CN107574256A - A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification - Google Patents
A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification Download PDFInfo
- Publication number
- CN107574256A CN107574256A CN201710802892.0A CN201710802892A CN107574256A CN 107574256 A CN107574256 A CN 107574256A CN 201710802892 A CN201710802892 A CN 201710802892A CN 107574256 A CN107574256 A CN 107574256A
- Authority
- CN
- China
- Prior art keywords
- molecular labeling
- tobacco
- powdery mildew
- resistance
- screening
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of molecular labeling for the screening of Powdery Mildew in Tobacco resistance of wide spectrum resource Rapid identification.Molecular labeling provided by the present invention is used for the Rapid identification powdery mildew resistance of wide spectrum resource to be formed because tobacco gene is mutated, the molecular labeling primer of the tobacco mildew-resistance resource is that molecular labeling primer isolates to M1 and molecular labeling primer to M2, and with powder mildew resistance character.Enter performing PCR to tobacco germplasm simultaneously using this 2 pairs of primers to expand, if two pairs of primers can amplify correspondingly sized specific fragment simultaneously, then this material is mildew-resistance resource, the Resistance resource gone out to this Marker Identification carries out powdery mildew inoculation and identification, as a result disease resistance is all shown, rate of coincideing is up to 100%.Molecular labeling disclosed by the invention need to only enter performing PCR amplification to tobacco germplasm DNA can identify such powder mildew resistance, be not required to be inoculated with powdery mildew, that is, save extensive work, ensure normal plants again.
Description
Technical field
The present invention relates to a kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification, belongs to molecule something lost
Pass field.
Background technology
Powdery Mildew in Tobacco is commonly called as " upper ash ", " frost occurs ", " upper nitre ", and cause harm ripe old leaf more the disease, develops from bottom to top.Leaf
Piece is fallen ill, and is just the yellowish-brown stigma of subcircular, and existing white powder dot on rear spot, it is in blanket to make scab, and patch expands, white powder
It is covered with whole blade, sick leaf elder generation chlorisis browning is rear withered.Cause harm tender stem when serious, is also covered with white powder on sick stem.After sick leaf baking
Thin as a piece of paper, color secretly becomes rusty brown, loses economic value.Powdery mildew has generation in each cigarette district of China, wherein with south China, southwest and China
Middle cigarette district is the most universal, and harm is also heavier.The preventing and treating of Powdery Mildew in Tobacco easily causes agricultural chemicals mainly based on chemical prevention at present
Residual, is the exceeded principal element of current tobacco residue.
Plantation tobacco mildew-resistance kind is to prevent and treat that the disease is most economical, safely effectively method, excellent tobacco white powder
The anti-source of disease is the basis for cultivating disease-resistant variety.
Powdery Mildew in Tobacco Resistance resource screening at present depends on field natural occurrence investigation and artificial infection idenfication, deposits
Qualification cycle is long, easily affected by environment, poor repeatability the shortcomings of.In traditional Resistant germplasm screening technique, first have to big
The tobacco plant and powdery mildew bacterium source of amount are inoculated with, and its is secondary very big space, and operation is extremely complex, while also by environment
Influence.If the relation between powdery mildew bacterium source, tobacco seedlings and environment can not be handled well effectively, resist/feel the phenotype of powdery mildew
Qualification result reliability is just very low, and therefore, mildew-resistance Screening germplasm is not only time-consuming, and difficulty is big, and cost is high.Molecular labeling
It is a kind of quick, simplicity, cost, a kind of technology cheap and that Non-Destructive Testing can be carried out in tobacco growing early stage, there is presently no
The report of Rapid identification powder mildew resistance resource related molecular marker.
The content of the invention
The technical problem to be solved in the present invention is：There is provided it is a kind of for Powdery Mildew in Tobacco Resistance resource Rapid identification screening
Molecular labeling, for the Rapid identification powdery mildew resistance of wide spectrum resource to be formed because tobacco gene is mutated, if two pairs of primer energy
Correspondingly sized specific fragment is amplified simultaneously, then this material is mildew-resistance resource, the resistance money gone out to this Marker Identification
Source carries out powdery mildew inoculation and identification, as a result all shows disease resistance, and rate of coincideing is up to 100%.
The technical scheme is that：A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification,
Described molecule labelled series are seq ID No.1 and seq ID No.2.
The primer pair of the described molecular labeling for being used for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification of amplification, it is described
Primer pair is M1-F1/M1-R and M2-F1/M2-R, and wherein M1-F1 sequence is：5’-AATTAACTTTGGTCCAAACTTA-
3 ', M1-R sequence is：5 '-TTAGATGTGTGATAGGGTCAGTTAG-3 ', M2-F1 sequence is：5’-
GGTGCTGCTCTGGATAGTCTC-3 ', M2-R sequence is：5’-ACAATCTAAAAGTGTAGTTTGGTGG-3’.
A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification, described molecular labeling is by upper
The primer pair stated expands to obtain using Powdery Mildew in Tobacco resistance tobacco gene group DNA as template through PCR.
Described molecular labeling is seq ID No.1 and seq ID No.2.
A kind of carrier contains above-mentioned molecular labeling.
A kind of recombinant cell contains above-mentioned carrier.
The detection method of a kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification, according to described
Molecular labeling nucleotide sequence design primer, expanded using being detected tobacco gene group DNA as template, and judge to expand
It whether there is the molecular labeling in product.
Described primer is above-mentioned primer pair.
As a result identify：The all no amplified bands of mark seq ID No.1 and seq ID No.2 or only one mark has
Band for susceptible material, while there are seq ID No.1 and seq ID No.2 amplified bands, the tobacco-containing material has white powder
Sick disease resistance.
Beneficial effects of the present invention：Correspondingly sized special piece can be amplified simultaneously using two pairs of primers provided by the invention
Section, i.e. molecular labeling of the invention, then this material is mildew-resistance resource, and the Resistance resource gone out to this Marker Identification carries out white
The inoculation of powder disease and identification, as a result all show disease resistance, and rate of coincideing is up to 100%.Molecular labeling disclosed by the invention only need to be to cigarette
Careless germ plasm resource DNA, which enters performing PCR amplification, can identify such powder mildew resistance, be not required to be inoculated with powdery mildew, that is, save a large amount of
Work, ensure normal plants again.
1st, accuracy is high, reproducible.Different powdery mildew Race Identification powdery mildews are inoculated with from traditional utilization to resist
Property method it is different, the present invention developed using SNP site in target gene can identify and screen merely with PCR electrophoretic techniques it is white
Powder disease Resistance resource, Marker Identification result and the resistance goodness of fit are up to 100%.Efficiently solve artificial infection and field natural occurrence
The shortcomings of investigation is easily affected by environment, poor repeatability.
2nd, qualification cycle is short, and workload is small.The present invention can greatly shorten qualification cycle and subtract in Seedling Stage Screening and Identification
Lack workload, save cost.
3rd, contribute to find the anti-source of new Powdery Mildew in Tobacco.By molecular labeling provided by the invention can be simple and quick draw
Divide Powdery Mildew in Tobacco resistance type, help to find the anti-source of new Powdery Mildew in Tobacco.
Brief description of the drawings
Fig. 1 is different primers to expanding disease-resistant and susceptible material DNA results；
Fig. 2 is that two molecular labelings screen to different tobacco germplasms, and wherein S1, S3 material only has M1 to be marked with
Band, M2 are marked without band；S2 materials only have M2 to be marked with band, and M1 is marked without band；Two molecular labelings of S4-S12 do not have
There is amplified band, therefore S1-S12 is susceptible material, two molecular labelings of R1-R4 materials have band, are disease-resistant material；
Fig. 3 is the result that tobacco S1-S12 and R1-R4 material are inoculated with progress Resistance Identification after powdery mildew, can be seen by figure
Go out, S1-S12 is susceptible material, and R1-R4 is disease-resistant material.
Embodiment
A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification, Powdery Mildew in Tobacco disease-resistant gene
Labeled primer M1 and M2 deoxyribonucleotide sequence：
First, molecular labeling primer designs
Primer M1 and M2 are designed according to powdery mildew correlated series difference site in disease-resistant material, reverse primer is fixed as M1-R
And M2-R, forward primer are respectively M1-F1, F2, F3 and M2-F1, F2, F3, the deoxyribonucleotide sequence of primer, annealing are warm
Degree and expanding fragment length see the table below：
2nd, tobacco DNA is extracted
Tobacco gene group DNA is extracted respectively with conventional CTAB methods, and method is:
(1) weigh tobacco leaf 100mg or so to be placed in 2mL centrifuge tubes, liquid feeding nitrogen is ground to powdered with special pestle；
(2) add 900 μ l be preheating to 65 DEG C 2 × CTAB buffer solutions (2%CTAB, 100mM Tris-HCl pH8.0,
20mM EDTA pH8.0,1.4M NaCl), 65 DEG C of water-baths take out cooling after 20 minutes；
(3) 200 μ l chloroform-isoamyl alcohols mixed liquors (24 are added:1) shake up, 4 DEG C, after 7500rpm centrifugations 10min in transfer
Managed to 1.5mL EP clearly；
(4) 200 μ l chloroform-isoamyl alcohols mixed liquors (24 are added again:1) shake up, 4 DEG C, 7500rpm centrifugations 10min；
(5) take out supernatant to be placed in new EP pipes, add 1/10 volume 3M pH5.2 sodium acetates and isometric isopropanol, shake
4 DEG C of centrifugation 20min (12000rpm) after even；
(6) supernatant is abandoned, after being washed twice with 75% ethanol, is placed in superclean bench and dries, buffered with the TE containing RNase
Liquid melts, and places -20 DEG C and saves backup.
(7) take 2 μ l DNA samples to carry out electrophoresis on 1% Ago-Gel, 120V electrophoresis 20 minutes, detect DNA
Quality；Take 1 μ l samples Nanodrop detection DNA concentrations and OD values.
3rd, PCR is expanded
PCR reaction systems 20ul：
PCR reaction cycle programs are：
(4) PCR primer is with 2% Ago-Gel, the electrophoresis 25min under 120V voltages, and is imaged in gel electrophoresis and is
The situation of the lower observation band of system.
4th, molecular labeling PCR amplifications and sequencing fragment
The 320bp arrived to above-mentioned amplification fragment and 354bp fragment, are connected respectively in pUC18 carriers, are recombinated
Carrier.The recombinant vector is transformed into bacillus coli DH 5 alpha, chooses monoclonal, culture obtains recombinant cell.From recombinant cell
Plasmid is extracted, the plasmid is recombinant vector, and cloned sequence is sequenced using M13 universal primers, as a result shown, M1-F1/
The sequence that M1-R marks expand in disease-resistant material is (seq ID No.1), and M2-F1/M2-R marks expand in disease-resistant material
The sequence increased is (seq ID No.2).The steps such as above-mentioned clone, conversion, culture, plasmid extraction refer to《Molecular Cloning: A Laboratory
The guide third edition》, Huang Peitang etc. translated, and Science Press's in September, 2002 is published.
Primer screening is tested
Respectively using disease-resistant material TT7 (platform cigarette 7) and susceptible material K326 DNA as template, with different forward primers
(following table) is combined with reverse primer, enters performing PCR amplification, as a result if following table, Fig. 1, M1 are that 100bp laddermarker, M2 are
DL2000marker。
Screening germplasm is tested
Using M1-F1/M1-R, the DNA of M2-F1/M2-R primer pair difference tobacco-containing materials enters performing PCR amplification, while to cigarette
Careless plant carries out seedling stage powdery mildew inoculated identification, as a result such as Fig. 3, it can be seen that two pairs of primers the material of amplified band occur simultaneously
Material (R1-R4) shows disease resistance, all amplified band (S1-S3) occurs without band (S4-S12) or only pair of primers
Material shows susceptibility.The upper figure of electrophoretogram uses M1-F1/M1-R primer pairs, and figure below uses M2-F1/M2-R primer pairs
Marker is DL2000.
<110>Guizhou Province Tabacco Science and Technology Institute
<120>A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification
<160> 25
<210> 1
<211>320
<212> DNA
<213>Tobacco (Nicotianatabacum L.)
<400> 1
AATTAACTTT GGTCCAAACC TAGCACATTT AACTCCACAG AATCAGGAAA ATTTTGATTT 60
CCAGATATAC ATCAATAGAG CAGTTGAAAA AGACTTCAAA TTTGTTGTGG AAATAAGGTG 120
TACATGCATC TTCTCTCTCT CTCTCTCTCT CTTTGTTTTT GTTTTCTCTA ACACTTTTCA 180
GAAACTTTTT ACCAATACTG TCATTACTAA ATATAACCTC ATTTATTGTG TGCAGTCCAG 240
CATTATGGCT CTTCACAGTA CTATATTTTC TAACCACTAC CAATGGTAAG ACTATCTAAC 300
TGACCCTATC ACACATCTAA 320
<210> 2
<211>352
<212> DNA
<213>Tobacco (Nicotiana tabacum L.)
<400> 2
GGTGCTGCTC TGGATAGTCT CCTCTCCCCC TCTCTATCTC TCCAGCTTTT TTTTAGCCCG 60
TTTGGACATA AGAATTTTTA TTTTATTCTT TTTCTAAAAA AATCACTTTT TTTTCGAAAT 120
CAGTATTTGG TCATAAAATT TTTAATTTTG AAGATGAATT TTGAAAAATT TTAAAAATTT 180
AAAAAACTCT AAAAGATTGT TTTTCAAAAT TTTCACTCAT ATCACAACCA GTGGCGGAGG 240
CAGGATCTTC ACGAAGGGGG TTCAAAAAAC AATTGTATCT AGTGGGAATT GAACTCATGA 300
CCTTATGTAG ATTTTGAACC CCCTTGACCA CCAAACTACA CTTTTAGATT GT 352
<210> 3
<211>22
<212> DNA
<213>It is artificial synthesized
<400> 3
AATTAACTTTGGTCCAAACTTA 22
<210> 4
<211>22
<212> DNA
<213>It is artificial synthesized
<400> 4
AATTAACTTTGGTCCAAACGTA 22
<210> 5
<211>22
<212> DNA
<213>It is artificial synthesized
<400> 5
AATTAACTTTGGTCCAAACCTA 22
<210> 6
<211>25
<212> DNA
<213>It is artificial synthesized
<400> 6
TTAGATGTGTGATAGGGTCAGTTAG 25
<210> 7
<211>21
<212> DNA
<213>It is artificial synthesized
<400> 7
GGTGCTGCTCTGGATAGTCTC 21
<210> 8
<211>22
<212> DNA
<213>It is artificial synthesized
<400> 8
CGGTGCTGCTCTGGATAGTATC 22
<210> 9
<211>21
<212> DNA
<213>It is artificial synthesized
<400> 9
GGTGCTGCTCTGGATAGTTTC 21
<210> 10
<211>25
<212> DNA
<213>It is artificial synthesized
<400> 10
ACAATCTAAAAGTGTAGTTTGGTGG 25
Claims (9)
- A kind of 1. molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification, it is characterised in that：Described molecule Flag sequence is seq ID No.1 and seq ID No.2.
- 2. expand the primer of the molecular labeling for being used for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification described in claim 1 It is right, it is characterised in that：Described primer pair is M1-F1/M1-R and M2-F1/M2-R, and wherein M1-F1 sequence is：5’- AATTAACTTTGGTCCAAACTTA-3 ', M1-R sequence is：5 '-TTAGATGTGTGATAGGGTCAGTTAG-3 ', M2-F1 Sequence be：5 '-GGTGCTGCTCTGGATAGTCTC-3 ', M2-R sequence is：5’- ACAATCTAAAAGTGTAGTTTGGTGG-3’。
- A kind of 3. molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification, it is characterised in that：Described molecule Mark is to be expanded as the primer pair described in claim 2 using Powdery Mildew in Tobacco resistance tobacco gene group DNA as template through PCR Arrive.
- 4. molecular labeling according to claim 3, it is characterised in that：Described molecular labeling is seq ID No.1 and seq ID No.2。
- A kind of 5. carrier, it is characterised in that：Contain the molecular labeling any one of claim 1,3 and 4.
- A kind of 6. recombinant cell, it is characterised in that：Contain the carrier described in claim 5.
- A kind of 7. detection of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification as claimed in claim 1 Method, it is characterised in that：Primer is designed according to the nucleotide sequence of described molecular labeling, to be detected tobacco gene group DNA Expanded for template, and judge to whether there is the molecular labeling in amplified production.
- A kind of 8. inspection of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification according to claim 7 Survey method, it is characterised in that：Described primer is the primer pair described in claim 2.
- A kind of 9. inspection of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification according to claim 7 Survey method, it is characterised in that：Mark seq ID No.1 and seq ID No.2 all without amplified band or only one mark Have band for susceptible material, while there are seq ID No.1 and seq ID No.2 amplified bands, the tobacco-containing material has white Powder disease disease resistance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710802892.0A CN107574256A (en) | 2017-09-08 | 2017-09-08 | A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710802892.0A CN107574256A (en) | 2017-09-08 | 2017-09-08 | A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107574256A true CN107574256A (en) | 2018-01-12 |
Family
ID=61031379
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710802892.0A Pending CN107574256A (en) | 2017-09-08 | 2017-09-08 | A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107574256A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112029889A (en) * | 2020-09-03 | 2020-12-04 | 贵州省烟草科学研究院 | Multiplex PCR method for detecting powdery mildew resistance genotype of tobacco and application of multiplex PCR method in breeding |
| CN115568416A (en) * | 2022-02-21 | 2023-01-06 | 贵州省烟草科学研究院 | Method for screening tobacco haploid by utilizing tobacco powdery mildew resistance and evaluating inductivity |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104031988A (en) * | 2014-05-07 | 2014-09-10 | 中国农业科学院烟草研究所 | Identification method for physiological races of erysiphe cichoracearum DC. |
-
2017
- 2017-09-08 CN CN201710802892.0A patent/CN107574256A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104031988A (en) * | 2014-05-07 | 2014-09-10 | 中国农业科学院烟草研究所 | Identification method for physiological races of erysiphe cichoracearum DC. |
Non-Patent Citations (1)
| Title |
|---|
| T. FUJIMURA ET AL: "Powdery mildew resistance in the Japanese domestic tobacco cultivar Kokubu is associated with aberrant splicing of MLO orthologues", 《PLANT PATHOLOGY》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112029889A (en) * | 2020-09-03 | 2020-12-04 | 贵州省烟草科学研究院 | Multiplex PCR method for detecting powdery mildew resistance genotype of tobacco and application of multiplex PCR method in breeding |
| CN112029889B (en) * | 2020-09-03 | 2023-11-14 | 贵州省烟草科学研究院 | Multiplex PCR method for detecting resistance genotype of tobacco powdery mildew and application of multiplex PCR method in breeding |
| CN115568416A (en) * | 2022-02-21 | 2023-01-06 | 贵州省烟草科学研究院 | Method for screening tobacco haploid by utilizing tobacco powdery mildew resistance and evaluating inductivity |
| CN115568416B (en) * | 2022-02-21 | 2023-06-16 | 贵州省烟草科学研究院 | Method for screening tobacco haploid and evaluating induction rate by using tobacco powdery mildew resistance |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| D'Hont et al. | A molecular approach to unraveling the genetics of sugarcane, a complex polyploid of the Andropogoneae tribe | |
| Kang et al. | Introgression of chromosome 3Ns from Psathyrostachys huashanica into wheat specifying resistance to stripe rust | |
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN103088127B (en) | Primers and method for purity identification of hybrid seeds of Chinese pumpkin 'Guangmi NO.1' | |
| CN107586867A (en) | Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method | |
| Baidoo et al. | Mitochondrial haplotype-based identification of root-knot nematodes (Meloidogyne spp.) on cut foliage crops in Florida | |
| CN106048010A (en) | RPA (recombinase polymerase amplification) technology based method for detecting phomopsis helianthi, RPA primers and kit | |
| CN104726450A (en) | Molecular markers in close linkage with specific resistance gene for capsicum phytophthora blight of root rot and application thereof | |
| CN107574256A (en) | A kind of molecular labeling for the screening of Powdery Mildew in Tobacco Resistance resource Rapid identification | |
| CN105647920A (en) | InDel molecular marker based on TYLCV (tomato yellow leaf curl virus) resistance gene Ty-3 | |
| CN106282373A (en) | A kind of Herba Dendrobii and the contrast authentication method of Henan Herba Dendrobii | |
| CN104313020B (en) | Indel molecular labelings and its application with hua ' nan-type cucumber gynoecy shape close linkage | |
| CN105002290B (en) | A kind of molecular detection kit of brassica plant cytoplasm type and application | |
| CN109680087B (en) | A kind of dual PCR detection method and its primer sets of Sugarcane white leaf phytoplasma and informal voucher Xanthomonas campestris | |
| CN104561353B (en) | InDel marker in close linkage with cabbage fertility as well as detection method and application of InDel marker | |
| CN104031912B (en) | Nucleic acid, method for detecting transgenic rice B2A68 and derived line thereof, and kit and application thereof | |
| CN106434930A (en) | Primer for purity identification of cucumber 'Yueqing 1' hybrid seed and method | |
| CN102690812A (en) | Molecular marker SIsv0067 closely linked with Setaria italica L. Beauv. heading stage gene | |
| CN106754911A (en) | Primer sets and its application for identifying Mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotrachetis virus | |
| CN104004845A (en) | Method and special primer set for identifying facticity to-be-tested variety belonging to CCRI 63 | |
| CN104745725B (en) | Detect CYVCV and CCDaV one-step method PCR detection primers to, kit and method simultaneously | |
| CN107338323B (en) | Molecular marker closely linked with powdery mildew resistance of flue-cured tobacco variety TT7 and application thereof | |
| CN107619879A (en) | A kind of primer pair and its application for being used to identify Dendrobidium huoshanness and dendrobium candidum | |
| CN107794264A (en) | For building the joint sequence and authentication method of polyploid plant mutant library | |
| CN106282372A (en) | Herba Dendrobii and the comparison authentication method of Dendrobium loddigesii |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180112 |
|
| RJ01 | Rejection of invention patent application after publication |