CN107574244A - Detect primer pair, kit and the method for No. 1047 codon mutations of exon of PIK3CA genes 20 - Google Patents
Detect primer pair, kit and the method for No. 1047 codon mutations of exon of PIK3CA genes 20 Download PDFInfo
- Publication number
- CN107574244A CN107574244A CN201610524420.9A CN201610524420A CN107574244A CN 107574244 A CN107574244 A CN 107574244A CN 201610524420 A CN201610524420 A CN 201610524420A CN 107574244 A CN107574244 A CN 107574244A
- Authority
- CN
- China
- Prior art keywords
- exon
- detection
- seq
- pik3ca
- codon mutations
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a kind of primer pair, kit and the method for No. 1047 codon mutations of exon of detection PIK3CA genes 20, the primer pair has such as SEQ ID NO:1 and SEQ ID NO:Base sequence shown in 2, detection method are using the DNA of detected sample as template, carry out quantitative fluorescent PCR reaction, collect fluorescence signal, draw melting curve；The melting curve of interpretation detected sample.The detection method of the present invention can inexpensively, it is quick, sensitively PIK3CA genes No. 1047 codon mutations of 20 exon are detected, be adapted to the use of clinical molecular diagnosis laboratory.
Description
Technical field
The invention belongs to biomedicine technical field, and specifically, the present invention relates to one kind to detect PIK3CA genes 20
Primer pair, kit and the method for No. 047 codon mutation of exons 1.
Background technology
The PIK3CA assignments of genes gene mapping encode 1068 kinds of amino acid, this group of amino acid produces one group of length in 3q26.3, long 34kb
124kD albumen.PIK3CA has been found to be a kind of oncogene, and it is mutated the amplification for including gene, missing and somatocyte
Missense mutation etc..PIK3CA gene codes PI3K catalytic subunit, can activate the downstream AKT approach of PI3K paths, activation or
Suppress target protein downstream and then adjust a variety of vital movements such as the propagation of cell, differentiation, migration, risen in tumor development
Important function.American researcher has found that gene PIK3CA produces mutation and correlation be present with kinds cancer morbidities such as colon cancers,
It was found that in 32% colorectal cancer patients body there is mutation in gene PIK3CA.
With the fast development of modern medicine, the individualized treatment of molecular targeted agents is used widely.Research is found
The colorectal cancer patients of PIK3CA gene mutations to for EGFR be target spot monoclonal antibody Cetuximab (Cetuximab,
Trade name Erbitux/ Chinese mugworts must be appropriate) produce resistance.Numerous studies confirm that PIK3CA gene mutations can cause patient with breast cancer couple
The treatment resistance of Her2 targeted drug injection Herceptins (Trastuzumab), so as to cause curative effect not good enough.PIK3CA genes are examined
Reference frame can be provided for the prognosis evaluation and the rational use of medicines of breast cancer and colorectal cancer patients by surveying mutation result.NEJM in 2012
Deliver result of study：The late stage colorectal cancer patients of PIK3CA gene mutations be present, aspirin may extend its life cycle.
Mass data shows that PIK3CA mutation about 4/5 occurs that (20 extras show in helical region (9 exon) and kinases area
Son) the two hot spot regions.No. 1047 codons of 20 exon of PIK3CA genes are as hot mutant site, for the position
The commercial kit of point is more and more, but price is costly.The more common method in laboratory includes at present：Sanger is sequenced
Method, fluorescence quantitative PCR method based on probe etc..Sanger PCR sequencing PCRs are currently because the changes of each bases of DNA can be read
The generally acknowledged goldstandard method of gene mutation is detected, but because sensitivity is low, sequencing steps are cumbersome, time-consuming, to equipment and operation
The requirement of personnel is higher, and must be detected on expensive sequenator, is not easy to be formed the molecule of normalizing operation
Diagnostic products.Fluorescence quantitative PCR method based on probe detects gene mutation and realized by known specific probe, the party
Method high sensitivity, specificity are good, at present the commercial kit of the detection PIK3CA gene mutations based on this method, but greatly
Part kit can only detect two kinds of mutation types for PIK3CA genes No. 1047 codons of 20 exon, and for the position
Point rare mutation type, then can not be detected, and detection reagent cost is high.
Therefore, it is necessary to a kind of improved method is provided to realize that PIK3CA genes No. 1047 codons of 20 exon are dashed forward
Accurate, the quick and cheap detection method of change state.
The content of the invention
Based on this, the defects of in order to overcome above-mentioned prior art, the invention provides one kind for detection PIK3CA genes
20 No. 1047 codon mutations of exon primer pair, kit and HRM detection methods.
In order to realize foregoing invention purpose, this invention takes following technical scheme：
A kind of primer pair of No. 1047 codon mutations of exon of detection PIK3CA genes 20, the primer pair have such as
SEQ ID NO:1 and SEQ ID NO:Base sequence shown in 2.
Present invention also offers a kind of kit of No. 1047 codon mutations of exon of detection PIK3CA genes 20, institute
Stating kit includes such as SEQ ID NO:1 and SEQ ID NO:Primer pair shown in 2.
In wherein some embodiments, the detection kit also includes 2*master mix.
In wherein some embodiments, the detection kit also includes MgCl2。
Present invention also offers a kind of reaction system of No. 1047 codon mutations of exon of detection PIK3CA genes 20,
The reaction system includes such as SEQ ID NO:1 and SEQ ID NO:Primer pair shown in 2.
In wherein some embodiments, the reaction system also includes 2*master mix and MgCl2。
In wherein some embodiments, the reaction system of No. 1047 codon mutations of exon of detection PIK3CA genes 20
For：DNA profiling 1-5 μ L, 2*master mix 10-12.5 μ L, MgCl22.5-3.5μL、SEQ ID NO:1 primer 0.6-1 μ
L、SEQ ID NO:2 primer 0.6-1 μ L, 15-20 μ L are added to without enzyme water.
Present invention also offers a kind of method of No. 1047 codon mutations of exon of detection PIK3CA genes 20, including
Following steps：
(1), using the DNA of detected sample as template, using such as SEQ ID NO:1 and SEQ ID NO:Drawing shown in 2
Thing is analyzed carrying out quantitative fluorescent PCR reaction and HRM, collects fluorescence signal；
(2), the melting curve of interpretation detected sample, if shown in the melting curve of detected sample two and more than
Melting peakss, then it represents that there is mutation in No. 1047 codons of the patient, such as only show a melting peakss, then it represents that the patient's
No. 1047 codons are wild type.
In wherein some embodiments, the reaction system of the quantitative fluorescent PCR of step (1) is：DNA profiling 1-5 μ L, 2*
master mix 10-12.5μL、MgCl22.5-3.5μL、SEQ ID NO:1 primer 0.6-1 μ L, SEQ ID NO:2 primers
0.6-1 μ L, 15-20 μ L are added to without enzyme water.
In wherein some embodiments, the response procedures of step (1) described quantitative fluorescent PCR are：95℃ 10min→(95
DEG C 20s, 62 DEG C of 20s, 72 DEG C of 20s) 45 cycles → 74-84 DEG C of melting temperature, temperature often raises 1 DEG C of acquisition, 40 fluorescence
Signal → 40 DEG C 10s.
In wherein some embodiments, the concentration of step (1) described template is 50-100ng/ μ L.
Compared with prior art, the invention has the advantages that：
1st, the present inventor passes through multiple exploration discovery, and the 20 of PIK3CA genes is carried out using the kit of the present invention
No. 1047 codon HRM methods detections of exon, can detect that as little as 5% mutating molecule, can detect PIK3CA genes
All mutation types on 20 codons of exon 1047, do not limited to by mutating alkali yl site and type；Surveyed with Sanger
Sequence method (goldstandard method) result is compared, and as a result concordance rate is 99.61% (506/508)；2 samples not being inconsistent are through Xiamen Ai De
Mankind's PIK3CA gene kinds mutation detection kit detects, and its result is consistent with the result of the inventive method.Illustrate this sample
Actually belonging to low abundance mutation, goldstandard Sanger PCR sequencing PCRs can not detect because detection sensitivity is low, and the present invention
High sensitivity, it can also be detected for the sample of low abundance mutation.Separately there is the DNA of 1 sample of poor quality, PCR sequencing PCR can not be examined
Survey result, but utilize the inventive method, can obtain testing result, and with Xiamen Ai De mankind's PIK3CA gene kind abrupt climatic changes
Kit testing result is consistent.Illustrate that the inventive method is low to the quality requirement of sample DNA, applicability is wide.Meanwhile present invention side
Requirement of the method to equipment is greatly reduced, and only needs a quantitative real time PCR Instrument with HRM functions can be without using sequencing
Instrument, the scope of application is wider, and instrument cost is lower；
2nd, detection method operation sequence of the invention greatly simplifies, and whole stopped pipe operation, avoids cross pollution, easily forms mark
The external diagnosis reagent product of standardization operation, and detection time and reagent cost substantially reduce, and can complete to detect in 90 minutes.
Brief description of the drawings
Fig. 1:(A) it is to contain No. 1047 codon CAT of 20 exon of PIK3CA genes in sample>HRM points of CTT mutation
Analysis figure；(B) it is to be free of No. 1047 codon CAT of 20 exon of PIK3CA genes in sample>The HRM analysis charts of CTT mutation.
Fig. 2：(A) it is No. 1047 codon CAT of 20 exon of gene containing PIK3CA in sample>The HRM analyses of TAT mutation
Figure；(B) it is to be free of No. 1047 codon CAT of 20 exon of PIK3CA genes in sample>The HRM analysis charts of TAT mutation.
Fig. 3 is that CAT occurs for No. 1047 codons of 20 exon of PIK3CA genes>The standard items of CGT mutation account for different prominent
HRM analysis charts during control with changed scale；Wherein, A is 25% mutation standard items, and B is 10% mutation standard items, and C is 5% mutation standard
Product, D are 0% mutation standard items；
Fig. 4 is using different primers, and the exon of PIK3CA genes 20 is detected using HRM detection methods of the present invention
The amplification curve of No. 1047 codon mutations, wherein, it is good using the expanding effect of primer pair 1, it can correctly tell saltant type
Sample；Saltant type sample can not be detected using primer pair 2,3；It is poor using primer pair 4,5 expanding effects；
Fig. 5 is to use different MgCl2Concentration, the extra of PIK3CA genes 20 is detected using HRM detection methods of the present invention
The amplification curve of No. 1047 codon mutations of aobvious son, wherein, the expanding effect of concentration gradient 1 is good, can detect that 5% is prominent
Become standard items (A)；Concentration gradient 2 can not detect 5% mutant proportion standard items (B)；Concentration gradient 3 can not detect
Go out the standard items (C) of 10% and following mutant proportion；Concentration gradient 4 can not detect the standard items of all mutant proportions
(D)。
Embodiment
Technical scheme is further illustrated below by way of specific embodiment, specific embodiment is not represented to this hair
The limitation of bright protection domain.Some nonessential modifications and adjustment that other people are made according to theory of the present invention still fall within this hair
Bright protection domain.
Step in following examples is this area Conventional procedures in addition to specified otherwise, in following examples
Used raw material, derive from commercially available.
The abrupt climatic change of No. 1047 codons of exon of 1 intestinal cancer neoplasmic tissue sample PIK3CA genes of embodiment 20
1st, primer
A kind of detection intestinal cancer neoplasmic tissue sample PIK3CA gene No. 1047 codons of 20 exon of the present embodiment are dashed forward
The primer of change, there is the base sequence such as SEQ ID NO.1 and SEQ ID NO.2.
Sense primer SEQ ID NO.1:ACCCTAGCCTTAGATAAAACTGAGC
Anti-sense primer SEQ ID NO.2:TCCATTTTTGTTGTCCAGCCACCAT
2nd, reaction system
Use the High Resolution Melting Master (article No. 04909631001) of LightCycler 480
It is formulated as follows reaction system：
| Title | Dosage (μ L) |
| 2*master mix | 10 |
| MgCl2 | 2.8 |
| SEQ ID NO:1 primer | 0.8 |
| SEQ ID NO:2 primers | 0.8 |
| Without enzyme water | 0.6 |
| DNA profiling | 1 |
3rd, detection method
(1), sample source and extracting genome DNA：All patients with bowel cancer tumor samples are all from Zhongshan University attached
Six hospital pathology departments, tissue is collected, genomic DNA is extracted using paraffinized sample extracts kit.DNA profiling concentration point
Do not adjust to 50-100ng/ul.1ul DNA profiling is separately added into above-mentioned reaction system.It is vortexed after mixing, uses Roche
The real-time fluorescence quantitative PCR instrument of LightCycler 480 is detected, and program is as follows：95℃ 10min→(95℃ 20s、62℃
20s, 72 DEG C of 20s) 45 cycles → 74-84 DEG C of melting temperature, temperature often raise 1 DEG C acquisition 40 fluorescence signal → 40 DEG C
10s。
(2), the melting curve of interpretation sample to be measured, to determine that No. 1047 codons of the exon of PIK3CA genes 20 are
It is no mutation to be present.If No. 1047 codons of the exon of sample P IK3CA genes 20 have mutation, testing sample melts bent
Line shows the melting peakss of two and the above, detects 100 samples altogether, and results contrast, two kinds of sides are carried out with Sanger PCR sequencing PCRs
Method result 100% is consistent.
Fig. 1:(A) it is to contain No. 1047 codon CAT of 20 exon of PIK3CA genes in sample>HRM points of CTT mutation
Analysis figure；(B) it is to be free of No. 1047 codon CAT of 20 exon of PIK3CA genes in sample>The HRM analysis charts of CTT mutation.
Fig. 2：(A) it is No. 1047 codon CAT of 20 exon of gene containing PIK3CA in sample>The HRM analyses of TAT mutation
Figure；(B) it is to be free of No. 1047 codon CAT of 20 exon of PIK3CA genes in sample>The HRM analysis charts of TAT mutation.
Embodiment 2 detects the kit of No. 1047 codon mutations of exon of PIK3CA 20
The kit of No. 1047 codon mutations of exon of detection PIK3CA 20 of the present embodiment includes following components：
2*master mix、MgCl2、SEQ ID NO:1 primer and SEQ ID NO:2 primers.
The sensitivity checking of the inventive method of test example 1
Sensitivity checking takes following methods：
1st, using No. 1047 CAT of 20 exon of PIK3CA genes>CGT is mutated standard items, is prepared with wild type standard items
Into the standard items of following several different mutant proportions：25% mutation, 10% mutation, 5% mutation, 0% mutation, specific compound method
With reference to the conventional method of the art.
2nd, detection reagent, i.e. reaction system in embodiment 1 are prepared；
3rd, the standard items 1ul for the different mutant proportions that step 1 prepared is taken, adds in step 2 in detection reagent, will detect
Reagent is put into the real-time fluorescence quantitative PCR instrument of Roche LightCycler 480 and detected；
4th, PCR and HRM programs：95 DEG C of 10min → (95 DEG C of 20s, 62 DEG C of 20s, 72 DEG C of 20s) 45 cycles → molten
74-84 DEG C of temperature is solved, temperature often raises 1 DEG C of acquisition, 40 fluorescence signal → 40 DEG C 10s.
5th, HRM interpretations of result：If No. 1047 codons of the exon of sample P IK3CA genes 20 have mutation, detect
The testing sample melting curve of reagent shows the melting peakss of two and the above.
As a result it is as shown in Figure 3.Fig. 3 is No. 1047 CAT of 20 exon of PIK3CA genes of different mutant proportions>CGT dashes forward
Become the HRM analysis charts of standard items, as seen from Figure 3, guarantee detection 5% using the detection reagent and detection method of the present invention
Mutation.
The inventive method of test example 2 and Sanger PCR sequencing PCRs and Xiamen Ai De mankind's PIK3CA detection in Gene Mutation reagents
The testing result of box compares
509 clinical tumor specimens are all from ZhongShan University attached No.6 Hospital pathology department, wherein colon cancer 244, directly
Intestinal cancer 209,20 cases of breast cancer, stomach cancer 34, carcinoma of anal canal 2.The method of the embodiment of the present invention 1, Sanger PCR sequencing PCRs are taken respectively
This 509 samples are detected with Xiamen Ai De mankind PIK3CA gene mutation detection kits, as a result as shown in table 1.
The testing result of 1 three kinds of methods of table compares
As seen from the results in Table 1,508 samples are shared while there is the method for the invention and goldstandard Sanger PCR sequencing PCRs
Result, the specificity of the inventive method is 99.61%, sensitiveness 100%, positive predictive value 89.47%.2 results
The sample not being consistent, after through Xiamen, Ai De PIK3CA gene mutation detection kits are detected, its result with institute of the present invention
It is consistent to state method, it is actually to belong to low abundance mutation to illustrate this sample, and goldstandard Sanger PCR sequencing PCRs are sensitive due to detecting
Spend it is low can not detect, and the present invention high sensitivity, for low abundance mutation sample can also detect.
Separately there is 1 sample because DNA is of poor quality, can not be detected with Sanger PCR sequencing PCRs, and the inventive method can be to it
Detected, testing result is wild type.After through Xiamen, Ai De PIK3CA gene mutation detection kits are detected, its result
It is consistent with the method for the invention, illustrate that the inventive method is low to the quality requirement of sample DNA, applicability is wide.
Comparative result of the test example 3 using different primers to the abrupt climatic change of the exon of PIK3CA genes 20
Inventor has groped multigroup primer pair, and research HRM methods (method of embodiment 1) are to detecting above-mentioned PIK3CA genes 20
The influence of the experimental result of exon gene mutation.Table 2 below is in the method for embodiment 1, using multigroup Exemplary primers pair
No. 1047 codons of 20 exon of PIK3CA genes carry out detection acquired results.It is demonstrated experimentally that the final choice of primer is closed
The feasibility of method.
Table 2 is using 5 pairs of primer pairs to peak type, the influence result of sentence read result
Note：Upper table uses HRM detection methods, and its PCR program sets 45 circulations altogether.Sample amplification CT values<28 are preferred, if
Not within the range, then it is bad or can not expand to be that this PCR reacts expanding effect to sample amplification CT values for interpretation, is finally possible to
Amount and the follow-up HRM analyses of amplified production can be influenceed.
As a result show, sample 1 is saltant type using the interpretation of Sanger PCR sequencing PCRs, and 5 pairs of primers in table 2 are using the present invention
Methods described and detection reagent detection.It was found that only SEQ ID NO:1、SEQ ID NO:Primer shown in 2 (draws in i.e. upper list 2
For thing to 1) can accurately detect that sample 1 is saltant type, remaining 4 pairs of primer (primer pair 2-5 in i.e. upper list) can not be accurate
Interpretation.
4 different MgCl of test example2Comparative result of the concentration to the exon abrupt climatic change of PIK3CA genes 20
Inventor has groped multiple MgCl2Result shadow of the concentration gradient to the exon abrupt climatic change of PIK3CA genes 20
Ring, using method in test example 1, different MgCl are studied by the mutation standard items of detection 25%, 10%, 5%2Concentration is to above-mentioned
The influence of the experimental result of the exon detection in Gene Mutation of PIK3CA genes 20.Table 3 below is using 4 exemplary MgCl2
The result of 20 exon No. 1047 codon mutation detection of the concentration gradient to PIK3CA.It is demonstrated experimentally that MgCl2Concentration is most
Selection concerns the explicitly of testing result eventually.
Table 3 uses different MgCl2Influence of the volume to peak type, sentence read result
The detection method of test example 5 and Sanger PCR sequencing PCR times and Cost comparisons
Computational methods：For having testing result using detection method and Sanger PCR sequencing PCRs in test example 2
508 samples are adjusted, as a result as shown in table 4.
The comparison of the inventive method of table 4 and the detection time and cost of Sanger PCR sequencing PCR kits
| HRM methods of the present invention | Sanger PCR sequencing PCRs | |
| Experiment spends time estimation | 1.5 hours/sample | 9 hours/sample |
| Experimental cost is estimated | 3.5 yuan/sample | 20 yuan/sample |
From result, PIK3CA No. 1047 sites of 20 exon are examined using HRM detection methods of the present invention
Survey, the detection time of each sample shortens 83.33% than Sanger PCR sequencing PCR, while the testing cost of each sample reduces
82.50%.Detection using HRM methods of the present invention for PIK3CA 20 exon 1047, can be greatlyd save
Detection time and cost, more preferable clinical service patient.
Embodiment described above only expresses the several embodiments of the present invention, and its description is more specific and detailed, but simultaneously
Can not therefore it be construed as limiting the scope of the patent.It should be pointed out that come for one of ordinary skill in the art
Say, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the protection of the present invention
Scope.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
Claims (6)
1. a kind of primer pair of No. 1047 codon mutations of exon of detection PIK3CA genes 20, it is characterised in that described to draw
Thing is to such as SEQ ID NO:1 and SEQ ID NO:Base sequence shown in 2.
A kind of 2. kit of No. 1047 codon mutations of exon of detection PIK3CA genes 20, it is characterised in that the examination
Agent box includes the primer pair described in claim 1.
A kind of 3. method of No. 1047 codon mutations of exon of detection PIK3CA genes 20, it is characterised in that including following
Step：
(1), using the DNA of detected sample as template, fluorescent quantitation is carried out using the primer pair shown in claim 1 respectively
PCR reacts, and collects fluorescence signal, draws melting curve；
(2), the melting curve of interpretation detected sample.
4. the method for No. 1047 codon mutations of exon of detection PIK3CA genes 20 according to claim 3, it is special
Sign is that the reaction system of quantitative fluorescent PCR is described in step (1)：DNA profiling 1-5 μ L, 2*Master mix 10-12.5
μL、MgCl22.5-3.5μL、SEQ ID NO:1 primer 0.6-1 μ L, SEQ ID NO:2 primer 0.6-1 μ L, without enzyme water add to 15-
20μL。
5. the method for No. 1047 codon mutations of exon of detection PIK3CA genes 20 according to claim 3, it is special
Sign is that the response procedures of step (1) described quantitative fluorescent PCR are：The response procedures of the quantitative fluorescent PCR are：95℃
10min → (95 DEG C of 20s, 62 DEG C of 20s, 72 DEG C of 20s) 45cycles → 74-84 DEG C of melting temperature, temperature often raise 1 DEG C and obtain 40
Secondary fluorescence signal → 40 DEG C 10s.
6. the method for No. 1047 codon mutations of exon of detection PIK3CA genes 20 according to claim 3, it is special
Sign is that the concentration of step (1) described template is 50-100ng/ μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610524420.9A CN107574244A (en) | 2016-07-05 | 2016-07-05 | Detect primer pair, kit and the method for No. 1047 codon mutations of exon of PIK3CA genes 20 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610524420.9A CN107574244A (en) | 2016-07-05 | 2016-07-05 | Detect primer pair, kit and the method for No. 1047 codon mutations of exon of PIK3CA genes 20 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107574244A true CN107574244A (en) | 2018-01-12 |
Family
ID=61048923
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610524420.9A Pending CN107574244A (en) | 2016-07-05 | 2016-07-05 | Detect primer pair, kit and the method for No. 1047 codon mutations of exon of PIK3CA genes 20 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107574244A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109913481A (en) * | 2019-04-24 | 2019-06-21 | 无锡市第五人民医院 | PIK3CA gene g.1792224821G > A mutation and its application in Computer-aided Diagnosis of Breast Cancer |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101875970A (en) * | 2010-03-29 | 2010-11-03 | 苏州工业园区为真生物医药科技有限公司 | Rapid detection of APC (Adenomatous Polyposis Coli) gene mutation |
| CN102533958A (en) * | 2010-12-28 | 2012-07-04 | 苏州科贝生物技术有限公司 | Method and kit for detecting human PIK3CA gene mutation |
| WO2012095378A1 (en) * | 2011-01-11 | 2012-07-19 | Roche Diagnostics Gmbh | High resolution melting analysis as a prescreening tool |
| CN103013993A (en) * | 2012-12-26 | 2013-04-03 | 武汉康圣达医学检验所有限公司 | Primer and method for mass spectrometric detection of hotspot mutation of PIK3CA genes by using primer |
-
2016
- 2016-07-05 CN CN201610524420.9A patent/CN107574244A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101875970A (en) * | 2010-03-29 | 2010-11-03 | 苏州工业园区为真生物医药科技有限公司 | Rapid detection of APC (Adenomatous Polyposis Coli) gene mutation |
| CN102533958A (en) * | 2010-12-28 | 2012-07-04 | 苏州科贝生物技术有限公司 | Method and kit for detecting human PIK3CA gene mutation |
| WO2012095378A1 (en) * | 2011-01-11 | 2012-07-19 | Roche Diagnostics Gmbh | High resolution melting analysis as a prescreening tool |
| CN103013993A (en) * | 2012-12-26 | 2013-04-03 | 武汉康圣达医学检验所有限公司 | Primer and method for mass spectrometric detection of hotspot mutation of PIK3CA genes by using primer |
Non-Patent Citations (2)
| Title |
|---|
| PANAGIOTIS等: "PIK3CA Hotspot Mutation Scanning by a Novel and Highly Sensitive High-Resolution Small Amplicon Melting Analysis Method", 《JOURNAL OF MOLECULAR DIAGNOSTICS》 * |
| YARDENA SAMUELS等: "High frequency of mutations of the PIK3CA gene in human cancers", 《SCIENCE》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109913481A (en) * | 2019-04-24 | 2019-06-21 | 无锡市第五人民医院 | PIK3CA gene g.1792224821G > A mutation and its application in Computer-aided Diagnosis of Breast Cancer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108504742B (en) | A kind of kit and method based on digital pcr technology detection HER-2 gene copy number variation | |
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| CN108949990A (en) | A kind of kit and method detecting EGFR genetic mutation | |
| CN107075564A (en) | The method and apparatus for determining tumour nucleic acid concentration | |
| CN108559776A (en) | A kind of biomarker and its application for sudden weak smart auxiliary diagnosis | |
| CN106755297A (en) | One group is based on primer sets that ARMS fluorescence quantitative PCR detection EGFR genes T790M is mutated and preparation method thereof | |
| CN105296637A (en) | Primers, probes and kit for detecting leukemia-related fusion genes | |
| CN110484624A (en) | A kind of gastric cancer biomarker and its detection method and application based on peripheral blood | |
| CN103122387B (en) | Rapid circulating tumor cell (CTCs) fluorescence PCR (Polymerase Chain Reaction) hypersensitivity detection kit and application thereof | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN109593847A (en) | Detect primer pair, kit and the method for the site microsatellite NR24 stability | |
| CN107723384A (en) | A kind of PCR kit for detecting human papilloma virus and preparation method thereof | |
| CN107641649B (en) | Primer pair, kit and method for detecting stability of NR27 locus of microsatellite | |
| CN108642156A (en) | A kind of the digital pcr detection kit and its detection method of T790M gene mutations | |
| Yu et al. | Urinary and plasma cell-free DNA comparison for lung cancer patients treated with epidermal growth factor receptor—thyroxine kinase inhibitors | |
| JP7187081B2 (en) | Methods for early diagnosis and post-treatment monitoring of breast cancer using liquid biopsy multiplex oncogene biomarkers | |
| CN107574244A (en) | Detect primer pair, kit and the method for No. 1047 codon mutations of exon of PIK3CA genes 20 | |
| WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
| CN110331208A (en) | Application of the molecular target in adenocarcinoma of lung Combining diagnosis | |
| CN110004217A (en) | The detection method and application of EGFR gene T790M site mutation in the blood plasma of periphery | |
| CN110358825A (en) | Detect the kit and its application method of people BCR-ABL fusion | |
| CN107326092A (en) | Applications and colorectal cancer detection kit of the related miRNA of colorectal cancer as biomarker | |
| CN106755330A (en) | Cancer related gene differential expression detection kit and its application | |
| CN108165546A (en) | A kind of miRNA biomarker, composition and application thereof | |
| CN107586851A (en) | A kind of KRAS, NRAS, BRAF gene mutation detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190613 Address after: 510655 Sixth Hospital Affiliated to Sun Yat-sen University, 26 Yuancun Erheng Road, Tianhe District, Guangzhou City, Guangdong Province Applicant after: The Sixth Affiliated Hospital of Sun Yat-sen University Address before: 510655 No.26 Yuancun Erheng Road, Tianhe District, Guangzhou City, Guangdong Province Applicant before: Wang Jianping Applicant before: Wang Lei Applicant before: Fu Xinhui Applicant before: Chen Zhiting Applicant before: Huang Jinglin Applicant before: Lin Hanjie Applicant before: Wang Jingxuan |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180112 |