CN107574140A - The preparation method of one plant of bacterial strain to pyrene with degradation function - Google Patents
The preparation method of one plant of bacterial strain to pyrene with degradation function Download PDFInfo
- Publication number
- CN107574140A CN107574140A CN201710895562.0A CN201710895562A CN107574140A CN 107574140 A CN107574140 A CN 107574140A CN 201710895562 A CN201710895562 A CN 201710895562A CN 107574140 A CN107574140 A CN 107574140A
- Authority
- CN
- China
- Prior art keywords
- pyrene
- acetone
- taken
- inorganic salt
- added
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
There is the preparation method of the bacterial strain of degradation function the invention discloses one plant to pyrene, the preparation of bacterial strain is carried out by the secondary screening of sampling, the enrichment of pyrene degradation bacteria, the domestication of pyrene degradation bacteria, the screening of pyrene degradation bacteria, the purifying of pyrene degradation bacteria, pyrene degradation bacteria, the bacterial strain screens what domestication obtained from contaminated soil, it can be degraded using pyrene as sole carbon source, the degradation rate of pyrene steadily rises, at the 10th day, total degradation rate basically reached 30.16%.
Description
Technical field
The present invention relates to the biodegradable processing technology field of polluted soil and water, and in particular to one plant has drop to pyrene
Solve the preparation method of the bacterial strain of function.
Background technology
Common there is degraded PAHs functional microorganisms to have pseudomonas (Pseudomonas), Sphingomonas
(Sphingomonas), Rhod (Rhodococcus), Mycobacterium (Mycobacterium), Bacillus
(Bacillus), Flavobacterium (Flavobacterium), Aeromonas (Aeromonas), Beijerinckia (Bei
Jernckia), corynebacterium (Corynebaeterium), cyanobacteria (Cyanobacteria), Micrococcus
(Micrococcus), Nocardia (Nocardia) standing grain mouth vibrio (Vibrio).
Then above bacterial strain can not be degraded for pyrene as sole carbon source, constrain the reparation of contaminated soil microorganism
The further development and application of technology.
The content of the invention
(1) technical problems to be solved
In order to overcome prior art insufficient, it is proposed that the preparation method of one plant of bacterial strain to pyrene with degradation function, from dirt
Screening domestication obtains in dye soil, can be degraded using pyrene as sole carbon source.
(2) technical scheme
The preparation method of the preparation method of one plant of bacterial strain to pyrene with degradation function：Including the following steps：
1) sample
Respectively 2 topsoil (5- are respectively taken in the soil of contaminated mistake or 10 places of sludge, each place
10cm) sample, 20 samples are taken altogether, with the packed soil taken of sterile sealing, be put in laboratory natural air drying, scalping (removes
The debris such as branch, cullet), 1mm × 1mm sieves are crossed, are saved backup in 4 DEG C.
2) enrichment of pyrene degradation bacteria
The soil that sampling obtains is weighed into 1.00g with electronic balance, added in 99mL inorganic salt liquid culture mediums, in 30 DEG C
24h is cultivated, bacterium amount is moderately increased.
3) domestication of pyrene degradation bacteria
1. taking acetone standard liquid (5.0g/L) 2mL of pyrene, it is added in 100mL inorganic salt liquid culture medium, places
Overnight, it is ensured that after acetone volatilization completely, add the soil inorganic salt fluid nutrient medium 1mL being enriched with, in 30 DEG C, 150rpm shakes
Bed culture 7d.Each pedotheque do 3 it is parallel.
2. taking acetone standard liquid (5.0g/L) 4mL of pyrene, it is added in 100mL inorganic salt liquid culture medium, places
Overnight, it is ensured that after acetone volatilization completely, the bacterium solution 1mL in adding step 1., in 30 DEG C, 150rpm shaking table cultures 7 days.
3. taking acetone standard liquid (5.0g/L) 6mL of pyrene, it is added in 100mL inorganic salt liquid culture medium, places
Overnight, it is ensured that after acetone volatilization completely, the bacterium solution 1mL in adding step 2., in 30 DEG C, 150rpm shaking table cultures 7 days.
4. taking acetone standard liquid (5.0g/L) 10mL of pyrene, it is added in 100mL inorganic salt liquid culture medium, places
Overnight, it is ensured that after acetone volatilization completely, the bacterium solution 1mL in adding step 3., in 30 DEG C, 150rpm shaking table cultures 7 days.
4) screening of pyrene degradation bacteria
The acetone standard liquid of 0.3mL5.0g/L pyrenes is taken to be added on MS inorganic salts solid mediums with liquid-transfering gun, with coating
Rod is coated with uniformly, after acetone volatilization, takes the bacterium solution after 0.1mL domestications to be applied on MS inorganic salts solid mediums.In
30 DEG C incubated 7 days.
5) purifying of pyrene degradation bacteria
Growing state of the microorganism on solid medium is observed, and provokes grow bacterium colony that is vigorous and having degraded to enclose in time
Purified with LB flat boards, rule at least 5 times, using glycerol stocks method preservation.Experiment follows the requirement of sterile working above.
6) secondary screening of pyrene degradation bacteria
The standard curve of pyrene-n-hexane is first produced, is comprised the following steps that：Accurately weighing 0.10g pyrenes is dissolved in n-hexane simultaneously
50mL is settled to, is configured to 2g/L solution.2g/L solution 2.5mL is pipetted in 50mL volumetric flasks and with n-hexane constant volume,
Obtain 100mg/L standard reserving solutions, then be diluted to respectively pyrene concentration for 0,5,10,15,20,25,30,40,50,60mg/L it is molten
Liquid, determined via ultraviolet specrophotometer at 302nm, draw standard curve.
Then 50 μ L pyrene acetone solns (mass concentration 5.0g/L) are aseptically taken to add 5mL sterilized inorganic
Salt fluid nutrient medium, 30 DEG C of incubation 24h, after acetone volatilization completely, the pre-fabricated μ L of bacteria suspension 20 is added as experiment
Group, while by the culture medium of inorganic salt liquid containing pyrene of no addition bacteria suspension as a control group.At 30 DEG C, centrifugal speed is
Concussion and cultivate under the conditions of 150r/min.In culture 1-10d same period timing sampling, with hexamethylene oscillation extraction, every time
3 Duplicate Samples are taken, by the extract of acquirement, the mass concentration of pyrene is detected with ultraviolet spectrophotometry [24-25].Pass through all-wave length
Scanning, linear relationship and the optimal 302nm of span scope are chosen as Detection wavelength, determines the degradation bacteria being purified to pyrene
Degradation property.The mass concentration scope for detecting pyrene is 0-60mg/L.Pyrene degradation rate calculation formula： In formula：Mt represents the content of pyrene in experimental group after cultivating, and Mo represents the pyrene in blank group after cultivating
Content.
The measure of growth curve：The bacterium is seeded in the MSM nutrient solutions of pyrene, wherein pyrene concentration is 100mg/L.35 DEG C,
120r/min, shaking table shaken cultivation, the bacterial number in 1 to 10d separately sampled measure nutrient solution of same time, three is taken daily
Individual Duplicate Samples, blank control group are not to be inoculated with bacterium in the MSM nutrient solutions of pyrene.Bacterial number measure uses turbidimetry.
7) colony morphological observation and microscopy
The pyrene degradation bacteria single bacterium colony of picking after purification is in the flat lining out of inorganic salts or LB for scribbling pyrene.30 DEG C of constant temperature trainings
Support, 1-7d is observed daily.Record colony morphology characteristic.
Size, form and the feature of bacterium are observed by Gram's stain and bacterium special construction decoration method.
8) Physiology and biochemistry is identified
Biochemical characteristic experiment is carried out to the strain for isolating and purifying to obtain.Including：Catalase test, glycolysis experiment,
Indole tests (indole test), production H2S experiments, urease test, gelatin liquefaction test.Physiology and biochemistry identification reference《Bai Jie
Family name's Bacteria Identification handbook》.
9) molecular biology identification
Bacterial strain is identified using the means of molecular biology, its 16S rDNA fragment is expanded using round pcr.PCR
Primer using 16S rDNA universal primer 1492R (5 '-CTACGGCTACCTTGTTACGA-3 ') and 27F (5 '-
AGAGTTTGATCCTGGCTCAG mono- 3 ').Pcr amplification reaction system is to add following component in 0.2ml centrifuge tubes：1.0μL
Genomic DNA (20ng/ μ L), 5 μ L Buffer (Mg2+ containing 2.5mM), 1.0 μ L Taq DNA polymerases, 1.0 μ L dNTP, 1.5
μ L 27F primers, 1.5 μ L 1492R primers, 39.0 μ L ddH2O totally 50 μ L.PCR response procedures are 95 DEG C of pre-degeneration 5min, 95
DEG C denaturation 30s, 58 DEG C annealing 30s, 72 DEG C extension 1min30s, 72 DEG C eventually extension 7min, 35 times circulation, after the completion of reaction, take 3 μ
L PCR primers carry out 1% agarose gel electrophoresis detection.Confirm pcr amplified fragment.By Chengdu D-Cal Bioisystech Co., Ltd
Sequencing, sequencing result are compared on NCBI websites.
Brief description of the drawings
Fig. 1 is pyrene-n-hexane canonical plotting.
Fig. 2 is pyrene residual quantity and growth curve chart.
Fig. 3 is PD-14 Gram's staining figures.
Fig. 4 is electrophoresis result figure.
Fig. 5 is PD-14 phylogenetic trees.
Embodiment
In order to make the purpose , technical scheme and advantage of the present invention be clearer, below in conjunction with brief description of the drawings and in fact
Example is applied, the present invention will be described in further detail.It should be appreciated that specific embodiment described herein is only explaining this
Invention, is not intended to limit the present invention.
Embodiment
Respectively 2 topsoil (5- are respectively taken in the soil of contaminated mistake or 10 places of sludge, each place
10cm) sample, 20 samples are taken altogether, with the packed soil taken of sterile sealing, be put in laboratory natural air drying, scalping (removes
The debris such as branch, cullet), 1mm × 1mm sieves are crossed, are saved backup in 4 DEG C；The soil that sampling obtains is weighed with electronic balance
1.00g, add in 99mL inorganic salt liquid culture mediums, cultivate 24h in 30 DEG C, bacterium amount is moderately increased；Then pyrene degraded is carried out
The domestication of bacterium, is specifically included：
1. taking acetone standard liquid (5.0g/L) 2mL of pyrene, it is added in 100mL inorganic salt liquid culture medium, places
Overnight, it is ensured that after acetone volatilization completely, add the soil inorganic salt fluid nutrient medium 1mL being enriched with, in 30 DEG C, 150rpm shakes
Bed culture 7d.Each pedotheque do 3 it is parallel.
2. taking acetone standard liquid (5.0g/L) 4mL of pyrene, it is added in 100mL inorganic salt liquid culture medium, places
Overnight, it is ensured that after acetone volatilization completely, the bacterium solution 1mL in adding step 1., in 30 DEG C, 150rpm shaking table cultures 7 days.
3. taking acetone standard liquid (5.0g/L) 6mL of pyrene, it is added in 100mL inorganic salt liquid culture medium, places
Overnight, it is ensured that after acetone volatilization completely, the bacterium solution 1mL in adding step 2., in 30 DEG C, 150rpm shaking table cultures 7 days.
4. taking acetone standard liquid (5.0g/L) 10mL of pyrene, it is added in 100mL inorganic salt liquid culture medium, places
Overnight, it is ensured that after acetone volatilization completely, the bacterium solution 1mL in adding step 3., in 30 DEG C, 150rpm shaking table cultures 7 days.
Then filtered out more than in 20 parts of samples can be grown in using pyrene as the minimal medium of sole carbon source and
This three plants of bacterium are respectively designated as PD-5, PD-14, PD-17 by 3 plants of bacterial strain for having degraded to enclose.Further according to 1-7d observation, find
PD-14 selects PD- fastest as the inorganic salts cultured on solid medium of sole carbon source using pyrene and growing way is vigorous
14 are used as experiment bacterial strain.
Then pyrene degraded bacteria strain secondary screening is carried out：
Pyrene-n-hexane standard curve is as shown in Figure 1.The regression equation of standard curve is Y=0.0348x+0.0137, equation
Degree of fitting is 0.9994, linear good.
30 DEG C of cultures in using pyrene as the inorganic salt liquid culture medium of sole carbon source with determined by ultraviolet spectrophotometry PD-14
10 days, the residual volume of pyrene and bacterium in the separately sampled measure nutrient solution of the same time of the 1st, 2,3,4,5,6,7,8,9,10 day
Quantity (OD600 values), takes three Duplicate Samples daily, and the culture medium of inorganic salt liquid containing pyrene to be not added with bacterium is used as blank control.Knot
Fruit is as shown in Figure 2.
As seen from Figure 2, the bacterium has the growth retardation phase of 2 days, and the plateau of this phase is stable, and bacterium breeds on a small quantity,
After being probably microbionation to culture medium, there can be the process of of short duration adaptation to new environment.Substrate pyrene has micro degraded during being somebody's turn to do.
It is the exponential phase of the bacterium after 2 days, viable count is ramped on this phase growth curve, and bacterium is exceedingly fast with stable geometric progression
Increase.At the 5th day, the growth of the bacterium reached stationary phase.It can be drawn from the residual quantity curve of pyrene, the degradation rate of pyrene is steady
Rise, at the 10th day, total degradation rate basically reached 30.16%.
PD-14 is seeded on LB flat boards, 30 DEG C incubated, and 1-7d is observed daily, records its colony characteristics such as
Shown in table 1.
Table 1PD-14 colony characteristicses
After PD-14 Gram's staining, through observing that PD-14 is Gram-negative bar under light microscope (oil mirror)
Bacterium, as shown in Figure 3.Observe that thalline is characterized as no gemma according to bacterium special construction decoration method, atrichia, there is pod membrane.
According to primary Jie Shi Bacteria Identifications handbook, bacterial strain PD-14 Physiology and biochemistry result is as shown in table 3.
The Physiology and biochemistry result of table 3
Note：+：It is positive；-：It is negative
Performing PCR amplification is entered to the 16S rDNA of bacterial strain, product carries out gel electrophoresis, takes 3 μ L DNA Maker and bacterium respectively
Strain pcr amplification product from left to right point sample successively on 1% Ago-Gel, carries out electrophoresis 30min, detection under 120V voltages
The pcr amplification product of bacterial strain.Bacterial strain 16S rDNA electrophoresis results are as shown in Figure 4.
As seen from Figure 4, bacterial strain PD-14 16S rDNA sequence purpose bacterial strains are expanded between 1000bp-2000bp
There is a clearly specific band.Sequence results after sequencing carry out sequence homology comparison with NCBI Blast programs, obtain
Treat the maximum strain information of strain sequence similarity to this, as a result show bacterial strain PD-14 16S rDNA sequences and
Klebsiella sp.M5al(CP020657.1)、Klebsiella oxytoca(AB353046.1)、Klebsiella
oxytoca strain LJ12(KM408607.1)、Klebsiella michiganensis strain S8
Etc. (KX346260.1) homology of bacterial strain is 99%.Most like sequence is downloaded, can also be from GenBank genes
In database, download in Klebsiella with 16S rDNA sequence of the bacterial strain PD-14 sequence similarities greater than or equal to 99%, use
MEGA7.0 softwares are with Neighbor-Joining method sequence of calculation similitudes and do Phylogenetic Analysis, as a result see Fig. 5.
Shown according to colony morphology characteristic, and Physiology and biochemistry result, can be using the preliminary judgement bacterium PD-14 as citric acid
Pseudomonas, and molecular biology identification result, it is Klebsiella Klebsiella oxytoca that can finally draw PD-14.
The above-described embodiments are merely illustrative of preferred embodiments of the present invention, not to the structure of the present invention
Think and scope is defined.On the premise of design concept of the present invention is not departed from, technology of the ordinary people in the field to the present invention
The all variations and modifications that scheme is made, all should drop into protection scope of the present invention, the claimed technology contents of the present invention,
All record in detail in the claims.
Claims (1)
1. the preparation method of one plant of bacterial strain to pyrene with degradation function, it is characterised in that：Including the following steps：
1) sample：Respectively 2 topsoil (5- are respectively taken in the soil of contaminated mistake or 10 places of sludge, each place
10cm) sample, 20 samples are taken altogether, with the packed soil taken of sterile sealing, be put in laboratory natural air drying, scalping (removes
The debris such as branch, cullet), 1mm × 1mm sieves are crossed, are saved backup in 4 DEG C；
2) enrichment of pyrene degradation bacteria：The soil that sampling obtains is weighed into 1.00g with electronic balance, adds the training of 99mL inorganic salt liquids
Support in base, cultivate 24h in 30 DEG C, bacterium amount is moderately increased；
3) domestication of pyrene degradation bacteria：A) acetone standard liquid (5.0g/L) 2mL of pyrene, is taken, is added to 100mL inorganic salt liquid
In culture medium, stand overnight, it is ensured that after acetone volatilization completely, the soil inorganic salt fluid nutrient medium 1mL being enriched with is added, in
30 DEG C, 150rpm shaking table cultures 7d.Each pedotheque do 3 it is parallel；B) acetone standard liquid (5.0g/L) 4mL of pyrene, is taken,
It is added in 100mL inorganic salt liquid culture medium, stands overnight, it is ensured that after acetone volatilization completely, in adds step 1.
Bacterium solution 1mL, in 30 DEG C, 150rpm shaking table cultures 7 days；C) acetone standard liquid (5.0g/L) 6mL of pyrene, is taken, is added to 100mL
Inorganic salt liquid culture medium in, stand overnight, it is ensured that acetone volatilization completely after, the bacterium solution 1mL in adding step 2., in 30
DEG C, 150rpm shaking table cultures 7 days；D) acetone standard liquid (5.0g/L) 10mL of pyrene, is taken, is added to 100mL inorganic salt liquid
In body culture medium, stand overnight, it is ensured that after acetone volatilization completely, the bacterium solution 1mL in adding step 3., in 30 DEG C, 150rpm
Shaking table culture 7 days；
4) screening of pyrene degradation bacteria：Take the acetone standard liquid of 0.3mL5.0g/L pyrenes to be added to MS inorganic salts solid with liquid-transfering gun to train
Support on base, be coated with uniformly with spreading rod, after acetone volatilization, take the bacterium solution after 0.1mL domestications to be applied to MS inorganic salts and consolidate
On body culture medium.It is incubated 7 days in 30 DEG C；
5) purifying of pyrene degradation bacteria：Growing state of the microorganism on solid medium is observed, and it is vigorous simultaneously to provoke growth in time
The bacterium colony for having degraded to enclose is purified with LB flat boards, is rule at least 5 times, using glycerol stocks method preservation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710895562.0A CN107574140A (en) | 2017-09-28 | 2017-09-28 | The preparation method of one plant of bacterial strain to pyrene with degradation function |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710895562.0A CN107574140A (en) | 2017-09-28 | 2017-09-28 | The preparation method of one plant of bacterial strain to pyrene with degradation function |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107574140A true CN107574140A (en) | 2018-01-12 |
Family
ID=61039181
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710895562.0A Pending CN107574140A (en) | 2017-09-28 | 2017-09-28 | The preparation method of one plant of bacterial strain to pyrene with degradation function |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107574140A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109097310A (en) * | 2018-09-09 | 2018-12-28 | 南京工业大学 | Anaerobic strain for degrading polycyclic aromatic hydrocarbon-pyrene and screening method and application thereof |
| CN110564653A (en) * | 2019-10-09 | 2019-12-13 | 常州新东化工发展有限公司 | Klebsiella michiganensis and application thereof in production of1, 3-propylene glycol |
| CN111718867A (en) * | 2020-05-29 | 2020-09-29 | 北京理工大学 | Petroleum aromatic hydrocarbon degrading strain PB3 for producing biosurfactant and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001064841A1 (en) * | 2000-02-28 | 2001-09-07 | Victoria University Of Technology | Degradation of polycyclic aromatic hydrocarbons by microorganisms |
| CN104789506A (en) * | 2015-04-23 | 2015-07-22 | 清华大学 | Thalassospira sp. capable of degrading polycyclic aromatic hydrocarbons under saline environment and application thereof |
-
2017
- 2017-09-28 CN CN201710895562.0A patent/CN107574140A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001064841A1 (en) * | 2000-02-28 | 2001-09-07 | Victoria University Of Technology | Degradation of polycyclic aromatic hydrocarbons by microorganisms |
| CN104789506A (en) * | 2015-04-23 | 2015-07-22 | 清华大学 | Thalassospira sp. capable of degrading polycyclic aromatic hydrocarbons under saline environment and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 周乐: "多环芳烃降解菌的筛选、降解条件及其与玉米联合修复菲、芘污染土壤的研究", 《中国优秀硕士学位论文全文数据库 工程科技I辑》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109097310A (en) * | 2018-09-09 | 2018-12-28 | 南京工业大学 | Anaerobic strain for degrading polycyclic aromatic hydrocarbon-pyrene and screening method and application thereof |
| CN110564653A (en) * | 2019-10-09 | 2019-12-13 | 常州新东化工发展有限公司 | Klebsiella michiganensis and application thereof in production of1, 3-propylene glycol |
| CN110564653B (en) * | 2019-10-09 | 2020-07-03 | 常州新东化工发展有限公司 | Klebsiella michiganensis and application thereof in production of1, 3-propylene glycol |
| CN111718867A (en) * | 2020-05-29 | 2020-09-29 | 北京理工大学 | Petroleum aromatic hydrocarbon degrading strain PB3 for producing biosurfactant and application thereof |
| CN111718867B (en) * | 2020-05-29 | 2022-03-18 | 北京理工大学 | Petroleum aromatic hydrocarbon degrading strain PB3 for producing biosurfactant and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Paungfoo‐Lonhienne et al. | A new species of B urkholderia isolated from sugarcane roots promotes plant growth | |
| CN106011005B (en) | Bacillus amyloliquefaciens T600 and preparation method and application of microbial inoculum thereof | |
| Ambawade et al. | Production of gibberellic acid by Bacillus siamensis BE 76 isolated from banana plant (Musa spp.) | |
| CN110616164A (en) | Enterobacter cloacae Y16 capable of activating insoluble phosphorus and cadmium and application thereof | |
| CN107574140A (en) | The preparation method of one plant of bacterial strain to pyrene with degradation function | |
| CN108998389A (en) | There is pseudomonad and the application of antagonism to rice Xanthomonas campestris and Pyricularia oryzae | |
| CN104403965B (en) | A kind of roost rose of Sharon pseudomonad of water body tetracycline pollutant of degrading and its application | |
| CN108611274B (en) | Method for directionally screening target microbial flora in soil | |
| CN107893047B (en) | Petroleum aromatic hydrocarbon degrading bacterium and application thereof | |
| CN112961930A (en) | Primer group, kit and method for identifying environmental bacteria at genus level | |
| Gulledge et al. | Detection of low numbers of Bacillus anthracis spores in three soils using five commercial DNA extraction methods with and without an enrichment step | |
| Azoddein et al. | Mercury removal using Pseudomonas putida (ATTC 49128): Effect of acclimatization time, speed and temperature of incubator shaker | |
| JP5374750B2 (en) | Method for culturing difficult-to-cultivate microorganisms | |
| CN106011021A (en) | Method for separating, purifying and identifying bacteria with super selenium endurance | |
| Akoijam et al. | Cyanobacterial diversity in hydrocarbon-polluted sediments and their possible role in bioremediation | |
| CN105925516B (en) | A kind of facultative autotrophy type sulphur oxidation denitrification rhizobium F43b and its application | |
| Giraldo et al. | Influence of the algal microbiome on biofouling during industrial cultivation of Nannochloropsis sp. in closed photobioreactors | |
| CN104805018B (en) | Earth mould (Agromyces sp.) MT E of one plant of a variety of phthalic acid ester that can degrade simultaneously | |
| CN106399194A (en) | Pyridine degradation strain A6, fungicide produced by same and application thereof | |
| CN114686403B (en) | Bacillus licheniformis and application thereof in fermentation of citrus waste fruit enzymes | |
| CN111218414A (en) | Bacillus amyloliquefaciens, application and preparation method of fermentation liquor of bacillus amyloliquefaciens | |
| CN104805037B (en) | Achromobacter (Achromobacter sp.) MT H of one plant of degraded diisooctyl phthalate | |
| CN107236683B (en) | Slow staphylococcus strain and application thereof | |
| CN106318891A (en) | Pyridine degradation strain a5, fungicide made from pyridine degradation strain a5 and application thereof | |
| CN105331558B (en) | A kind of fluoranthene degradation bacteria and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |