CN107574240A

CN107574240A - One NF κ B1 gene insertion/deletion site is preparing the application in detecting hepatitis C neurological susceptibility product

Info

Publication number: CN107574240A
Application number: CN201711041892.XA
Authority: CN
Inventors: 岳明; 李军; 喻荣彬; 张津玮; 金柯; 张云; 樊圆圆; 凡豪志; 韩亚萍
Original assignee: Jiangsu Province Hospital First Affiliated Hospital With Nanjing Medical University; Nanjing Medical University; Nanjing Drum Tower Hospital
Current assignee: Nanjing University; Jiangsu Province Hospital First Affiliated Hospital With Nanjing Medical University; Nanjing Medical University; Nanjing Drum Tower Hospital
Priority date: 2017-10-30
Filing date: 2017-10-30
Publication date: 2018-01-12

Abstract

The invention discloses the application of a kind of NF κ B1 gene rs28362491 insertion/deletions of NF κ B paths in human genome or genotype in detection or the product of examination hepatitis C neurological susceptibility product or the SNP related to hepatitis C is prepared；In actual applications, rs28362491 polymorphism will can be detected（That is allele）Or genotype material and other materials（Such as detect the other SNPs or genotype material related to hepatitis C）It is united the product for preparing examination hepatitis C susceptible person.

Description

One NF- κ B1 gene insertion/deletion site is preparing detection hepatitis C Application in neurological susceptibility product

Technical field

The present invention relates to biomedicine field, the NF- κ B1 genes of NF- κ B paths in particularly a kind of human genome Rs28362491 insertion/deletions site is preparing the application in detecting hepatitis C neurological susceptibility product.

Background technology

Gene pleiomorphism (genetic polymorphism) refers on the gene level of a biocenose, same There is more than one genetic mutation in position, different genetic mutation forms is referred to as genotype (genotype) or allele (allele).Gene pleiomorphism includes following several：SNP (single nucleotide Polymorphisms, SNPs), insertion/deletion (insertion/deletion, InDel or I/D) polymorphism, DNA repeat sequence Row polymorphism.SNP refers to the change of nucleotide sequence caused by single nucleotide acid mutation.InDel polymorphisms refer to gene The insertion of specific DNA fragments or missing in group, it and SNP polymorphisms are all two equipotential gene genetics marks.According to DNA fragmentation Size, InDel polymorphisms can be divided into following five class：The InDel of (1) 1 base-pair (base pairs, bps)；(2) single bp InDel；(3) InDel using 2-15bps as more bps of repeat unit；(4) transposons InDel；(5) any DNA sequence InDel.InDel polymorphisms may cause the unconventionality expression of functional protein, and then relevant with the physiological health of organism or disease. The various polymorphisms of human genome, which result in not agnate, crowd DNA sequence, has diversity, also results in people Body to the neurological susceptibility of disease, course advancement, lapse to, and medication effect has differences.InDel polymorphisms have been considered as at present A kind of genetic marker, available for research hereditary variation and the relation of human diseases.

Viral hepatitis type C is a kind of virus hepatitis as caused by HCV (HCV) infection.The whole world is shared 1.85 hundred million HCV infection persons, Chinese HCV infection rate is about 1.6%, and blood transfusion, Injecting Drug User, organ transplant and haemodialysis are As domestic main HCV routes of transmission.HCV acute infections can have two kinds of different final results：Viral self limiting is removed and continued Sexuality dye.It is body untreated, automatic clear in after infection 12 months after self limiting removing person refers to HCV infection human body Except HCV, so as to from persistent infection, show as HCV RNA feminine genders, HCV antibody positives.Persistent infection refers to that HCV feels After contaminating human body, body untreated, HCV can not be removed in after infection 12 months, show as the HCV RNA positives, HCV antibody It is positive.HCV infection person more than 70% can develop into persistent infection, and a portion patient is also possible to develop into liver hard Change, hepatocellular carcinoma (HCC).

The disease development of HCV infection person and lapse to and be able to can be influenceed by many factors, including virus, host immune and it is hereditary because Element.In the past few years, in the multinomial large-scale clinical trials in the whole world, new direct antiviral drugs (direct-acting Antiviral agents, DAAs) cure rate of chronic hepatitis C improved significantly to more than 95%, it has also become traditional poly- second two Alcohol interferon+ribavirin therapy scheme is more preferably selected.However, with the application of DAAs medicines, constantly there is new problem to emerge in large numbers： HBV/HCV concurrent infections person can cause HBV reactivations using DAA medicines；The liver that persistent virus response (SVR) is obtained in part is hard Change in patient, DAAs application can not reduce HCC incidence；DAAs treats the generation that can also result in resistance, true at present Resistance related mutation (resistance associated variants, the RAVs) site recognized include NS3/4A target spots it is related, Related tens RAVss related to NS5B target spots of NS5A target spots.

It is examination, identification Susceptible population in view of preventing the matter of utmost importance that HCV is propagated.Therefore, Chinese population heredity is carried out The research of the relation of background and HCV infection, for further investigation inherent cause hepatitis course advancement mechanism of action, be and When, effective prevention and control hepatitis is popular provides effective target spot, instrument and theoretical foundation, have important practical significance.

NF- κ B are nuclear factors, have and some genes on promoter region specific nucleotide sequence with reference to and start Genetic transcription, the function of adjusting cell propagation, apoptosis, inflammatory process and immune response.NF- κ B can be by bacterium/viral antigen, thin Many stimulant activation such as intracellular cytokine, then adjust the expression of 150 several genes.NF- κ B/ReL family members have c-ReL, NF- κB1(P50)、NF-κB2(P52)、RelA(P65)、ReLB.These albumen are by the ammonia being about made up of 300 amino acid Base end, referred to as ReL homologous regions, including DNA binding sites, Dimerized position and with NF- κ B suppress albumen (I κ B) bound site Point.The NF- κ B that active DNA is combined are P50 and P65 dimers.Homologous or heterodimeric can be formed between ReL protein members Body, different NF- κ B/ReL albumen dimers have different binding sequences, and respectively have characteristic, and homodimer not can recognize that Different DNA target targets, and the ability to express of different adjustment gene is improved.NF- kB proteins P50/P65, P50/c- ReL, P65/c-ReL complex have transcriptional activation, and P50/P50 and P52/P52 homodimers then have transcription suppression Make and use.

Now there are some researches show NF- κ B family genes (NF- κ B1, NF- κ B2, RelA, RelB, Rel) and its suppressor I κ B may be had an impact by related SNP s to host to HCV neurological susceptibility and the immune response of interior resisting virus.2014, have Research shows that NF- κ B ε (IkB ε) rs2233437-A significantly improves host HCV from Scavenging activity is limited, and has prompted NF- κ B path phases Correlation gene polymorphism may be lapsed to exist with HCV infection and associated.Recent study discovery, NF- κ B1 gene promoter areas ATTG deletion forms allele in rs28362491 (ATTG insertions/ATTG missings) can raise with the liver cancer risk of Chinese population Relevant (Wang X, Hao X, Wang H, et al.Impact of NFKB1 and NFKBIA gene polymorphism and additional gene-gene interaction on liver cancer risk in Chinese population.INTERNATIONAL JOURNAL OF CLINICAL AND EXPERIMENTAL PATHOLOGY 2016, 9:12968-12975.)；Morocco's Institute Pasteur finds that the deletion Genotype also develops into chronic liver disease with chronic hepatitis C Relevant (Fakhir F-Z, Lkhider M, Badre W, the et al.The-94Ins/DelATTG polymorphism of progress in NFκB1 promoter modulates chronic hepatitis C and liver disease progression.Infection,Genetics and Evolution 2016,39:141-146.).Experiment in vitro shows, Rs28362491 ATTG deletion forms allele can cause nucleoprotein to combine decrease, i.e. promoter activity reduces (Karban AS,Okazaki T,Panhuysen CI,et al.Functional annotation of a novel NFKB1 promoter polymorphism that increases risk for ulcerative colitis[J].Human molecular genetics,2004,13(1):35-45.).In addition, the loci polymorphism also with ulcerative colitis (Karban AS,Okazaki T,Panhuysen CI,et al.Functional annotation of a novel NFKB1 promoterpolymorphism that increases risk for ulcerative colitis[J] .Human molecular genetics,2004,13(1):35-45.), dilated cardiomyopathy (Bin Zhou, Li Rao, Ying Peng,et al.Functional polymorphism of the NFKB1gene promoter is related to the risk of dilated cardiomyopathy[J].BMC Med Genet,2009,1186:1471-2350.) It is related etc. a variety of diseases.However, the hepatitis C sense on NF- κ B1 gene rs28362491 polymorphisms and Chinese population at present The research of dye neurological susceptibility correlation is not yet reported that.

The content of the invention

It is an object of the invention to provide a kind of NF- κ B paths NF- κ B1 gene insertion/deletions rs28362491 to exist Prepare the application in detection or examination hepatitis C neurological susceptibility product.

Specifically, present invention firstly provides following any purposes：

(1) NF- κ B1 gene rs28362491 insertion/deletions (i.e. allele) or genotype in human genome Application in detection or examination hepatitis C neurological susceptibility product is prepared.

(2) NF- κ B1 gene rs28362491 insertion/deletions (i.e. allele) or genotype in human genome Application in the product of preparation detection or the examination SNP related to hepatitis C.

Secondly, present invention also offers following any purposes：

(1) NF- κ B1 gene rs28362491 insertion/deletions (i.e. allele) or base in human genome are detected Because type material prepare detection or examination hepatitis C neurological susceptibility product in application.

(2) NF- κ B1 gene rs28362491 insertion/deletions (i.e. allele) or base in human genome are detected Because of application of the material in the product for preparing detection or the examination SNP related to hepatitis C of type.

In the present invention, NF- κ B1 gene rs28362491 insertion/deletions or genotype in human genome are detected Material includes can be used for the reagent or kit for detecting genotype in the prior art.Specifically, these materials are ability Domain it is conventional, can be used for detecting examination involved by the detection method of NF- κ B1 gene rs28362491 insertion/deletions Agent and kit.

The detection method of currently used human genome Genotyping includes：Single-strand conformation polymorphism (SSCP), denaturation Gradient gel electrophoresis (DGGE), digestion amplification polymorphism sequence (CAPS), ApoE gene (including the present invention adopted TaqMan-PCR methods parting) detection, gene direct Sequencing (Sanger methods), DNA chip method, denaturing high-performance chromatography And mass spectrography etc. (DHPLC).Reagent is had nothing in common with each other used by different SNP classifying methods；And same class detection method, then root According to the study different testing goals, site and parting effect and select primers of different designs, probe etc., it is different to obtain detection The reagent or kit of genotype.

In the present invention, detection or examination hepatitis C neurological susceptibility product include NF- κ B1 genes in above-mentioned detection human genome It the material of rs28362491 insertion/deletions or genotype, can be reagent or kit, can also be reagent, examination The combination product of agent box and instrument, as primer and DNA sequencer combination obtain product, by TaqMan-PCR reagents, DNA sequencing What reagent and DNA sequencer combination obtained is used for detection or examination hepatitis C neurological susceptibility product.

In the present invention, the product of detection or the examination SNP related to hepatitis C equally includes above-mentioned inspection Survey human genome in NF- κ B1 gene rs28362491 insertion/deletions or the material of genotype, can be reagent or Kit, the product obtained can also be combined for the combination product of reagent, kit and instrument, such as primer and DNA sequencer, by TaqMan-PCR reagents, DNA sequencing reagent and DNA sequencer combine the detection of acquisition or the monokaryon that examination is related to hepatitis C The product of nucleotide polymorphism.

Present invention also offers a kind of TaqMan PCR reagents, and it contains NF- κ B1 genes in amplification human genome The PCR primer and TaqMan MGB probes of genomic DNA fragment including rs28362491.

Further, in TaqMan PCR reagents provided by the present invention, the PCR primer sequence is respectively such as SEQ ID Shown in NO.1 and SEQ ID NO.2；The TaqMan MGB probe sequences are respectively such as SEQ ID NO.3 and SEQ ID NO.4 institutes Show, and SEQ ID NO.3 and SEQ ID NO.4 5 ' the equal mark fluorescent reporter groups in end, 3 ' ends mark non-fluorescence quenching Group and DNA minor groove binders MGB groups.

In the present invention, rs28362491 is the SNP site of a two equipotential polymorphisms on human chromosomal 4q23-q24, The variation is insertion/deletion mutation (insertion/deletion, I/D).The rs28362491 genotype be II, ID or DD.The II is wild-type genotype of the rs28362491 sites for insert type I (i.e. ATTG sequences are inserted in the site), and the DD is Rs28362491 sites are deletion form D (i.e. site deletion ATTG sequences) homozygous mutant genotypes, and the ID is Rs28362491 sites are that (i.e. the site is the insertion of ATTG sequences in the genotype of item chromosome to insertion I and missing D, another The genotype of bar chromosome is ATTG sequence deletions) heterozygous mutant gene type.Rs28362491 in the detection human genome Polymorphism or genotype concretely detect rs28362491 nucleotides species.Present specification embodiment shows：Take Ratio of the individual in HCV infection person colony with rs28362491ID genotype, HCV people is being uninfected by higher than corresponding genotype Ratio in group, result, it is believed that the risk rise of rs28362491ID genotype carriers' HCV infections, relative risk are 1.282 again, there is statistical significance (P=0.047)；And in dominant models, rs28362491 deletion forms D and HCV neurological susceptibilities Still exist statistics correlation, relative risk is respectively 1.281 times (P=0.035).

Further, NF- κ B1 gene rs28362491 insertion/deletion (i.e. equipotentials in present invention detection human genome Gene) or the material of genotype include TaqMan-PCR reagents, the reagent includes amplification NF- κ B1 gene rs28362491 sites The PCR primer and TaqMan probe of genomic DNA fragment inside.

Further, in the present invention, the PCR primer refers to：Forward primer nucleotide sequence as shown in SEQ ID NO.1, Reverse primer nucleotide sequence is as shown in SEQ ID NO.2；The TaqMan probe includes detecting wild allele I probe (Probe-I)：In 5 ' end mark fluorescent reporter group FAM of SEQ ID NO.3 sequences, 3 ' ends mark non-fluorescence quenching NFQ bases Group and DNA minor groove binders MGB groups；And detection mutation allele D probe (Probe-D)：In SEQ ID NO.4 sequences 5 ' end mark fluorescent reporter group VIC of row, 3 ' ends mark non-fluorescence quenching NFQ groups and DNA minor groove binders MGB groups.

In the present patent application, described hepatitis C refers in particular to the hepatitis C for Chinese han population.

HCV infection person's (case group) described in the present patent application is removed for HCV self limitings and the merging of persistent infection Crowd, i.e.,：Treated without HCV-Ab IgG, and the crowd of HCV antibody positives (HCV RNA are negative or positive).It is as described herein to be uninfected by HCV crowd's (control group) is the non-HCV infection crowd of HCV negative antibodies and HCV RNA feminine genders.

The 5' ends for the TaqMan-MGB probes that the present invention uses are connected with fluorescent reporter group：6- Fluoresceincarboxylic acids (FAM) Or chlordene -6- methylfluoresceins (VIC), 3' ends be connected with non-fluorescence quenching group (non-fluorescent quencher, NFQ), fluorescence itself is not produced, but has the function that quenching fluorescence reporter group launches fluorescence.It is also connected with probe DNA minor groove binders (minor groove binder, MGB) modification group, ditch that can be in intercalation of DNA double-spiral structure, shape Into Non-covalent binding, the stability for hybridizing chain is improved.TaqMan-MGB probes have higher sensitivity than conventional TaqMan probe Property and specificity, be detect single base mutation effective tool.

When PCR amplifications just start, probe is complete, and fluorescent reporter group is very close with quenching group, and fluorescence signal is quenched Go out group absorptions, now can't detect fluorescence intensity.When product to be measured enters performing PCR amplification, Taqman probes elder generation and DNA profiling Sequence complementary portion combines, and with the progress of extension, Taq DNA polymerase moves along template strand, row to fluorescent reporter group Position when, play 5 ' → 3 ' digestion activities probe is cut off, at this moment fluorescent reporter group separates with quenching group, and generation can be examined The fluorescence signal measured.The synthesis of each PCR new chain is along with the release of a fluorescence signal, signal intensity and PCR primer Quantity it is proportional.With being continuously increased for amplification number, the fluorescence signal intensity of release constantly strengthens.Examined by dynamic in real time Genotyping can be carried out to PCR primer in sample well by surveying in reaction the fluorescence intensity launched.

In the present invention, in the case group being made up of 679 HCV infection persons, and by 976 pairs for being uninfected by crowd and forming According to the individual ratio in case group in group, carrying rs28362491 ID genotype, higher than corresponding genotype in control group Ratio.That is, the risk rise of rs28362491 ID genotype carriers' HCV infections, relative risk 1.282 Times, there is statistical significance (P=0.047)；And in dominant models, rs28362491 D allele and HCV neurological susceptibilities Statistics correlation still be present, relative risk is respectively 1.281 times (P=0.035).In actual applications, will can detect Rs28362491 polymorphism (i.e. allele) or genotype material is with other materials (as detected other and hepatitis C phase The SNP (i.e. allele) or genotype material of pass) it is united preparation examination hepatitis C susceptible person's Product.

In one embodiment of the present of invention, using the amplification of TaqMan-MGB sonde methods including rs28362491 sites Genomic DNA fragment, two kinds of allele on same gene site are marked with two kinds of Taqman fluorescence probes, use ABI 7900HT type quantitative real time PCR Instruments, the relative intensity of fluorescence of each sample well middle probe is detected on 384 orifice plates, with terminal Read plate program interpretation genotyping result, genotype is determined according to the species of fluorescence signal and intensity, can be achieved to great amount of samples High flux allelic gene typing.

The present invention separately designs two different probes and positive, reverse primer, divided according to pleomorphism site to be detected Fluorescence labeling is not carried out to probe with FAM and VIC, and analyzes its specificity, it is ensured that every primer and other mankind in database Gene is without homology.When carrying out TaqMan-PCR reactions, if 2 site bases of 2 chromosome are identical, it is a kind of glimmering only to send Light, you can be determined as homozygous genotype (II or DD), and the type of homozygous gene can be distinguished according to different fluorescence signals： Wild type (II) or homozygous mutant (DD)；When 2 pleomorphism site base differences, two kinds of fluorescence signals are had, show to treat The genotype of test sample product is heterozygous mutant (ID).Testing result is as shown in Figure 1.

The present invention has found in a sample (679 HCV infection persons and 976 collators) from Chinese han population NF- κ B1 genes rs28362491 is the insertion/deletion related to hepatitis C neurological susceptibility, will can be detected Rs28362491 insertion/deletion (i.e. allele) or the material of genotype and other materials are (as other in detected The SNP (i.e. allele) related to hepatitis C or genotype material) it is united the preparation type of examination third The product of hepatitis susceptible person.

Brief description of the drawings

Fig. 1 is Genotyping figure of the TaqMan-MGB sonde methods to NF- κ B1 gene rs28362491 sites.

Embodiment

With reference to embodiment, the present invention is further described in detail, the embodiment provided is only to explain The present invention is stated, the scope being not intended to be limiting of the invention.

The embodiment of the present invention contain it is following in material, reagent, unless otherwise specified, commercially obtain.

The nucleotide sequence that following examples are related to：

SEQ ID NO.1 (forward primer sequence Forwardprimer)：CATGACTCTATCAGCGGCACTG；

SEQ ID NO.2 (reverse primer sequences Reverseprimer)：AATCCCAAGGGCTGGAGC；

SEQ ID NO.3(Probe-I)：CCGACCATTGATTG；

SEQ ID NO.4(Probe-D)：CGACCATTGGGCC；

SEQ ID NO.5 (general primer)：AGGAAGACTTCCGAGCGGTC；

SEQ ID NO.6 (HCV 1a genotype special primer)：TGCCTGGGGATAGGCTGAC；

SEQ ID NO.7 (HCV 1b genotype special primer)：GAGCCATCCTGCCCACCCCA；

SEQ ID NO.8 (the genotype special primers of HCV 2)：CCAAGAGGGACGGGAACCTC；

SEQ ID NO.9 (the genotype special primers of HCV 3)：ACCCTCGTTTCCGTACAGAG；

SEQ ID NO.10 (HCV4 genotype special primer)：GCTGAGCCCAGGACCGGTCG.

Experimental method in following examples, it is conventional method unless otherwise specified.

All research objects endorsed written informed consent form in following examples, and the scheme of this research is through Jiangsu Province Ethics Committee of the People's Hospital ratifies, and meets in the Declaration of Helsinki that World Medical Association in 2013 newly revises and is related to physianthropy Clause (the WorldMedical Association.World Medical Association of the codes of ethics of research Declaration of Helsinki:ethical principles for medical research involving human subjects.JAMA.2013,310(20):2191-2194.)。

Research object：Following examples are included altogether：(1) 448 HCV persistent infection person：Serum HCV antibody positives (being detected with the third generation ELISA method kit of Abbott companies), and HCV RNA are positive, ALT rises or normal；(2) 231 HCV self limiting removing persons：Serum HCV antibody positives, and HCV RNA are negative, ALT rises or normal；(3) 976 collators, blood Clear HCV negative antibodies and HCV RNA feminine genders.Group (1) and group (2) are collectively referred to as infected group (case group).Control group and persistent infection Group, self limiting removing group the age (<5 years old), match in terms of sex and geographic zone (city, township).Other livers of exclusion concurrent infection Scorching virus, HIV or the patient treated with antiviral drugs.During research, all serological results are with continuous 12 At least independent experimental verification three times in during month follow-up.All subjects are by veteran doctor, in clinical and experiment The number of chambers is on the basis of, with internationally recognized standard diagnostics.

Embodiment 1 prepares NF- κ B1 gene rs28362491 insertion/deletions or genotype in detection human genome Material

1st, the extraction of genomic DNA

(1) EDTA anticoagulant tubes collect patient's 5ml peripheric venous blood blood, 4000rpm centrifugation 10min, separation serum, leucocyte And red blood cell, number, frozen in -80 DEG C standby one by one after packing.

(2) using phenol-chloroform method extracting genomic DNA：The cell pyrolysis liquid of 3 times of volumes is taken to add haemocyte after centrifugation, Fully vibration mixes, lysis at room temperature 5min, 4000rpm centrifugation 10min, reject supernatant.

(3) observation precipitation color, if red deeper, continue plus cell pyrolysis liquid is handled, crush and remove red blood cell, until Centrifugal sediment is white or lightpink untill.

(4) 1ml genome DNA extraction liquids and 8 μ l Proteinase K Solution are taken, is added in the sediment obtained by (3), fully After mixing, 37 DEG C of water-baths are stayed overnight.

(5) take out centrifuge tube to put to cooling, add 1ml Tris saturated phenols, compress lid, turn upside down 15min, fully Mix, 4000rpm centrifugations 10min.

(6) take supernatant to be transferred in another clean centrifuge tube, add and the isometric chloroform of supernatant:Isoamyl alcohol mixes Close liquid (24:1) lid, is compressed, turn upside down 15min, fully mixes, and 4000rpm centrifugation 10min, takes supernatant, average mark is loaded on 2 clean centrifuge tubes.

(7) the NaAC solution (3mol/L) of 1/10 volume is added, light rotation fully mixes.It is pre- to add isometric -20 DEG C Cold ice absolute ethyl alcohol, upper and lower gentle inversion for several times, naked eyes visible white flocculent deposit, with

8000~10000rpm centrifuges 10min, abandons supernatant.

(8) add the ice absolute ethyl alcohol 1ml of -20 DEG C of precoolings again in the sediment of white, compress lid, shake up and down Swing, wash away inside pipe wall DNA and drop in solution in pipe.10min is centrifuged with 12000rpm again, supernatant is abandoned, repeats once.

(9) filter paper for being inverted centrifuge tube in cleaning dries 20min, or drains ethanol to be dried in vacuo instrument.

(10) 100 μ l TE buffer solutions are added, in 4 DEG C overnight, after DNA is completely dissolved, after checking digit one by one, are placed in 4 DEG C refrigerator.

(11) 200 μ l DNA solutions are taken, 100 μ l are diluted to, with determined by ultraviolet spectrophotometry OD₂₆₀And OD₂₈₀Extinction Angle value, with OD₂₆₀DNA concentration is determined, l~20ng/ μ l meet requirement of experiment；With OD₂₆₀/OD₂₈₀Ratio determines DNA purity, Meet requirement of experiment between 1.8-1.9.

(12) according to surveyed DNA concentration, take and be diluted to 50-200ng/ μ l in right amount, after DNA is fully mixed, be placed in 4 DEG C of ice Case preserves, and for being used during PCR or Taqman method SNP Genotypings, the DNA original solutions of remaining high concentration freeze in -20 DEG C.

2nd, HCV RNA are extracted

(1) 300 μ l serum are taken, add 1ml RNA iso Plus, concussion mixes, and is stored at room temperature 5min.

(2) 200 μ l chloroforms are added in Eppendorf pipes, finger compresses lid, acutely vibrates 15s, make liquid in pipe abundant Emulsification, is no longer layered, room temperature stands 5min again.

(3) it is placed in high-speed refrigerated centrifuge, 4 DEG C, 12000rpm, centrifuges 15min.

(4) supernatant after centrifugation is drawn, avoids being drawn onto middle white layer, adds in new clean Eppendorf pipes, Then isometric isopropanol is added, overturns and mixes, be stored at room temperature 10min.

(5) it is placed in high-speed refrigerated centrifuge, 4 DEG C, 12000rpm, centrifuges 10min.

(6) suction out and abandon supernatant, the ethanol of 1ml 75% is slowly added to along Eppendorf tube walls, gently overturn washing tube wall.

(7) it is placed in high-speed refrigerated centrifuge, 4 DEG C, 12000rpm, centrifuges 5min, exhausts supernatant.

(8) 10min is stored at room temperature, it is drying precipitated, suitable quantity of water (RNase-free) is added, is gently blown and beaten, made with liquid-transfering gun Precipitation is abundant, and -80 DEG C freeze.

3rd, HCV RNA amplifications

The HCV RNA of gained in 5 μ l previous steps are taken 70 DEG C of pre-degeneration 10min, ice bath 5min, to be sequentially added as template Following reagent：The μ l of 5 × buffer 4, the μ l of 10mmol/L dNTP 1, the μ l of 20U/ μ l RNase 0.5,50pmol/ μ l anti-sense primers 0.5 μ l, 0.1mol/L dithiothreitol (DTT)s (DTT) 2 μ l, μ l of M-MLV reverse transcriptases 1, add pyrocarbonic acid diethyl ester (DEPC) and go out The μ l of bacterium water 11, the μ l of reaction system cumulative volume 20.37 DEG C of reverse transcriptions 1h, 95 DEG C of inactivations 5min, rapid ice bath 5min.

4th, HCV RNA are quantified

HCV RNA are with by the Cobas TaqMan HCV Test kits of Roche Holding Ag of the U.S., specific behaviour in blood sample Make step to carry out by kit specification.

5th, HCV Genotypings

(1) Genotyping of HCV RNA positive patients：

The above-mentioned μ l of amplified production 5 are taken, are separately added into 5 Eppendorf pipes, often pipe contains 0.5 μ l general primer (nucleosides Acid sequence is as shown in SEQ ID NO.5) and the special core gene code area primer containing type reaction mixture, overall reaction system For 50 μ l.

Nested PCR amplification condition：94 DEG C of pre-degeneration 3min, then 94 DEG C of 1min, 58 DEG C of 1min, 72 DEG C of 1min are followed for 35 totally Ring, 72 DEG C of extension 10min.Take 5 μ l amplified productions to enter row agarose gel electrophoresis, HCV genotype is judged according to clip size.

The HCV genotype detection primers of table 1

(2) Genotyping of HCV RNA negative patients

Using Murex HCV Serotyping 1-6 Assay ELISA kits, with based on HCV virus type specificity The ELISA method of antibody removes patient to self limiting negative HCV RNA and carries out HCV Genotyping detections (Bhattacherjee V,Prescott L,Pike I,et al.Use ofNS-4peptides to identify type-specific antibody to hepatitis C virus genotypes 1,2,3,4,5and 6[J].Journal of general virology,1995,76(7):1737-1748.)。

Cleaning Principle and brief step are as follows：The peptide sequence of 2 of HCV non-structural district NS4 areas height variations, have with The special linear epitope of the genotype of HCV 1~6, the special polypeptide antigen of artificial synthesized 1~6 type, is coated with microwell plate accordingly. Sequentially add and neutralize antigen and serum specimen.Neutralizing antigen has 7 kinds of different types, and one kind includes all 6 type antigens, and remaining is every kind of Only contain 5 species-specific antigens in 1~6 type, and lack a certain type antigen in 1~6 type successively, neutralizing antibody is pressed into micro plate F to A order, often row sequentially add, as contained 1 type antibody in sample, then in the neutralization antigen that can not be lacked 1 type antigen With, and with being coated with 1 type antigen binding of microwell plate.

After 37 DEG C of mixed liquor incubates 1h, washing removes uncombined material, the specific antibody of capture, then marked with HRP Two anti-igg combine, and after 37 DEG C of 1h, add chromogenic substrate, OD values are determined at 450nm with ELIASA.If it is not added with neutralizing antigen For control H holes, add in all 6 types and antigen be control G holes, with " OD_H/OD_G≥0.1”、“OD_Sample/OD_G≥0.4” Confirm antibody typing result, concrete operations and result judgement by specification are carried out.

6th, candidate locus is screened

In HapMap (http://www.hapmap.org) in download BeiJing, China crowd (CHB) gene pleiomorphism number According to storehouse, import HaploView softwares and select label site：Parameter setting is incidence coefficient r²More than 0.8；Have in Chinese population There is upper frequency, i.e., minimum gene frequency (minor allele frequency, MAF) is more than 0.05.In view of neighbouring Nearby sequence may have regulating and controlling effect to gene in sequence particularly upstream promoter area, and each candidate gene is included into its turn respectively Record starting point upstream 2000bp and downstream 2000bp sequences include analysis.In addition, combining related document, selection may influence base Because of the site of function.According to above principle, the present embodiment have selected 1 candidate locus：rs28362491.

NF- κ B1 genes are located at human chromosomal 4q23-q24, containing 24 extrons and 23 intrones, Rs28362491 is located at 5 ' ends of NF- κ B1 genes, and close to gene coding region.

7th, rs28362491 Genotypings

(1) according to human genome NF- κ B1 genes rs28362491 site, forward primer (such as SEQ ID are separately designed Shown in NO.1) probe different with two (as shown in SEQ ID NO.2) with reverse primer, i.e., respectively with FAM and VIC to probe Carry out fluorescence labeling (detection wild type insertion allele I probe：Nucleotide sequence shown in SEQ ID NO.3, and 5' ends Fluorescent reporter group FAM is connected with, 3 ' ends mark non-fluorescence quenching NFQ groups and DNA minor groove binders MGB；Detect saltant type Lack the probe of allele D：Nucleotide sequence shown in SEQ ID NO.4, and 5' ends are connected with fluorescent reporter group VIC, 3 ' ends mark non-fluorescence quenching NFQ groups and DNA minor groove binders MGB), and analyze its specificity, it is ensured that every primer and number According to other human genes in storehouse without homology.

(2) DNA sample to be measured is uniformly diluted to 10ng/ μ l, dispensed to 96 orifice plates, is loaded for the subsequent volley of rifle fire. Primer and probe dry powder is centrifuged into 5min with 12000rpm, lid is gently opened after centrifugation, in case dry powder sprays after uncapping. Then appropriate aseptic double-distilled water is added, dilution probe/primer to prescribed concentration, fully vibration make mixing.

(3) probe, primer, PCR Master Mix solution 12000rpm are centrifuged 30 seconds, mixed respectively.It is dispensed into 96 holes The DNA sample of plate is also mixed with microwell plate special centrifugal machine centrifugation 1min.Then it is as shown in table 2 to prepare PCR system：

The TaqmanPCR systems of table 2 are prepared

The above-mentioned system of table 2 is to detect NF- κ B1 gene rs28362491 insertion/deletions or base in human genome Because of the material of type；The above-mentioned substance obtained in the present embodiment is the base including amplification NF- κ B1 gene rs28362491 sites Because of the PCR primer of group DNA fragmentation and the TaqMan PCR reagents of TaqMan MGB probes, in specific implementation, can also use The reagent or kit of the conventional detection SNP genotype in other this areas.

The application of embodiment 2NF- κ B1 gene rs28362491 insertion/deletions or genotype

1st, detecting step

NF- κ B1 gene rs28362491 insertion/deletions or base in the detection human genome that embodiment 1 is obtained Because the material (system solution prepared according to the system of table 2) of type is dispensed to 8 sterile PCR pipes.It is 5 μ to adjust volley of rifle fire range L, take system liquid to add in 384 orifice plates, finally add the μ l/ holes of DNA sample 1.2 blank controls (sterile double steamings are set per plate Water), 2 known positive controls, to control reagent, systemic contamination and testing result.

(1) with special Taqman PCR sealers, excellent 384 orifice plate will be added to obturage, and will centrifuge 1min.Load 7900HT types Quantitative real time PCR Instrument, PCR reaction conditions are set：50 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 10min that begin, 95 DEG C are annealed 30 seconds, and 60 DEG C extension 30 seconds, 35 circulation.

(2) after PCR reactions terminate, with Applied Biosystems companies on 7900HT quantitative real time PCR Instruments Sequence Detection System softwares (SDS, version 2 .3) read genotypic results.

The Genotyping success rate in rs28362491 sites>98%.

When carrying out TaqMan-PCR reactions, if 2 pleomorphism site bases are identical, only send a kind of fluorescence, you can with It is determined as homozygous genotype, and the type of homozygous gene can be distinguished according to different fluorescence signals：Wild-type genotype or homozygosis Saltant type；When 2 pleomorphism site base differences, two kinds of fluorescence signals are had, show the SNPs genes that testing sample carries Type is heterozygous mutant.As shown in Figure 1, in Fig. 1, II represents table wild-type genotype to rs28362491 genotype call results II, ID represent heterozygous mutant ID genotype, and DD represents homozygous mutation DD genotype.

2nd, quality control

All research participants are recorded using construction standard questionnaire interview.Questionnaire have collected what document was reported The Major Risk Factors of HCV infection, including sex, age, area, HCV infection history, hepatitis environmental risk factor exposes history.This Epidemiology survey operation manuals and experiment standardized testing operational procedure have been studied and defined, it is unified to train all staff on board, To ensure survey data and the quality of data of experimental determination in this research.All application forms and data are encoded by staff, The respective independent input computer of two people, database is established after both sides' review is errorless.All testing results are by two researchers with blind Method carries out interpretation respectively, i.e., both do not know the clinic and other data of surveyed samples sources patient.To detecting unsuccessful or interpretation The sample having a question repeats to test, consistent until measuring result.Every group of sample repetition detection for randomly selecting 5% respectively, unanimously Rate is up to 100%.

3rd, statistical analysis

Two staff are with the software double track typing questionnaire data of EpiData 3.1 and testing result, through logical check core To rear, database is established, is further analyzed with SPSS softwares (version 2 1.0) and Stata (version 13).Quantitative variable is with average It is worth (mean) ± standard deviation (SD), or median (quartile spacing (IQR)) represents.Demography between case group and control group The difference of feature, HCV patient's biological indicator and the genotypes distribution and allele frequencies, with chi-square criterion, one-way analysis of variance (One- Way ANOVA) or nonparametric Kruskal-Wallis inspections.Goodness of fit Pearson's chi-square criterions are used to assess control group Whether genotype distribution meets Hardy-Weinberg balances.Multifactor Logistic regression analyses calculate odds ratio (ORs) With 95% confidential interval (CIs), the high risk factor of HCV infection is analyzed.Chromatographic analysis is used to control Confounding Factor to statistical result Influence.Bilateral P values<0.05 has statistical significance.

4th, the social demography of research object and Clinical symptoms

The social demography of all research objects and Clinical symptoms are as shown in table 3.Persistent infection group includes 448 patients (158 males, 290 women, average age are 54.74 ± 8.72 years old).Self limiting virus sweep group includes 231 people (80 Male, 151 women, average age are 56.63 ± 9.26 years old).Control group include 976 persons of being uninfected by (370 males, 606 Name women, average age are 55.08 ± 11.29 years old).Age and sex between three groups are not significantly different (P>0.05), three groups Between ALT is horizontal, AST is horizontal, route of infection has significant difference (P is equal<0.001), and persistent infection group and self limiting are clear Except significant difference (P be present in the virus infection type of group<0.001).

The demography and Clinical symptoms of the HCV persistent infections group of table 3, self limiting removing group and control group

Remarks：Group A：Control group (is uninfected by group), Group B：Self limiting removing group, Group C：Persistent infection Group, Group (B+C)：HCV infection group (case group).mean:Average value；SD：Standard deviation；ALT：ALT； AST：Aspartate amino transferase；IQR：Quartile spacing；A one-way analysis of variances (One-Way ANOVA)；B χ 2- are examined Test；C Kruskal-Wallis are examined.

5th, Hardy-Weinberg genetic equilibriums are examined

The involved rs28362491 sites of this research, are uninfected by group as a control group：P=0.122.P is more than 0.05, says The bright site meets Hardy-Weinberg balances in the distribution frequency of control group, and control group has crowd representative.

6th, the association analysis of NF- κ B pathway genes polymorphism and HCV infection neurological susceptibility

In NF- κ B pathway genes the genotype distribution frequency in rs28362491 sites and with three kinds of genetic models (be added mould Type, dominant models and recessive model) analysis SNP and HCV infection neurological susceptibility, associating of lapsing to be shown in Table 4.

SNPs sites and HCV infection neurological susceptibility, the Logistic regression analyses lapsed in the NF- κ B signal pathway genes of table 4

Remarks：CI：Confidential interval, HCV：HCV, OR：Odds ratio.Group A：Control group (is uninfected by group), Group B：Self limiting removing group, Group C：Persistent infection group, Group (B+C)：Infected group (case group).

^aLogistic returns P values, OR values and 95% confidential interval after adjustment, and adjustment factor is sex, age and infection Approach.

^bLogistic returns P values, OR values and 95% confidential interval after adjustment, and adjustment factor is sex, age and infection Approach.Font-weight person is that data have significant difference.

Through Logistic return that adjustment sex, age, ALT be horizontal and route of infection these Confounding Factors after, find to carry Ratio of the individual of rs28362491 ID genotype in case group (persistent infection group and self limiting removing group), higher than ID Ratio of the genotype carriers in control group (being uninfected by HCV crowd).I.e. rs28362491 ID genotype carriers infect HCV risk rise, relative risk is 1.282 times, has statistical significance (P=0.047)；In dominant models, Rs28362491 D allele is related to HCV neurological susceptibilities, and relative risk is 1.281 times, has statistical significance (P= 0.035)。

Using sex, age, route of infection as classification factor, to rs28362491 sites and HCV in NF- κ B pathway genes Susceptibility infection, the further chromatographic analysis of risk is lapsed to, be shown in Table 5.

Rs28362491 sites in the NF- κ B signal pathway genes of table 5 with HCV infection neurological susceptibility, lapse to the layering of relation Analysis

Remarks：HCV：HCV, CI：Confidential interval, OR：Odds ratio.Group A：Control group (is uninfected by group), Group B：Self limiting removing group, Group C：Persistent infection group, Group (B+C)：Infected group (case group).

^aLogistic returns P values, OR values and 95% confidential interval after adjustment, and adjustment factor is sex, age, infection Approach.

^bLogistic returns P values, OR values and 95% confidential interval after adjustment, and adjustment factor is sex, age, infection Approach.Font-weight person is that data have significant difference.

Study population presses average age, is divided into ＜ 55 years old and >=55 years old subgroup, for further analyzing.As shown in table 5, In paid blood donation subgroup, rs28362491 D allele is related to HCV neurological susceptibilities, and relative risk is respectively 1.231 times, With statistical significance (P=0.021).

7th, the association analysis that NF- κ B pathway genes polymorphism is removed with HCV self limitings

Adjustment sex, age, ALT horizontal, virogene type and route of infection these Confounding Factors are returned through Logistic Afterwards, do not find that rs28362491 genotype distribution frequency is removed to the self limiting of HCV infection and has statistics related (P is equal> 0.05, it is shown in Table 4, table 5).

Therefore, it is applicant's understanding that NF- κ B1 gene rs28362491 site insertion/deletions and hepatitis C are susceptible Property it is related, in specific implementation, examination hepatitis C is prepared using NF- κ B1 gene rs28362491 insertion/deletions The product of the product of susceptible person or detection or the examination SNP related to hepatitis C, such as will detection should Rs28362491 insertion/deletion or the material (Taqman PCR systems as described in Table 2) of genotype and other materials (such as other detections SNP related to hepatitis C or the material of genotype) or instrument are united preparation The product of the product of examination hepatitis C susceptible person or detection or the examination SNP related to hepatitis C, has Wide application prospect.

Sequence table

<110>No.1 Attached Hospital, Nanjing Medical Univ

Nanjing Medical University

Gulou Hospital Attached to Medical College of Nanjing Univ.

<120>One NF- κ B1 gene insertion/deletion site answering in detection hepatitis C neurological susceptibility product is prepared With

<141> 2017-10-30

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

catgactcta tcagcggcac tg 22

<210> 2

<211> 18

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

aatcccaagg gctggagc 18

<210> 3

<211> 14

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

ccgaccattg attg 14

<210> 4

<211> 13

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

cgaccattgg gcc 13

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

aggaagactt ccgagcggtc 20

<210> 6

<211> 19

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

tgcctgggga taggctgac 19

<210> 7

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

gagccatcct gcccacccca 20

<210> 8

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

ccaagaggga cgggaacctc 20

<210> 9

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

accctcgttt ccgtacagag 20

<210> 10

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

gctgagccca ggaccggtcg 20

Claims

1. NF- κ B1 gene rs28362491 insertion/deletions or genotype are preparing detection or examination third in human genome Application in type hepatitis neurological susceptibility product.

2. in human genome NF- κ B1 gene rs28362491 insertion/deletions or genotype prepare detection or examination with Application in the product of the related SNP of hepatitis C.

3. detecting NF- κ B1 gene rs28362491 insertion/deletions or the material of genotype in human genome is preparing inspection Application in survey or examination hepatitis C neurological susceptibility product.

4. detecting NF- κ B1 gene rs28362491 insertion/deletions or the material of genotype in human genome is preparing inspection Survey or the product of the examination SNP related to hepatitis C in application.

5. the application according to claim 3 or 4, it is characterised in that NF- κ B1 genes in the detection human genome Rs28362491 insertion/deletions or the material of genotype include TaqMan PCR reagents.

6. application according to claim 5, it is characterised in that the TaqMan PCR reagents are included in amplification human genome The PCR primer and TaqMan MGB probes of genomic DNA fragment including NF- κ B1 genes rs28362491.

7. application according to claim 6, it is characterised in that the PCR primer sequence respectively such as SEQ ID NO.1 and Shown in SEQ ID NO.2；The TaqMan MGB probe sequences respectively as shown in SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.3 and SEQ ID NO.4 5 ' the equal mark fluorescent reporter groups in end, 3 ' ends mark non-fluorescence quencher and DNA minor groove binders MGB groups.

A kind of 8. PCR primer of the genomic DNA fragment in human genome containing amplification including NF- κ B1 genes rs28362491 With the TaqMan PCR reagents of TaqMan MGB probes.

9. TaqMan PCR reagents according to claim 8, it is characterised in that the PCR primer sequence is respectively such as SEQ Shown in ID NO.1 and SEQ ID NO.2；The TaqMan MGB probe sequences are respectively such as SEQ ID NO.3 and SEQ ID NO.4 It is shown, and SEQ ID NO.3 and SEQ ID NO.4 5 ' the equal mark fluorescent reporter groups in end, 3 ' ends mark non-fluorescence sudden Go out group and DNA minor groove binders MGB groups.