CN107557488B - Molecular marker of cytoplasmic male sterility fertility restorer gene of brassica napus mustard - Google Patents
Molecular marker of cytoplasmic male sterility fertility restorer gene of brassica napus mustard Download PDFInfo
- Publication number
- CN107557488B CN107557488B CN201710860182.3A CN201710860182A CN107557488B CN 107557488 B CN107557488 B CN 107557488B CN 201710860182 A CN201710860182 A CN 201710860182A CN 107557488 B CN107557488 B CN 107557488B
- Authority
- CN
- China
- Prior art keywords
- seq
- molecular marker
- brassica napus
- cytoplasmic male
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a molecular marker of a cytoplasmic male sterility fertility restorer gene of brassica napus, and particularly relates to an InDel molecular marker of a cytoplasmic male sterility line fertility restorer gene of brassica napus, wherein the InDel molecular marker is one or more of IDC506, IDC551, IDC705, IDC822, IDC860 and IDC 865. The InDel molecular marker provided by the invention can be used for map-based cloning and molecular marker-assisted selection of the gene, and the breeding of a new excellent restorer line is accelerated.
Description
Technical Field
The invention belongs to the technical field of crop molecular breeding, and particularly relates to a molecular marker of a cytoplasmic male sterility fertility restorer gene of brassica napus brassica juncea.
Background
Rape is one of the most important oil crops in China and even in the world, and is an important edible oil source for human beings. A great deal of facts and research show that the yield of rape can be obviously improved by utilizing heterosis. The production of hybrid seeds by using Cytoplasmic Male Sterility (CMS) is the most widely used breeding approach for rape heterosis.
At present, cytoplasmic male sterility types applied to rape production all over the world mainly comprise radish cytoplasmic male sterility (ogu CMS), Polima cytoplasmic male sterility (pol CMS), Shaan 2A cytoplasmic male sterility and the like. Among them, ogu CMS was discovered in the radish population in 1968 by Ogura, a Japanese scholar, and then transferred to Brassica napus by French scholar. ogu CMS aborts completely and its fertility is not affected by temperature and lighting conditions. The ogu restorer gene found in radish brassicae is also introduced into brassica napus, realizes the three-line matching of ogu CMS and is used for the seed selection of rape hybrids. The Polima cytoplasmic Male sterile line (pol CMS) was discovered in the Brassica napus variety Polima introduced in Europe in 1972 by the university of Huazhong agriculture, the department of the Trandzian. The agricultural scientific college in Hunan province in 1976 firstly realized the three-line matching of the system. At present, over 70% of rape hybrid seeds in China are bred by pol CMS. It can be classified into low-temperature sterile type, high-temperature sterile type and stable sterile type, and its sensitivity to temperature mainly depends on cell nucleus, i.e. maintainer line. In view of the fact that the sterile cytoplasm type of rape hybrid in China is single and certain seed production risk exists, breeding of the novel and stable sterile cytoplasm type has important significance for utilizing the rape heterosis.
WJS1ACMS is a type of sterile cytoplasm that has been found to be derived from Brassica juncea, which has been introduced into the Brassica napus sterile line WNJ 01A. Through fertility identification under different ecological environments (a spring rape area and a winter rape area) for many years, the sterile line has thorough abortion, is a pollen-free type, and the fertility of the sterile line is not influenced by temperature and illumination conditions. Meanwhile, researchers cross the hybrid of the hybrid with Chinese cabbage, namely Shanghai Qing or Beijing Chinese cabbage, and breed a stable restorer line Hui (restorer) 01 in the filial generation, wherein the restorer line can completely restore the fertility of WNJ 01A.
However, the prior art does not report the molecular marker of the cytoplasmic male sterile line fertility restorer gene of brassica napus.
Disclosure of Invention
In order to solve the problem that the cytoplasmic male sterility fertility restorer gene of brassica napus can not be efficiently identified in the prior art, the invention provides an InDel molecular marker which can be used for breeding a cytoplasmic male sterility line restorer line of brassica napus, wherein the InDel molecular marker comprises one or more of IDC506, IDC551, IDC705, IDC822, IDC860 and IDC 865.
Wherein, the primer pair of IDC506 is as follows:
as shown in SEQ ID NO. 1: TGTTCGAGAACCATGGTCAA, respectively;
as shown in SEQ ID NO. 2: TTACCGAAGAGATCAGCGCT are provided.
Primer pairs for IDC551 were:
as shown in SEQ ID NO. 3: CATGTAACCGCCTCTCTTCC, respectively;
as shown in SEQ ID NO. 4: GATTGGAACGAGACCAAGGA are provided.
Primer pairs for IDC705 were:
as shown in SEQ ID NO. 5: AAAATGCTTGCGAAAGAGGA, respectively;
as shown in SEQ ID NO. 6: ATCTTGAGTTATGGGCGTGC are provided.
Primer pairs for IDC822 were:
as shown in SEQ ID NO. 7: TTTGCTTGGCAACTTCTCAC, respectively;
as shown in SEQ ID NO. 8: AACTCCCTTCCCAGCTTTTC are provided.
Primer pairs for IDC860 were:
as shown in SEQ ID NO. 9: ACCCAAGCCTCTGCTAGTGA, respectively;
as shown in SEQ ID NO. 10: TCGGTTGGTTAAGGTAGAAAGC are provided.
Primer pairs for IDC865 were:
as shown in SEQ ID NO. 11: GGCCCTAAACCATGGAGTCT, respectively;
as shown in SEQ ID NO. 12: ATGTGTAAAGTGCAGCGTGG are provided.
Whether the material to be detected has the restoring gene or not can be detected by using one or more of the molecular markers.
In order to improve the detection accuracy, the InDel molecular markers comprise two or more of IDC506, IDC551, IDC705, IDC822, IDC860 and IDC 865. Further preferably IDC506, IDC551, IDC705, IDC822, IDC860 and IDC 865. It is further preferred that the InDel molecules are labeled IDC506, IDC551, IDC705, IDC822, IDC860 and IDC 865.
In the present invention, the cytoplasmic male sterile line of Brassica napus is preferably WNJ 01A. The cytoplasmic male sterile line restorer line of Brassica napus is preferably Hui 01. The restorer gene is preferably Rfw.
After PCR amplification, when the labeled IDC506, IDC551, IDC705, IDC822, IDC860 and IDC865 have target bands specific to the restoring gene, the probability that the material to be detected has the restoring gene can reach 94.50%, 98.39%, 99.31%, 98.85%, 97.02% and 96.65% respectively. Markers IDC506 and IDC551 are on one side of the Rfw gene, and IDC705, IDC822, IDC860, and IDC865 are on the other side of the gene. When the markers on both sides are used in combination and have target bands specific to the restoring gene, the probability that the detection material has the restoring gene is 100%.
In the embodiment of the present invention, the PCR reaction system for amplification is: (10. mu.l): 1 × Taq Buffer, 15mM Mmg+2mM dNTP, 0.2U Taq DNA polymerase (Thermo Scientific Co.), 2. mu.M each of forward and reverse primers, 100ng template DNA, supplemented with ddH2O to a final volume of 10. mu.l.
The PCR procedure was as follows: (1) pre-denaturation at 94 ℃ for 3min for 1 cycle; (2) denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s, extension at 72 ℃ for 30s, and 35 cycles; (3) extending for 5min at 72 ℃, 1 cycle, and storing at 4 ℃ for later use after the operation is finished.
In a preferred embodiment of the method of the present invention,
the size of a nucleotide fragment amplified by the marker IDC506 in a restorer line Hui01 is 222bp, and the specific nucleotide sequence is as follows:
5'-TGTTCGAGAACCATGGTCAATGTTTACCACAATCAAGACGAGATAAAAAAAGTGTTTTTACCAGGGCGAGAATGTATCACGCACCTGCAAATGTGAGCGCTAGAACGCCAGAAAGTATCACGGCCTTTGTCGCTGTCAAAACTGAAAAACTCAAGCGAACAATCAGCTTCCAGTGGCCTATTCATGTCCCAGAGGACATCGTTTACCGAAGAGATCAGCGCT-3', as shown in SEQ ID NO. 13.
The size of the nucleotide fragment amplified by the marker IDC506 in the sterile line WNJ01A is 203bp, and the specific nucleotide sequence is as follows:
5'-TGTTCGAGAACCATGGTCAATGTTTACCACAATCAAGACGAGATAAAAAAAGTGTTTTTACCAGGGCGAGAATGTGAGCGCTAGAACGCCAGAAAGTATCACGGCCTTTGTCGCTGTCAAAACTGAAAAACTCAAGCGAACAATCAGCTTCCAGTGGCCTATTCATGTCCCAGAGGACATCGTTTACCGAAGAGATCAGCGCT-3', as shown in SEQ ID NO. 14.
The size of a nucleotide fragment amplified by the marker IDC551 in a restorer line Hui01 is 159bp, and the specific nucleotide sequence is as follows:
5'-CATGTAACCGCCTCTCTTCCCACACTCTCCATAGTACCCTATTTGAAAGTAACCAAGGAGTCCATTTTTGAGACATAGTAATGATCAAAGGCTTGTAAATGGACTTAAGAAAGAACTTGTTTTCAAACCTTTGGAGATAGATTGGAACGAGACCAAGGA-3', as shown in SEQ ID NO. 15.
The size of the nucleotide fragment amplified by the marker IDC551 in the sterile line WNJ01A is 156bp, and the specific nucleotide sequence is as follows:
5'-CATGTAACCGCCTCTCTTCCCACACTTTCTCATAGTACCCTATCGTAAGAAAGAAAAGGAGTCCAGTCTTGAGACATAGCAATGATCAAATGCTTGTAAATGGACTTATCAAAGAACTTTTCAACCTTTGGAGATGGATTGGAACGAGACCAAGGA-3', as shown in SEQ ID NO. 16.
The size of a nucleotide fragment amplified by the label IDC705 in a restorer line Hui01 is 198bp, and the specific nucleotide sequence is as follows:
5'-AAAATGCTTGCGAAAGAGGAGGTAATATTTTTTTTTTGCTAATAAGAAGTTCCGACTACTTTGGGTTCGTTATCTCTTTTCATCTTTGGACCAATCTTTATAAGTACTACGTTTAAAGGCGTGAAACAAGATTCGAGCTTAAGAACACAACGCAACCTTCCTTTTGATACATTGAGGGATCTTGAGTTATGGGCGTGC-3', as shown in SEQ ID NO. 17.
The size of the nucleotide fragment amplified by the marker IDC705 in the sterile line WNJ01A is 183bp, and the specific nucleotide sequence is as follows:
5'-AAAATGCTTGCGAAAGAGGAGGTGATATTTTCTTTTTTTTTGCTAATAAGAAGTTCCGACTACTTTGGGTTTGGACCTATCTTTATAAGTACTACGTTTAAAAGCGTGAAACAAGATTCGAGCTTAAGAACACAACGCAACCGTCCTTTTGATACATTGAGGGATCTTGAGTTATGGGCGTGC-3', as shown in SEQ ID NO. 18.
The size of a nucleotide fragment amplified by the label IDC822 in a restorer line Hui01 is 218bp, and the specific nucleotide sequence is as follows:
5'-TTTGCTTGGCAACTTCTCACTAGATGTGCTTTTCCTCGGTGCCTAGAAACCAAGATTGTACAAGTGATATTCAGACAAGATGTATGATGCAAACCAGTTTATTCAGAAGAGAGCTTACTGCTAAACTCCTAGCATCAGGGGTTGAATCACGTTTGGTAAGCTTCTTCAGCCCTGAGCTATCTGAAGCTCTGATATCTAAACTCCCTTCCCAGCTTTTC-3', as shown in SEQ ID NO. 19.
The size of the nucleotide fragment amplified by the marker IDC822 in the sterile line WNJ01A is 223bp, and the specific nucleotide sequence is as follows:
5'-TTTGCTTGGCAACTTCTCACTAGATGTGCTTTTCCGCGGCGCCTAGAAACCAAGATTGTAGAAGGTATATTAACCCTTTGTTAGTATCAAAGCCAAAGGAAGCTAAAGAAGAAGAGAGCTTACTATTAAACTCCTGGCATCAGGGGTTGAATCACGTTTGGTAAGCTTCTTCAGCCCTGAGCTATCTGAAGCTCTGATATCTAAACTCCCTTCCCAGCTTTTC-3', as shown in SEQ ID NO. 20.
The size of the nucleotide fragment amplified by the marker IDC860 in a restorer line Hui01 is 186bp, and the specific nucleotide sequence is as follows:
5'-ACCCAAGCCTCTGCTAGTGAGCAACAATAGTTACTATTTATTTACACAATTGCTTCAATTTTTCCTTGATATTGTTTTCATTAACTCAAACTTCCTTTGTACGTTGGAAAAAAAAAGTATTTTTTGTTATTATTTGAGGATATTCATTTAAAATTATATTTTTGTCGGTTGGTTAAGGTAGAAAGC-3', as shown in SEQ ID NO. 21.
The size of the nucleotide fragment amplified by the marker IDC860 in the sterile line WNJ01A is 147bp, and the specific nucleotide sequence is as follows:
5'-ACCCAAGCCTCTGCTAGTGAGCAACAATAGTTACTATTTATTTACACAATTGCTTCAATTTTTCCTTGATAAAAAAAGTATTTTTTGTTATTATTTGAGGATATTCATTTAAAATTATATTTTTGTCGGTTGGTTAAGGTAGAAAGC-3', as shown in SEQ ID NO. 22.
The size of the nucleotide fragment amplified by the marked IDC865 in the restorer line Hui01 is 207bp, and the specific nucleotide sequence is as follows:
5'-GGCCCTAAACCATGGAGTCTCCACTTTTTTTTCAAGATTTTTTTTTAATGGATTTTTTCTTGGTGTGGTTTTTAATGAAAGAGGTCTTCATGGTTTYCAAACTAAACCATGTTTGATCGGTTTCCTTGATCAAGCTTGAGGGGGAGTGTTGAGATGAGAGGGTACTTGTTGAGAGAAATGCAGTGAAATGTGTAAAGTGCAGCGTGG-3' as shown in SEQ ID NO. 23.
The size of the nucleotide fragment amplified by the marker IDC865 in the sterile line WNJ01A is 219bp, and the specific nucleotide sequence is as follows:
5'-GGCCCTAAACCATGGAGTCTCCACTCTTTTTTCAAGATTTTTTTTTAATGGATTTTTTCCTGATGTGGTTTTTAATGAAAGAGGTCTTCATGGTTTCCAAACTAAACCATGTTTGATCGGTTTCCTTGATCAAGCTTGAGGGGGAGTGTTGAGAGGAGTGTTGAGATGAGAGGGTACTTGTTGAGAGAAATGCAGTGAAATGTGTAAAGTGCAGCGTGG-3', as shown in SEQ ID NO. 24.
In another aspect of the invention, the invention also provides application of the InDel molecular marker in auxiliary breeding of excellent restorer lines.
In a preferred embodiment of the present invention, the restorer line in the above application is preferably Hui 01.
In a preferred embodiment of the present invention, the above-mentioned InDel molecular marker comprises IDC506, IDC551, IDC705, IDC822, IDC860 and IDC 865.
When the material to be bred or screened is detected, if any one of the nucleotide sequences amplified by PCR (polymerase chain reaction) of IDC506, IDC551, IDC705, IDC822, IDC860 and IDC865 shows the nucleotide sequence amplified in a restorer line such as Hui01, the material can be indicated as the restorer line such as Hui01 within an error range.
Wherein, the nucleotide sequence of IDC506 amplified in restorer Hui01 is shown as SEQ ID NO. 13; the nucleotide sequence of IDC551 amplified in restorer Hui01 is shown in SEQ ID NO. 15; the nucleotide sequence of IDC705 amplified in restorer Hui01 is shown in SEQ ID NO. 17; the nucleotide sequence of IDC822 amplified in restorer Hui01 is shown in SEQ ID NO. 19; the nucleotide sequence of IDC860 amplified in restorer Hui01 is shown in SEQ ID NO. 21; the nucleotide sequence of IDC865 amplified in restorer line Hui01 is shown in SEQ ID NO. 23.
The InDel molecular marker provided by the invention can effectively identify the cytoplasmic male sterile line restorer line of brassica napus mustard, can be used for map-based cloning and molecular marker-assisted selection of the gene, and accelerates the breeding of a new excellent restorer line.
Drawings
FIG. 1 is a graph showing the results of verification and application of the InDel markers IDC506, IDC551, IDC705, IDC822, IDC860 and IDC865 to the F2 population individuals in example 1 of the present invention; f: fertile individual plants; s: a non-fertile individual plant; a: sterile line WNJ 01A; b: restorer line Hui 01; wherein the arrows indicate polymorphic bands of the molecular marker;
FIG. 2 is a map showing the location of chromosome marker Rfw in Brassica napus A09 in example 3 of the present invention; wherein the left numbers indicate the genetic distance between molecular markers.
Detailed Description
The following examples are given to further illustrate the embodiments of the present invention. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
Unless otherwise specified, the technical means used in the examples are conventional technical means well known to those skilled in the art. The reagents used in the examples are commercially available unless otherwise specified.
Example 1: genetic analysis for constructing location population and restoring gene
Hybridizing sterile line WNJ01A as female parent with restoring line Hui01 as male parent, F1The hybrids appeared to be fully fertile, indicating that the fertility restoration trait was controlled by the dominant gene. F obtained by selfing2The population comprises 2161 individuals in total, and the field survey shows that the number of fertile individuals is 1606, and the number of sterile individuals is 555. Chi-square test (chi)2test) shows that the separation ratio of fertile and sterile single plants accords with 3:1 (X)2＝0.50<χ2 0.05,1＝3.84，P>0.05), indicating that restoration of fertility is controlled by a single dominant gene locus, which was designated Rfw.
Example 2: development of molecular marker of restorer gene Rfw
Total DNA of the plant was extracted by CTAB method (Lijia et al, 1994) at F237 extremely fertile single plants and 38 extremely sterile single plants are selected from the group, 80ng of DNA of each single plant is mixed in equal quantity, and a fertile mixing pool (F-Bulk) and a sterile mixing pool (S-Bulk) are respectively constructed. Sequencing of pooled pools by second generation sequencing technology (NGS) (BSA-seq) combined with QTL-seq method was analyzed to locate the Rfw gene within the candidate interval (Chr. A09:27.62-33.87Mb, size 6.25Mb) of Brassica napus A09 chromosome. In this interval we developed a total of 203 InDel markers, performed preliminary analysis in parental, DNA mixing pools and further analysis in partially extremely sterile and extremely fertile individuals.
PCR reaction for marker amplification (10. mu.l): 1 × Taq Buffer, 15mM Mg+2mM dNTP, 0.2U Taq DNA polymerase (Thermo Scientific Co.), 2. mu.M each of forward and reverse primers, 100ng template DNA, supplemented with ddH2O to a final volume of 10. mu.l.
The PCR procedure was as follows: (1) pre-denaturation at 94 ℃ for 3min for 1 cycle; (2) denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s, extension at 72 ℃ for 30s, and 35 cycles; (3) extending for 5min at 72 ℃, 1 cycle, and storing at 4 ℃ for later use after the operation is finished.
Electrophoresis: mu.l of a sample buffer (98% deionized formamide, 10mM EDTA, 0.005% xylene blue FF, and 0.005% bromophenol blue) was added to the PCR amplification product, denatured at 95 ℃ for 5min, cooled in an ice bath, and left at 4 ℃ for further use. And separating PCR products by using 6% polyacrylamide gel electrophoresis, and obtaining the data of the marker genotype of each individual plant after silver staining and developing.
The results showed that there were 6 molecular markers co-developed with distinct polymorphic bands and closely linked to Rfw, namely IDC506, IDC551, IDC705, IDC822, IDC860 and IDC865, respectively.
Example 3 application of molecular marker of restorer Gene Rfw
Marks IDC506, IDC551, IDC705, IDC822, IDC860 and IDC865 are set at F above2Validation and application were performed in the same manner as in example 2 (FIG. 1) in the population. The results show that IDC506 and IDC551 are located on one side of the restorer gene Rfw, with genetic distances of 2.76 and 0.80cM, respectively; IDC705, IDC822, IDC860, and IDC865 were located on the other side, at genetic distances of 0.34, 0.57, 1.49, and 1.61cM, respectively (fig. 2). The IDC551 and IDC705 intervals are located at the physical position of chromosome 30.9-32.0Mb of Brassica napus A9 and have a size of 1.1 Mb. When markers IDC506, IDC551, IDC705, IDC822, IDC860, and IDC865 had target bands specific for the restorer gene, then the probability of the test material having the restorer gene was 94.50%, 98.39%, 99.31%, 98.85%, 97.02%, and 96.56%, respectively. When the markers on both sides are combined pairwise and have target bands specific to the restoring gene, the probability that the detection material has the restoring gene is 100%. The results of the above studies show that the above molecular markers can be used for molecular marker-assisted selection of the Rfw gene.
Finally, the method of the present invention is only a preferred embodiment and is not intended to limit the scope of the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> university of agriculture in Huazhong
<120> molecular marker of cytoplasmic male sterility fertility restorer gene of brassica napus brassica juncea
<130>KHP171115371.7
<160>24
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213>IDC506
<400>1
tgttcgagaa ccatggtcaa 20
<210>2
<211>20
<212>DNA
<213>IDC506
<400>2
ttaccgaaga gatcagcgct 20
<210>3
<211>20
<212>DNA
<213>IDC551
<400>3
catgtaaccg cctctcttcc 20
<210>4
<211>20
<212>DNA
<213>IDC551
<400>4
gattggaacg agaccaagga 20
<210>5
<211>20
<212>DNA
<213>IDC705
<400>5
aaaatgcttg cgaaagagga 20
<210>6
<211>20
<212>DNA
<213>IDC705
<400>6
atcttgagtt atgggcgtgc 20
<210>7
<211>20
<212>DNA
<213>IDC822
<400>7
tttgcttggc aacttctcac 20
<210>8
<211>20
<212>DNA
<213>IDC822
<400>8
aactcccttc ccagcttttc 20
<210>9
<211>20
<212>DNA
<213>IDC860
<400>9
acccaagcct ctgctagtga 20
<210>10
<211>22
<212>DNA
<213>IDC860
<400>10
tcggttggtt aaggtagaaa gc 22
<210>11
<211>20
<212>DNA
<213>IDC865
<400>11
ggccctaaac catggagtct 20
<210>12
<211>20
<212>DNA
<213>IDC865
<400>12
atgtgtaaag tgcagcgtgg 20
<210>13
<211>222
<212>DNA
<213>IDC506-PCR
<400>13
tgttcgagaa ccatggtcaa tgtttaccac aatcaagacg agataaaaaa agtgttttta 60
ccagggcgag aatgtatcac gcacctgcaa atgtgagcgc tagaacgcca gaaagtatca 120
cggcctttgt cgctgtcaaa actgaaaaac tcaagcgaac aatcagcttc cagtggccta 180
ttcatgtccc agaggacatc gtttaccgaa gagatcagcg ct 222
<210>14
<211>203
<212>DNA
<213>IDC506-PCR
<400>14
tgttcgagaa ccatggtcaa tgtttaccac aatcaagacg agataaaaaa agtgttttta 60
ccagggcgag aatgtgagcg ctagaacgcc agaaagtatc acggcctttg tcgctgtcaa 120
aactgaaaaa ctcaagcgaa caatcagctt ccagtggcct attcatgtcc cagaggacat 180
cgtttaccga agagatcagc gct 203
<210>15
<211>159
<212>DNA
<213>IDC551-PCR
<400>15
catgtaaccg cctctcttcc cacactctcc atagtaccct atttgaaagt aaccaaggag 60
tccatttttg agacatagta atgatcaaag gcttgtaaat ggacttaaga aagaacttgt 120
tttcaaacct ttggagatag attggaacga gaccaagga 159
<210>16
<211>156
<212>DNA
<213>IDC551-PCR
<400>16
catgtaaccg cctctcttcc cacactttct catagtaccc tatcgtaaga aagaaaagga 60
gtccagtctt gagacatagc aatgatcaaa tgcttgtaaa tggacttatc aaagaacttt 120
tcaacctttg gagatggatt ggaacgagac caagga 156
<210>17
<211>198
<212>DNA
<213>IDC705-PCR
<400>17
aaaatgcttg cgaaagagga ggtaatattt tttttttgct aataagaagt tccgactact 60
ttgggttcgt tatctctttt catctttgga ccaatcttta taagtactac gtttaaaggc 120
gtgaaacaag attcgagctt aagaacacaa cgcaaccttc cttttgatac attgagggat 180
cttgagttat gggcgtgc 198
<210>18
<211>183
<212>DNA
<213>IDC705-PCR
<400>18
aaaatgcttg cgaaagagga ggtgatattt tctttttttt tgctaataag aagttccgac 60
tactttgggt ttggacctat ctttataagt actacgttta aaagcgtgaa acaagattcg 120
agcttaagaa cacaacgcaa ccgtcctttt gatacattga gggatcttga gttatgggcg 180
tgc 183
<210>19
<211>218
<212>DNA
<213>IDC822-PCR
<400>19
tttgcttggc aacttctcac tagatgtgct tttcctcggt gcctagaaac caagattgta 60
caagtgatat tcagacaaga tgtatgatgc aaaccagttt attcagaaga gagcttactg 120
ctaaactcct agcatcaggg gttgaatcac gtttggtaag cttcttcagc cctgagctat 180
ctgaagctct gatatctaaa ctcccttccc agcttttc 218
<210>20
<211>223
<212>DNA
<213>IDC822-PCR
<400>20
tttgcttggc aacttctcac tagatgtgct tttccgcggc gcctagaaac caagattgta 60
gaaggtatat taaccctttg ttagtatcaa agccaaagga agctaaagaa gaagagagct 120
tactattaaa ctcctggcat caggggttga atcacgtttg gtaagcttct tcagccctga 180
gctatctgaa gctctgatat ctaaactccc ttcccagctt ttc 223
<210>21
<211>186
<212>DNA
<213>IDC860-PCR
<400>21
acccaagcct ctgctagtga gcaacaatag ttactattta tttacacaat tgcttcaatt 60
tttccttgat attgttttca ttaactcaaa cttcctttgt acgttggaaa aaaaaagtat 120
tttttgttat tatttgagga tattcattta aaattatatt tttgtcggtt ggttaaggta 180
gaaagc 186
<210>22
<211>147
<212>DNA
<213>IDC860-PCR
<400>22
acccaagcct ctgctagtga gcaacaatag ttactattta tttacacaat tgcttcaatt 60
tttccttgat aaaaaaagta ttttttgtta ttatttgagg atattcattt aaaattatat 120
ttttgtcggt tggttaaggt agaaagc 147
<210>23
<211>207
<212>DNA
<213>IDC865-PCR
<400>23
ggccctaaac catggagtct ccactttttt ttcaagattt ttttttaatg gattttttct 60
tggtgtggtt tttaatgaaa gaggtcttca tggtttycaa actaaaccat gtttgatcgg 120
tttccttgat caagcttgag ggggagtgtt gagatgagag ggtacttgtt gagagaaatg 180
cagtgaaatg tgtaaagtgc agcgtgg 207
<210>24
<211>219
<212>DNA
<213>IDC865-PCR
<400>24
ggccctaaac catggagtct ccactctttt ttcaagattt ttttttaatg gattttttcc 60
tgatgtggtt tttaatgaaa gaggtcttca tggtttccaa actaaaccat gtttgatcgg 120
tttccttgat caagcttgag ggggagtgtt gagaggagtg ttgagatgag agggtacttg 180
ttgagagaaa tgcagtgaaa tgtgtaaagt gcagcgtgg 219
Claims (1)
1. The application of the primer combination in the auxiliary breeding of the cytoplasmic male sterile line restorer line of brassica napus and mustard is characterized in that the primer combination is as follows:
the first pair of primers is:
as shown in SEQ ID NO. 1: TGTTCGAGAACCATGGTCAA, respectively;
as shown in SEQ ID NO. 2: TTACCGAAGAGATCAGCGCT, respectively;
the second pair of primers is:
as shown in SEQ ID NO. 3: CATGTAACCGCCTCTCTTCC, respectively;
as shown in SEQ ID NO. 4: GATTGGAACGAGACCAAGGA, respectively;
the third pair of primers is:
as shown in SEQ ID NO. 5: AAAATGCTTGCGAAAGAGGA, respectively;
as shown in SEQ ID NO. 6: ATCTTGAGTTATGGGCGTGC, respectively;
the fourth pair of primers is:
as shown in SEQ ID NO. 7: TTTGCTTGGCAACTTCTCAC, respectively;
as shown in SEQ ID NO. 8: AACTCCCTTCCCAGCTTTTC, respectively;
the fifth pair of primers is:
as shown in SEQ ID NO. 9: ACCCAAGCCTCTGCTAGTGA, respectively;
as shown in SEQ ID NO. 10: TCGGTTGGTTAAGGTAGAAAGC, respectively;
the sixth pair of primers is:
as shown in SEQ ID NO. 11: GGCCCTAAACCATGGAGTCT, respectively;
as shown in SEQ ID NO. 12: ATGTGTAAAGTGCAGCGTGG are provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710860182.3A CN107557488B (en) | 2017-09-21 | 2017-09-21 | Molecular marker of cytoplasmic male sterility fertility restorer gene of brassica napus mustard |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710860182.3A CN107557488B (en) | 2017-09-21 | 2017-09-21 | Molecular marker of cytoplasmic male sterility fertility restorer gene of brassica napus mustard |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107557488A CN107557488A (en) | 2018-01-09 |
| CN107557488B true CN107557488B (en) | 2020-04-07 |
Family
ID=60982100
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710860182.3A Active CN107557488B (en) | 2017-09-21 | 2017-09-21 | Molecular marker of cytoplasmic male sterility fertility restorer gene of brassica napus mustard |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107557488B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112725497B (en) * | 2021-01-12 | 2022-04-08 | 华中农业大学 | Molecular marker for identifying stem mustard oxa cytoplasmic male sterility restoring gene and application thereof |
| CN113528698B (en) * | 2021-07-14 | 2022-01-25 | 中国农业科学院油料作物研究所 | InDel molecular marker for identifying and/or distinguishing cabbage vegetables and application thereof |
| CN116622874B (en) * | 2022-10-21 | 2024-04-12 | 南京农业大学 | Molecular marker of low-temperature male sterile locus of brassica napus, primer pair and application of molecular marker |
-
2017
- 2017-09-21 CN CN201710860182.3A patent/CN107557488B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Moleeular markers in Brassica oilseed breeding: current status and future possibilities;Snowdon RJ等;《PlantBreeding》;20041231;第123卷(第1期);1-8 * |
| 甘蓝型油菜萝卜甘蓝细胞质雄性不育系NRO4270A的研究;舒畅;《中国优秀硕士学位论文全文数据库，农业科技辑，华中农业大学硕士学位论文》;20161231;27，摘要 * |
| 芥菜cry2基因RNAi载体的构建与遗传转化研究;梁婷等;《安徽农业科学》;20121231;第40卷(第7期);3894-3898 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107557488A (en) | 2018-01-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Singh et al. | Evaluation of microsatellite markers for genetic diversity analysis among sugarcane species and commercial hybrids | |
| RU2016114532A (en) | RF4 REPAIR GENE FOR CYTOPLASMATIC MEN STERILITY (CMS) OF CORN C-TYPE, MOLECULAR MARKERS AND THEIR APPLICATION | |
| US20100021916A1 (en) | Microsatellite-based fingerprinting system for saccharum complex | |
| CN107557488B (en) | Molecular marker of cytoplasmic male sterility fertility restorer gene of brassica napus mustard | |
| CN105755140A (en) | InDel marker for cotton cytoplasm male sterility restoring lines and method for identifying molecules by aid of InDel marker | |
| CN110241251B (en) | InDel markers for simultaneously identifying cytoplasmic male sterility restorer genes Rf1 and Rf2 of cotton | |
| CN104878099B (en) | The detection method of goat ATBF1 gene mononucleotide polymorphisms and its application | |
| CN108728571A (en) | The InDel molecular labeling and application chain with gossypium harknessii brand fertility restorer gene | |
| CN108866233B (en) | Marker locus, primer pair, kit and application for identifying disease resistance/infection traits of peach trees to meloidogyne incognita | |
| Landergott et al. | Allelic configuration and polysomic inheritance of highly variable microsatellites in tetraploid gynodioecious Thymus praecox agg. | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| CN108441566A (en) | A kind of detection method of goat ATBF1 gene insertion/deletions and its application | |
| CN104561353B (en) | InDel marker in close linkage with cabbage fertility as well as detection method and application of InDel marker | |
| KR101010446B1 (en) | Molecular marker linked to the major resistant gene to pepper anthracnoseColletotrichum capsici and its use | |
| KR20090088492A (en) | Development of sequence-based microsatellite markers in brassica rapa and construction of genetic map | |
| Kyaligonza et al. | Identification of F1 cassava (Manihot esculenta Crantz) progeny using microsatellite markers and capillary electrophoresis | |
| CN113265483B (en) | Method for rapidly identifying 4St chromosome of Elytrigia intermedium | |
| CN103290102B (en) | SNP (Single Nucleotide Polymorphism) classification method and application based on PCR (Polymerase Chain Reaction) | |
| CN113637784B (en) | SSR molecular marker AerM02 for sex identification of actinidia arguta and application thereof | |
| JP4982746B2 (en) | Pig parent-child determination method using DNA marker | |
| CN108950050B (en) | Detection primer and kit for cytoplasmic male sterility restoring gene Rf (DW)10 of Dongfu-type rice, application and detection method | |
| Mbanjo et al. | Development of expressed sequence tags-simple sequence repeats (EST-SSRs) for Musa and their applicability in authentication of a Musa breeding population | |
| CN108866232B (en) | Detection primer and kit for cytoplasmic male sterility restoring gene Rf (DW)11 of Dongfu-type rice, application and detection method | |
| CN114164289A (en) | Soybean nuclear male sterility InDel marker and application thereof | |
| CN107190070B (en) | Universal primer combination of melilotus, application and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |