases in every primer and database Because of no homology.When carrying out TaqMan-PCR reaction, if 2 site bases of 2 chromosome are identical, it is a kind of glimmering only to issue Light can be determined as homozygous genotype (AA or GG), and the type of homozygous gene can be distinguished according to different fluorescence signals: Wild type (AA) or homozygous mutant (GG)；When 2 polymorphic site base differences, can there are two types of fluorescence signal, show to The genotype of sample is heterozygous mutant (AG).Testing result is as shown in Fig. 1.

Present invention hair in a sample (1456 HCV infection persons and 1125 collators) from Chinese han population Existing NF- κ B1 gene rs230530 is single nucleotide polymorphism relevant to hepatitis C neurological susceptibility, can will test rs230530's The substance of single nucleotide polymorphism (i.e. allele) or genotype and other substances are (as other related with hepatitis C in detected Single nucleotide polymorphism (i.e. allele) or genotype substance) be united preparation screening hepatitis C susceptible person production Product.

Detailed description of the invention

Fig. 1 is Genotyping figure of the TaqMan-MGB sonde method to the site NF- κ B1 gene rs230530.

Specific embodiment

With reference to embodiment, the present invention is further described in detail, and the embodiment provided is only to explain The present invention is stated, the range being not intended to be limiting of the invention.

The embodiment of the present invention contains following materials, reagent, is commercially available unless otherwise specified.Below The nucleotide sequence that embodiment is related to:

SEQ ID NO.1 (site rs230530 forward primer sequence Forwardprimer):

AAAATGGACATACAAGCATTCTCCT；

SEQ ID NO.2 (site rs230530 reverse primer sequences Reverseprimer):

TGCAATAAATAAAGGCATATGGTGGT；

SEQ ID NO.3 (rs230530 site Probe-A): CAAACATCTTAATTTACATTC；

SEQ ID NO.4 (rs230530 site Probe-G): AAACATCTTAATTTGCATTC；

SEQ ID NO.5 (general primer): AGGAAGACTTCCGAGCGGTC；

SEQ ID NO.6 (HCV 1a genotype special primer): TGCCTGGGGATAGGCTGAC；

SEQ ID NO.7 (HCV 1b genotype special primer): GAGCCATCCTGCCCACCCCA；

SEQ ID NO.8 (HCV2 genotype special primer): CCAAGAGGGACGGGAACCTC；

SEQ ID NO.9 (3 genotype special primer of HCV): ACCCTCGTTTCCGTACAGAG；

SEQ ID NO.10 (HCV4 genotype special primer): GCTGAGCCCAGGACCGGTCG.

SEQ ID NO.11 (site rs3774963 forward primer sequence Forwardprimer):

TGGAAGGCATGGTGTTTGG；

SEQ ID NO.12 (site rs3774963 reverse primer sequences Reverseprimer):

TGTGACTGCTCCAGCCCATA；

SEQ ID NO.13 (rs3774963 site Probe-G): ATGTTCGACTCCCAC；

SEQ ID NO.14 (rs3774963 site Probe-C): ATGTTCCACTCCCAC.

Experimental method in embodiment is unless otherwise specified conventional method.

All research objects endorsed written informed consent form in following embodiment, and the scheme of this research is through Jiangsu Province The approval of Ethics Committee, the People's Hospital, meets physianthropy involved in the Declaration of Helsinki that World Medical Association in 2013 newly revises Clause (the WorldMedical Association.World Medical Association of the codes of ethics of research Declaration ofHelsinki:ethical principles for medical research involving human subjects.JAMA.2013,310(20):2191-2194.)。

Research object: following embodiment is included in total: (1) 898 HCV persistent infection persons: serum HCV antibody positive (being detected with the third generation ELISA method kit of Abbott company), and HCV RNA is positive, ALT raising or normal；(2) 558 HCV self limiting removing person: serum HCV antibody positive, and HCV RNA is negative, ALT raising or normal；(3) 1125 collators, Serum HCV negative antibody and HCV RNA feminine gender.Group (1) and group (2) are collectively referred to as infected group (case group).Control group and lasting sense Dye group, self limiting removing group are in age (< 5 years old), gender and the matching of geographic zone (city, township) aspect.Exclude concurrent infection other Hepatitis virus, HIV or the patient treated with antiviral drugs.During research, all serological results are with continuous 12 At least independent experimental verification three times during follow-up in a month.All subjects are by veteran doctor, clinical and real The number of chambers is tested on the basis of, with internationally recognized standard diagnostics.

The object of NF- κ B1 gene rs230530 single nucleotide polymorphism or genotype in the preparation detection human genome of embodiment 1 Matter

1, the extraction of genomic DNA

(1) EDTA anticoagulant tube collects patient 5ml peripheric venous blood blood, and 4000rpm is centrifuged 10min, separates serum, leucocyte And red blood cell, it numbers, is frozen in -80 DEG C spare one by one after packing.

(2) genomic DNA is extracted using phenol-chloroform method: takes the cell pyrolysis liquid of 3 times of volumes that haemocyte after centrifugation is added, Sufficiently oscillation mixes, and lysis at room temperature 5min, 4000rpm are centrifuged 10min, reject supernatant.

(3) observation precipitating color continues if red deeper plus cell pyrolysis liquid is handled, be crushed removal red blood cell, until Until centrifugal sediment is white or lightpink.

(4) Proteinase K Solution for taking 1ml genome DNA extraction liquid and 8 μ l adds in (3) resulting sediment, sufficiently After mixing, 37 DEG C of water-baths are stayed overnight.

(5) it takes out centrifuge tube to put to cooling, the Tris saturated phenol of 1ml is added, compressing pipe lid, turn upside down 15min, sufficiently It mixes, 4000rpm is centrifuged 10min.

(6) take supernatant to be transferred in another clean centrifuge tube, be added and the isometric chloroform of supernatant: isoamyl alcohol is mixed It closes liquid (24:1), compressing pipe lid, turn upside down 15min, mixes well, and 4000rpm is centrifuged 10min, takes supernatant, average mark is loaded on 2 clean centrifuge tubes.

(7) the NaAC solution (3mol/L) of 1/10 volume is added, light rotation mixes well.It is pre- to add isometric -20 DEG C Cold ice dehydrated alcohol, for several times, naked eyes visible white flocculent deposit is centrifuged upper and lower gentle inversion with 8000~10000rpm 10min abandons supernatant.

(8) the ice dehydrated alcohol 1ml of -20 DEG C of pre-coolings is added again in the sediment of white, compressing pipe lid shakes up and down It swings, washes away inside pipe wall DNA and fall in pipe in solution.10min is centrifuged with 12000rpm again, abandons supernatant, repetitive operation is primary.

(9) it is inverted centrifuge tube and drains ethyl alcohol in the dry 20min of clean filter paper, or to be dried in vacuo instrument.

(10) 100 μ l TE buffers are added, overnight in 4 DEG C, after DNA is completely dissolved, after checking digit one by one, are placed in 4 DEG C refrigerator.

(11) 200 μ l DNA solutions are taken, 100 μ l are diluted to, with determined by ultraviolet spectrophotometry OD₂₆₀And OD₂₈₀Extinction Angle value, with OD₂₆₀Determine that DNA concentration, l~20ng/ μ l meet requirement of experiment；With OD₂₆₀/OD₂₈₀Ratio determines the purity of DNA, Meet requirement of experiment between 1.8-1.9.

(12) it according to surveyed DNA concentration, takes and is diluted to 50-200ng/ μ l in right amount, after mixing well DNA, be placed in 4 DEG C of ice Case saves, and for using when PCR or Taqman method SNP Genotyping, the DNA original solution of remaining high concentration freezes in -20 DEG C.

2, HCV RNA is extracted

(1) 300 μ l serum are taken, the RNA iso Plus of 1ml is added, concussion mixes, and is stored at room temperature 5min.

(2) 200 μ l chloroforms are added in Eppendorf pipe, finger compressing pipe lid acutely vibrates 15s, keeps liquid in pipe abundant Emulsification, is no longer layered, room temperature stands 5min again.

(3) it is placed in high-speed refrigerated centrifuge, 4 DEG C, 12000rpm, is centrifuged 15min.

(4) supernatant after centrifugation is drawn, avoids being drawn onto middle white layer, be added in new clean Eppendorf pipe, Then isometric isopropanol is added, is mixed by inversion, is stored at room temperature 10min.

(5) it is placed in high-speed refrigerated centrifuge, 4 DEG C, 12000rpm, is centrifuged 10min.

(6) it is sucked out and abandons supernatant, be slowly added to 75% ethyl alcohol of 1ml along Eppendorf tube wall, gently overturn washing tube wall.

(7) it is placed in high-speed refrigerated centrifuge, 4 DEG C, 12000rpm, is centrifuged 5min, exhaust supernatant.

(8) it is stored at room temperature 10min, it is drying precipitated, it is added suitable quantity of water (RNase-free), is gently blown and beaten, made with liquid-transfering gun Sufficiently, -80 DEG C freeze precipitating.

3, HCV RNA amplification

Take HCV RNA obtained in 5 μ l previous steps as template, 70 DEG C of initial denaturation 10min, ice bath 5min are sequentially added Following reagent: 5 × buffer, 4 μ l, 1 μ l of 10mmol/L dNTP, 0.5 μ l of 20U/ μ l RNase, 50pmol/ μ l downstream primer 0.5 μ l, 2 μ l of 0.1mol/L dithiothreitol (DTT) (DTT), 1 μ l of M-MLV reverse transcriptase, going out for pyrocarbonic acid diethyl ester (DEPC) is added 11 μ l of bacterium water, 20 μ l of reaction system total volume.37 DEG C of reverse transcriptions 1h, 95 DEG C of inactivations 5min, rapid ice bath 5min.

4, HCV RNA is quantitative

HCV RNA is by the Cobas TaqMan HCV Test kit quantification of Roche Holding Ag, the U.S., specific behaviour in blood sample Make step to carry out by kit specification.

5, HCV Genotyping

(1) Genotyping of HCV RNA positive patient:

Above-mentioned 5 μ l of amplified production is taken, is separately added into 5 Eppendorf pipes, every pipe contains 0.5 μ l general primer (nucleosides Acid sequence is as shown in SEQ ID NO.5) and the special core gene code area primer containing type reaction mixture, overall reaction system For 50 μ l.

Nested PCR amplification condition: 94 DEG C of initial denaturation 3min, then 94 DEG C of 1min, 58 DEG C of 1min, 72 DEG C of 1min are followed for 35 totally Ring, 72 DEG C of extension 10min.It takes 5 μ l amplified productions to carry out agarose gel electrophoresis, HCV genotype is judged according to clip size.

1 HCV genotype detection primer of table

(2) Genotyping of HCV RNA negative patient

Using Murex HCV Serotyping 1-6Assay ELISA kit, with anti-based on HCV virus type specificity The ELISA method of body to the self limiting of HCV RNA feminine gender remove patient carry out the detection of HCV Genotyping (Bhattacherjee V, Prescott L,Pike I,et al.Use ofNS-4peptides to identify type-specific antibody to hepatitis C virus genotypes 1,2,3,4,5and 6[J].Journal of general virology, 1995,76(7):1737-1748.)。

Testing principle and briefly steps are as follows: the polypeptide sequence of 2 of the area HCV non-structural district NS4 height variations, have with The special linear epitope of 1~6 genotype of HCV, the special polypeptide antigen of artificial synthesized 1~6 type, is coated with microwell plate accordingly. It sequentially adds and neutralizes antigen and serum specimen.Neutralizing antigen has 7 kinds of different types, and one kind includes all 6 type antigens, and remaining every kind 5 species-specific antigens in 1~6 type are contained only, and successively lack a certain type antigen in 1~6 type, neutralizing antibody is pressed into micro plate The sequence of F to A, every row sequentially add, and as contained 1 type antibody in sample, then cannot be lacked in the neutralization antigen of 1 type antigen With, and the 1 type antigen binding with coating microwell plate.

After 37 DEG C of incubation 1h of mixed liquor, washing removal unbonded material, the specific antibody of capture, then marked with HRP Two anti-igg combine, and after 37 DEG C of 1h, chromogenic substrate are added, measures OD value at 450nm with microplate reader.If being not added with neutralization antigen It is the control hole H, is added in all 6 types and antigen is the control hole G, with " OD_H/OD_G≥0.1”、“OD_Sample/OD_G≥0.4” Antibody typing is confirmed as a result, concrete operations and result judgement by specification carry out.

6, SNP candidate locus is screened

The snp database of downloading BeiJing, China crowd (CHB), leads in HapMap (http://www.hapmap.org) Enter HaploView software to select Tag SNP (Tag SNP): parameter setting is incidence coefficient r²Greater than 0.8；In Chinese population With upper frequency, i.e., minimum gene frequency (minor allele frequency, MAF) is greater than 0.05.In view of neighbour Nearby sequence may have regulating and controlling effect to gene in nearly sequence especially upstream promoter area, include respectively it by each candidate gene Transcripting start point upstream 2000bp and downstream 2000bp sequence are included in analysis.In addition, selection may influence in conjunction with relevant document The Tag SNP site of gene function.According to the above principle, the present embodiment has selected 2 candidate locus: rs3774963 and rs230530。

NF- κ B1 gene is located at human chromosomal 4q23-q24, contains 24 exons and 23 intrones, rs230530 The deep regional and No. 15 intrones of No. 3 intrones of NF- κ B1 gene are located at rs3774963.

7, SNP site Genotyping

(1) according to the site SNPs of human genome NF- κ B1 gene rs230530, forward primer (such as SEQ ID is separately designed Shown in NO.1) probe different with two with reverse primer (as shown in SEQ ID NO.2), i.e., respectively with FAM and VIC to probe Carry out the fluorescent marker (probe of detection wild-type allele A: nucleotide sequence shown in SEQ ID NO.3, and the connection of the end 5' There is fluorescent reporter group FAM, 3 ' ends mark non-fluorescence quenching NFQ group and DNA minor groove binders MGB；Detect mutant allele The probe of gene G: nucleotide sequence shown in SEQ ID NO.4, and the end 5' is connected with fluorescent reporter group VIC, 3 ' end labels Non-fluorescence quenching NFQ group and DNA minor groove binders MGB), and analyze its specificity, it is ensured that its in every primer and database Its human gene is without homology.

According to the site SNPs of human genome NF- κ B1 gene rs3774963, forward primer (such as SEQ ID is separately designed Shown in NO.11) probe different with two with reverse primer (as shown in SEQ ID NO.12), i.e., respectively with FAM and VIC to spy Needle carries out the fluorescent marker (probe of detection wild-type allele G: nucleotide sequence shown in SEQ ID NO.13, and the end 5' It is connected with fluorescent reporter group FAM, 3 ' ends mark non-fluorescence quenching NFQ group and DNA minor groove binders MGB；Detect saltant type The probe of allele C: nucleotide sequence shown in SEQ ID NO.14, and the end 5' is connected with fluorescent reporter group VIC, 3 ' ends Mark non-fluorescence quenching NFQ group and DNA minor groove binders MGB), and analyze its specificity, it is ensured that every primer and database In other human genes without homology.

(2) DNA sample to be measured is uniformly diluted to 10ng/ μ l, packing to 96 orifice plates is loaded for the subsequent volley of rifle fire. Primer and probe dry powder is centrifuged 5min with 12000rpm, pipe lid is gently opened after centrifugation, in case dry powder sprays after uncapping. Then suitable aseptic double-distilled water is added, dilution probe/primer to prescribed concentration, sufficiently oscillation make to mix.

(3) probe, primer, PCR Master Mix solution 12000rpm are centrifuged 30 seconds, are mixed respectively.It is dispensed into 96 holes The DNA sample of plate is also mixed with microwell plate special centrifugal machine centrifugation 1min.Then it is as shown in table 2 to prepare PCR system:

2 Taqman PCR system of table is prepared

Above-mentioned 2 system of table is to detect NF- κ B1 gene rs230530 single nucleotide polymorphism or genotype in human genome Substance；The above-mentioned substance obtained in the present embodiment is the genome including the amplification site NF- κ B1 gene rs230530 Other also can be used in specific implementation in the PCR primer of DNA fragmentation and the TaqMan PCR reagent of TaqMan MGB probe The reagent or kit of the conventional detection SNP genotype in this field.

The application of 2 NF- κ B1 gene rs230530 single nucleotide polymorphism of embodiment or genotype

1, detecting step

NF- κ B1 gene rs230530 single nucleotide polymorphism or genotype in the detection human genome that embodiment 1 is obtained Substance (i.e. according to the prepared system solution of 2 system of table) packing to 8 sterile PCR pipes.Adjustment volley of rifle fire range is 5 μ l, is taken System liquid is added in 384 orifice plates, finally adds 1 hole μ l/ of DNA sample.2 blank controls (aseptic double-distilled water) of every plate setting, 2 A known positive control, to control reagent, systemic contamination and testing result.

(1) with dedicated Taqman PCR sealer, excellent 384 orifice plate will be added to obturage, and will be centrifuged 1min.It is packed into 7900HT type Fluorescence quantitative PCR instrument, PCR reaction condition is arranged: 50 DEG C of initial denaturation 5min, 95 DEG C of beginnings are denaturalized 10min, and 95 DEG C are annealed 30 seconds, and 60 DEG C extend 30 seconds, 35 circulation.

(2) PCR after reaction, with Applied Biosystems company on 7900HT fluorescence quantitative PCR instrument Sequence Detection System software (SDS, version 2 .3) reads genotypic results.

The Genotyping success rate in the site of 2 SNP is about 95%.

When carrying out TaqMan-PCR reaction, if 2 polymorphic site bases are identical, only issue a kind of fluorescence, it can It is determined as homozygous genotype, and the type of homozygous gene: wild-type genotype or homozygosis can be distinguished according to different fluorescence signals Saltant type；When 2 polymorphic site base differences, it can show the SNPs gene that sample to be tested carries there are two types of fluorescence signal Type is heterozygous mutant.Rs230530 genotype call results are as shown in Fig. 1, and in Fig. 1, AA indicates the wild AA genotype of table, AG represents heterozygous mutant AG genotype, and GG represents homozygous mutation GG genotype.

2, quality controls

All research participants are recorded using construction standard questionnaire interview.Questionnaire has collected what document was reported The Major Risk Factors of HCV infection, including gender, age, area, HCV infection history, hepatitis environmental risk factor exposure history.This Epidemiological survey operation manuals and experiment standardized testing operating instruction have been studied and defined, it is unified to train all staff on board, To guarantee the quality of data of survey data and experimental determination in this research.All application forms and data are encoded by staff, Two people respective independent input computer establishes database after both sides' review is errorless.All testing results are by two researchers with blind Both method carries out interpretation respectively, i.e., does not know the clinic and other data of surveyed samples sources patient.To the unsuccessful or interpretation of detection The sample having a question repeats to test, consistent until measuring result.Every group randomly select respectively 5% sample repeat detect, unanimously Rate is up to 100%.

3, it statisticallys analyze

Two staff are with 3.1 software double track typing questionnaire data of EpiData and testing result, through logical check core To rear, database is established, is further analyzed with SPSS software (version 2 1.0) and Stata (version 13).Quantitative variable is with average Being worth (mean) ± standard deviation (SD) or median (quartile spacing (IQR)) indicates.Demography between case group and control group Feature, the difference of HCV patient's biological indicator and the genotypes distribution and allele frequencies, with chi-square criterion, one-way analysis of variance (One- Way ANOVA) or nonparametric Kruskal-Wallis inspection.Goodness of fit Pearson's chi-square criterion is for assessing control group Whether genotype distribution meets Hardy-Weinberg balance.Multifactor Logistic regression analysis calculates odds ratio (ORs) With 95% confidence interval (CIs), the high risk factor of HCV infection is analyzed.Chromatographic analysis is for controlling Confounding Factor to statistical result Influence.Multiple range test is corrected with Bonferroni method, the method is most conservative, and value < 0.025 bilateral P has statistical significance.It is non- At Multiple range test, value < 0.05 bilateral P has statistical significance.

4, the social demography of research object and Clinical symptoms

The social demography of all research objects and Clinical symptoms are as shown in table 3.Persistent infection group includes 874 patients (341 males, 533 women, average age are 49.73 ± 10.96 years old).Self limiting virus sweep group includes 557 people (225 Name male, 332 women, average age are 49.01 ± 13.54 years old).Control group includes 1124 person of being uninfected by (422 male Property, 702 women, average age is 49.54 ± 14.48 years old).Age and gender between three groups be not significantly different (P > 0.05), ALT is horizontal between three groups, AST is horizontal, route of infection is there are significant difference (P < 0.001), and persistent infection group and There are significant difference (P < 0.001) for the virus infection type of self limiting removing group.

3 HCV persistent infection group of table, the demography and Clinical symptoms of self limiting removing group and control group

Remarks: Group A: control group (is uninfected by group), Group B: self limiting removing group, Group C: persistent infection Group, Group (B+C): infected group (case group).Mean: average value；SD: standard deviation；ALT: alanine aminotransferase； AST: aspartate amino transferase；IQR: quartile spacing；A one-way analysis of variance (One-WayANOVA)；B χ 2- inspection It tests；CKruskal-Wallis is examined.

5, Hardy-Weinberg genetic equilibrium is examined

2 SNP sites (rs3774963 and rs230530) involved in this research are uninfected by group as a control group, Rs230530:P=0.063；Rs3774963:P=0.303.P is all larger than 0.05, illustrates 2 sites in the distribution frequency of control group Rate meets Hardy-Weinberg balance, and control group has crowd representative.

6, the association analysis of NF- κ B pathway gene polymorphism and HCV infection neurological susceptibility

The genotype distribution frequency of 2 SNP sites (rs3774963 and rs230530) and with three in NF- κ B pathway gene Kind of genetic model (additive model, dominant models and recessive model) analysis SNP and HCV infection neurological susceptibility, being associated with of lapsing to are shown in Table 4。

The site SNPs and HCV infection neurological susceptibility, the Logistic regression analysis lapsed in 4 NF- κ B signal pathway gene of table

Remarks: CI: confidence interval, HCV: Hepatitis C Virus, OR: odds ratio, SNP: single nucleotide polymorphism.

Group A: control group (is uninfected by group), Group B: self limiting removing group, Group C: persistent infection group, Group (B+C): infected group (case group).

^aLogistic returns P value, OR value and 95% confidence interval adjusted, and adjustment factor is gender, age and infection Approach.^bLogistic returns P value, OR value and 95% confidence interval adjusted, and adjustment factor is gender, age and infection way Diameter.Multiple range test is corrected using Bonferroni method, P < 0.025 (0.05/2) is to have statistical difference.

Font-weight person is that data have statistical difference.

After Logistic returns that adjustment gender, age, ALT be horizontal and route of infection these Confounding Factors, discovery is carried Ratio of the individual of rs230530AG genotype in case group (persistent infection group and self limiting removing group), is higher than AG gene Ratio of the type carrier in control group (being uninfected by HCV crowd).That is the risk of rs230530AG genotype carriers HCV infection It increases, relative risk is 1.324 times, is had statistical significance (P=0.017)；In dominant models, rs230530G equipotential Gene is related to HCV neurological susceptibility, and relative risk is respectively 1.346 times, has statistical significance (P=0.005).It does not find Rs3774963 (P value equal > 0.025, Bonferroni method correction) related to HCV neurological susceptibility.

Using gender, age, route of infection as classification factor, the site rs230530 in NF- κ B pathway gene and HCV are felt Dye neurological susceptibility lapses to the further chromatographic analysis of risk, is shown in Table 5.

The site rs230530 in 5 NF- κ B signal pathway gene of table and HCV infection neurological susceptibility, the layering point for lapsing to relationship Analysis

Remarks: HCV: Hepatitis C Virus, CI: confidence interval, OR: odds ratio, SNP: single nucleotide polymorphism.

Group A: control group (is uninfected by group), Group B: self limiting removing group, Group C: persistent infection group, Group (B+C): infected group (case group).

^aLogistic returns P value, OR value and 95% confidence interval adjusted, and adjustment factor is gender, age, infection Approach.^bLogistic returns P value, OR value and 95% confidence interval adjusted, and adjustment factor is gender, age, infection way Diameter.Font-weight person is that data have statistical difference.

Study population presses average age, is divided into < 50 years old and >=50 years old subgroup, for further analyzing.As shown in table 5, In women subgroup and paid blood donation subgroup, rs230530G allele and HCV neurological susceptibility there are statistical correlations (P value < 0.05), the relative risk of women subgroup is 1.464 times (P=0.007), and the relative risk of paid blood donation subgroup is 1.386 Again (P=0.049).

7, the association analysis that NF- κ B pathway gene polymorphism and HCV self limiting are removed

Adjustment gender, age, ALT horizontal, virogene type and route of infection these Confounding Factors are returned through Logistic Afterwards, do not find that the genotype distribution frequency of rs3774963 and rs230530 has statistics related to the removing of the self limiting of HCV infection (P is equal > and 0.05, table 4, table 5).

Therefore, it is applicant's understanding that the single nucleotide polymorphism and hepatitis C neurological susceptibility phase of NF- κ B1 gene rs230530 Close, in specific implementation, using NF- κ B1 gene rs230530 polymorphism preparation screening hepatitis C susceptible person product or The product of detection or screening single nucleotide polymorphism relevant to hepatitis C, the mononucleotide that such as will test the rs230530 are more State property or the substance (Taqman PCR system as described in Table 2) of genotype and other substance (such as other detections and hepatitis C phases The single nucleotide polymorphism of pass or the substance of genotype) or instrument be united preparation screening hepatitis C susceptible person product Detection or screening single nucleotide polymorphism relevant to hepatitis C product, have broad application prospects.

Sequence table

<110>No.1 Attached Hospital, Nanjing Medical Univ

Nanjing Medical University

Gulou Hospital Attached to Medical College of Nanjing Univ.

<120>application of the NF- κ B1 gene rs230530 SNP in preparation detection hepatitis C neurological susceptibility product

<141> 2017-10-30

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

aaaatggaca tacaagcatt ctcct 25

<210> 2

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

tgcaataaat aaaggcatat ggtggt 26

<210> 3

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

caaacatctt aatttacatt c 21

<210> 4

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

aaacatctta atttgcattc 20

<210> 5

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

aggaagactt ccgagcggtc 20

<210> 6

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

tgcctgggga taggctgac 19

<210> 7

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

gagccatcct gcccacccca 20

<210> 8

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

ccaagaggga cgggaacctc 20

<210> 9

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

accctcgttt ccgtacagag 20

<210> 10

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

gctgagccca ggaccggtcg 20

<210> 11

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

tggaaggcat ggtgtttgg 19

<210> 12

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

tgtgactgct ccagcccata 20

<210> 13

<211> 15

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

atgttcgact cccac 15

<210> 14

<211> 15

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

atgttccact cccac 15

Claims (3)

1. detecting the substance of NF- κ B1 gene rs230530 single nucleotide polymorphism or genotype in human genome to detect in preparation Or the application in screening Hepatitis C Virus neurological susceptibility product；It includes NF- κ B1 in human genome that the substance, which includes for expanding, The PCR primer and TaqMan MGB probe of genomic DNA fragment including gene rs230530.

2. application according to claim 1, which is characterized in that the PCR primer sequence respectively such as SEQ ID NO.1 and Shown in SEQ ID NO.2；The TaqMan MGB probe sequence respectively as shown in SEQ ID NO.3 and SEQ ID NO.4, and 5 ' the equal mark fluorescent reporter groups in end of SEQ ID NO.3 and SEQ ID NO.4,3 ' ends mark non-fluorescence quencher and DNA minor groove binders MGB group.

3. a kind of PCR containing the genomic DNA fragment in amplification human genome including NF- κ B1 gene rs230530 draws The TaqMan PCR reagent of object and TaqMan MGB probe, the PCR primer sequence is respectively such as SEQ ID NO.1 and SEQ ID Shown in NO.2；The TaqMan MGB probe sequence is respectively as shown in SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID 5 ' the equal mark fluorescent reporter groups in end of NO.3 and SEQ ID NO.4,3 ' ends mark non-fluorescence quencher and DNA ditch Conjugate MGB group.