CN107556384B - Anti-human cystatin C antibody and application thereof - Google Patents

Abstract

The invention relates to a novel anti-human cystatin C antibody and application thereof, belonging to the field of immunochemistry. The invention prepares a plurality of antibodies, and performs pairing screening to obtain an antibody combination (C12 and C14) with sensitivity and specificity meeting the requirements; meanwhile, the preparation method is convenient for mass production and can meet the requirement of large-scale clinical application in the future. The antibody combination is debugged and optimized to obtain the colloidal gold rapid detection test paper card of the human cystatin C, which has simple and convenient operation, sensitivity, specificity and related detection performance and can meet the requirement of human clinical sample detection.

Description

Anti-human cystatin C antibody and application thereof

Technical Field

The invention belongs to the field of immunochemistry, and particularly relates to two anti-human cystatin C (CysC) antibodies, a preparation method thereof and application of the antibodies in human cystatin C detection.

Background

Cystatin C (CysC) consists of 122 amino acids, has a molecular weight of 13.3KD, is a cysteine protease inhibitor, also known as gamma-miniprotein or gamma-retroglobulin. CysC is produced at a constant rate in the body and is present in a variety of body fluids, particularly high in cerebrospinal fluid and seminal plasma. CysC in circulation is cleared only by glomerular filtration and reabsorbed in the proximal convoluted tubule, but is completely metabolized and decomposed after reabsorption and does not return to blood, so that the concentration in blood is determined by the glomerular filtration rate without depending on the influence of any external factors (such as sex, age, diet and the like), and the CysC is an ideal marker reflecting the change of the glomerular filtration rate. Renal clearance indicators such as serum creatinine (Scr), Urea (Urea), endogenous creatinine clearance (Ccr), and the like are affected by many extra-renal factors such as age, sex, height, muscle mass, dietary pattern, drugs, and the like, and renal tubules affecting creatinine secretion, whereas CysC is not affected by these factors. Studies have shown that the reference concentration of blood CysC stabilizes at adult levels after one year of age, up to around sixty years of age, and is gender-free. It has been shown that CysC has a sensitivity of 40% and a specificity of 100% for detecting diabetic nephropathy, compared with other indexes, and thus the occurrence of diabetic microangiopathy can be observed by periodically detecting the change in CysC concentration in blood of diabetic patients. In addition, CysC in serum can be stabilized for two days at room temperature, can be stabilized for 7 days at 0-20 ℃, can be stabilized for 6 months at-80 ℃, and has no obvious influence on the measured value by repeated freeze thawing. In conclusion, CysC becomes an important sensitive index reflecting glomerular filtration conditions through various indexes.

In view of the superiority of CysC in reflecting glomerular filtration rate, the preparation of CysC antibody and the preparation of CysC quantitative detection kit have important clinical application value. The colloidal gold quantitative detection method is convenient to use, easy to popularize and low in cost, can meet the quantitative detection of disease indexes, and is suitable for the immediate inspection of a primary medical system.

Disclosure of Invention

The technical problem to be solved by the invention is to provide an antibody capable of effectively and specifically binding to human cystatin C. More specifically:

the first objective of the invention is to provide two anti-human cystatin C antibodies.

The first anti-human cystatin C antibody (C12),

the heavy chain variable region comprises the following complementarity determining regions: the amino acid sequence is shown as the sequence SEQ ID NO:1, HCDR1 as set forth in sequence SEQ ID NO:2 and/or HCDR2 as shown in SEQ ID NO: HCDR3 shown at 3;

and a light chain variable region sequence thereof comprising the following complementarity determining regions: the amino acid sequence is shown as the sequence SEQ ID NO: 4, LCDR1 shown as a sequence SEQ ID NO: 5 and/or LCDR2 as shown in sequence SEQ ID NO: LCDR3 shown in fig. 6.

The nucleotide sequences of HCDR 1-HCDR 3 and LCDR 1-3 are preferably shown as SEQ ID NO: 17 to 22.

Preferably, the amino acid sequence of the heavy chain variable region of the C12 antibody is shown as SEQ ID NO. 7, the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 8, the heavy chain variable region and the light chain variable region are directly fused by connecting short peptides, and the amino acid sequence is shown as SEQ ID NO. 35.

More preferably, the nucleotide sequence of the heavy chain variable region of the C12 antibody is shown in SEQ ID NO. 23, the nucleotide sequence of the light chain variable region is shown in SEQ ID NO. 24, the heavy chain variable region and the light chain variable region are directly fused by connecting short peptides, and the nucleotide sequences are shown in SEQ ID NO. 36.

A second anti-human cystatin C antibody (C14),

the heavy chain variable region of the antibody comprises the following complementarity determining regions: the amino acid sequence is shown as the sequence SEQ ID NO: 9, HCDR1 as shown in sequence SEQ ID NO: 10 and/or HCDR2 as set forth in sequence SEQ ID NO: HCDR3 shown in fig. 11;

and the antibody light chain variable region sequence comprises the following complementarity determining regions: the amino acid sequence is shown as SEQ ID NO: 12, LCDR1 as shown in sequence SEQ ID NO: 13 and/or LCDR2 as set forth in sequence SEQ ID NO: LCDR3 shown at 14.

The nucleotide sequences of HCDR 1-HCDR 3 and LCDR 1-3 are preferably shown as SEQ ID NO: 25 to 30.

Preferably, the amino acid sequence of the heavy chain variable region of the C14 antibody is shown as SEQ ID NO. 15, and the amino acid sequence of the light chain variable region of the antibody is shown as SEQ ID NO. 16; the heavy chain variable region and the light chain variable region are directly fused by connecting short peptides, and the amino acid sequence of the heavy chain variable region and the light chain variable region is shown as SEQ ID NO. 35.

More preferably, the nucleotide sequence of the heavy chain variable region of the C14 antibody is shown in SEQ ID NO:31, the nucleotide sequence of the light chain variable region is shown in SEQ ID NO:32, the heavy chain variable region and the light chain variable region are directly fused by connecting short peptides, and the nucleotide sequences are shown in SEQ ID NO: 36.

The second purpose of the invention is to provide two single-chain antibodies, wherein the amino acid sequence of the antibody C12 is shown in SEQ ID NO. 33; the amino acid sequence of the antibody C14 is shown in SEQ ID NO. 34.

The third purpose of the invention is to provide two nucleotide sequences for coding the single-chain antibody, wherein the nucleotide sequences are shown as SEQ ID NO. 37 and SEQ ID NO. 38.

The fourth purpose of the invention is to provide an expression vector containing the nucleotide sequence.

The fifth object of the present invention is to provide a recombinant host bacterium containing the above expression vector.

It is a sixth object of the present invention to provide a method for producing the above single-chain antibody, comprising:

1) culturing the recombinant host bacteria under proper conditions to express the antibody;

2) then purifying and collecting the antibody from the host bacteria.

The seventh purpose of the invention is to provide the application of the anti-human cystatin C antibody in detecting the content of human cystatin C.

The eighth purpose of the invention is to provide a group of antibody pair combinations which can be paired and can detect human cystatin C; the antibody has high detection sensitivity and good specificity to the combination.

The ninth purpose of the invention is to provide a colloidal gold immunochromatographic assay quantitative detection card for detecting human cystatin C by using the anti-human cystatin C antibody, which comprises a sample absorption pad, a gold label pad, a reaction membrane and a water absorption pad; the gold-labeled pad is sprayed with an antibody C12 labeled by colloidal gold particles, the reaction membrane is provided with a detection zone and a quality control zone, the position of the detection zone is coated with an antibody C14, and the position of the quality control zone is coated with an anti-His tag antibody or Protein L. The reaction membrane is preferably a nitrocellulose membrane. The anti-His tag antibody is preferably a murine anti-His antibody.

The invention prepares a plurality of antibodies, and performs pairing screening to obtain a group of antibody combinations (C12 and C14) with sensitivity and specificity meeting the requirements; meanwhile, the preparation method is convenient for mass production and can meet the requirement of large-scale clinical application in the future. The antibody combination is debugged and optimized to obtain the colloidal gold immunochromatographic assay quantitative detection card of human cystatin C, which has the advantages of simple operation, sensitivity, specificity and related detection performance and can meet the requirement of human plasma sample detection.

Drawings

FIG. 1 shows the electrophoresis of the genes for the heavy and light chain variable regions of antibodies M12 and M14. Lane 1 is the PCR amplified gene of the heavy chain variable region of M12, Lane 2 is 500DNA Ladder, Lane 3 is the PCR amplified gene of the light chain variable region of M12, Lane 4 is the PCR amplified gene of the heavy chain variable region of M14, and Lane 5 is the PCR amplified gene of the light chain variable region of M14.

FIG. 2 is a schematic diagram of the structure of a single-chain antibody. V_HDenotes the heavy chain variable region sequence, V_LRepresents the light chain variable region sequence, and the His tag is six histidines.

FIG. 3 is an agarose gel electrophoresis of the PCR product of single-chain antibody expression. FIG. 3-a is the PCR product of the C12 gene; FIG. 3-b shows the PCR product of the C14 gene.

FIG. 4 is a diagram showing the effect of detection of single-chain antibody specificity (Western Blot). FIG. 4-a is the single chain antibody C12; FIG. 4-b shows the single chain antibody C14.

FIG. 5 is a diagram showing the results of the colloidal gold immunochromatographic assay quantitative detection card of the present invention. 1 is a sample pad, 2 is a reaction film, 3 is an absorption pad, 4 is a quality control line (C line), 5 is a detection line (T line), 6 is a gold label pad, and 7 is a PVC sheet.

Fig. 6 is a graph of a CysC test card (CC14-CC12) fit, where the standard curve equation is y-0.002 x²+0.120x +0.066, where the correlation coefficient R²＝0.999。

Fig. 7 is a graph of a linear range of a CysC detection card (CC14-CC12), in which y is 1.004x +0.103 and a correlation coefficient is R²＝0.997。

Fig. 8 is a comparison chart of the cystatin C quantitative determination reagent with good reputation on the market and the product to be evaluated, in which the standard curve equation is y ═ 1.090x-0.517, and the correlation coefficient is R²The result of the quantitative detection of the kit and the commercial main stream cystatin C is better consistent with 0.953.

Detailed Description

Definition of

"antibody", also known as immunoglobulin, is a large Y-shaped protein secreted by B lymphocytes, and is an immunoglobulin molecule capable of specifically binding to a target antigen, such as a protein, a sugar, a polynucleotide, a lipid, a polypeptide, a small molecule compound, etc., through complementary sites (antigen-binding sites) at the two bifurcated tips of the Y.

"Single chain antibody" (scFv) refers to the variable region of the heavy chain (V) of an antibody_H) And light chain variable region (V)_L) A single-chain fusion protein is formed by connecting 15-20 amino acid short peptides (linkers), and the linkers used for connection are usually rich in glycine and serine, so that the stability and flexibility of a single-chain antibody are facilitated. The connection mode can be V_LIs connected to V_HC-terminal, or vice versa. Despite the removal of the constant region and the introduction of the linker, the single-chain antibody retains the specificity of the antibody to the antigen, and has the characteristics of small molecular weight, strong penetration, weak antigenicity and the like.

Complementary-determining regions (CDRs), also called hypervariable regions. Patterned at the amino acid end of the antibody monomer is the most critical region for binding of the target antigen to the antibody, and in immune network theory, the complementarity determining regions of each antibody are also called idiotypes or genotypes.

Example 1 preparation of human cystatin C-resistant hybridoma cell line

1. Animal immunization

BALB/C female mice (purchased from Kyoto laboratories, Inc.) were immunized with cystatin C extracted from human plasma (purchased from HyTest, Inc.) according to the general immunization protocol. For specific immunization, see "guidelines for antibody preparation and use". And tracking the serum titer of the immune mice by adopting an indirect ELISA method, selecting the immune mice with the highest serum titer, and performing fusion experiments on the spleen cells and myeloma cells of the mice.

2. Cell fusion

(1) Preparation of spleen cells

Immunized mice, eyeballs are picked and blood is taken, after cervical vertebra is cut off, the immunized mice are placed in 75% (v/v) alcohol for soaking for 10 minutes, spleens of the immunized mice are taken out from a sterile operating platform, the spleens are placed in a cell screen, cells are fully ground, the cells are screened, the spleen is centrifugally washed for a plurality of times by using sterile 1640 culture medium (purchased from Gibco company), and then the cells are resuspended to prepare single cell suspension, and the single cell suspension is counted for standby.

(2) Preparation of feeder cells

Taking one female BALB/c mouse 8-10 weeks old, picking an eyeball to obtain negative serum, and immersing the negative serum in 75% (v/v) alcohol for 10 minutes after the cervical vertebra is cut off; the abdominal skin was aseptically peeled, the peritoneum was exposed, and about 10mL of 1640HT medium (purchased from SIGMA) was injected into the abdominal cavity of the mouse with a syringe, and the abdomen was gently massaged and air-blown several times. Sucking the culture medium containing the macrophages and injecting the culture medium into 20% 1640HAT culture medium for later use;

taking one female BALB/c mouse with the age of 2-3 weeks, and immersing the mouse in 75% (v/v) alcohol for 10 minutes after the mouse dies after cervical vertebra breakage; aseptically placing thymus into a cell screen, grinding, sieving to obtain thymocytes, and placing the thymocytes into the 20% 1640HAT culture medium containing macrophages for later use.

(3) Cell fusion

Mouse myeloma cell line SP2/0 was selected at the logarithmic growth phase and collected and counted. GetAbout 10⁸The spleen cells are mixed with 2 × 10⁷Each of the above SP2/0 cell lines was mixed in a fusion tube, centrifuged at 1000rpm for 10 minutes, and the supernatant was discarded (discarded as clean as possible), and the fusion tube was gently rubbed back and forth on the palm of the hand to loosen the pellet. 1mL of preheated PEG1450 (polyethylene glycol 1450, available from SIGMA) was added slowly and quickly over 60 seconds, 30mL of 1640HT medium was added and stopped, centrifuged at 1000rpm for 10 minutes, the supernatant was removed, the precipitate was loosened by gentle rubbing, and added to 20% of 1640HAT medium obtained in step 2.

Mixing the HAT culture medium, subpackaging at 200 μ L/well into 96-well cell culture plate, standing at 37 deg.C and 5% CO₂Cultured in a cell culture box. After one week, 20% 1640HAT medium was replaced with 10% 1640HT medium, and after 3 days, the supernatant was examined.

3. Screening of human cystatin C-resistant specific hybridoma

(1) Preparation of the test plate: diluting CysC (purchased from HyTest company) to 1 mu g/mL by using CB coating solution, coating a 96-hole ELISA plate at 100 mu L/hole, coating overnight at 2-8 ℃, washing and patting to dry once; PBST buffer containing 2% bovine serum Albumin (BovineSerum Albumin, BSA) was blocked (200 ul/well) for 2 hours at 37 ℃; patting dry for later use.

(2) Screening of positive clones: adding 100 μ L/well of cell culture supernatant to be detected into the detection plate, performing action at 37 deg.C for 30min, washing, drying, adding 100 μ L/well HRP-labeled goat anti-mouse IgG, performing action at 37 deg.C for 30min, washing, drying, adding 100 μ L/well TMB color development solution, performing light-shielding development at 37 deg.C for 15 min, adding 50 μ L of 2M H per well₂SO₄The reaction was stopped and the value read at OD 450. Positive well determination principle: OD450 value/negative control value is not less than 2.1. Selecting positive clone strains to carry out cell cloning screening. After three to four rounds of cloning screening, the positive rate of the monoclonal cell strain is determined to be a stable cell strain with 100 percent of positive rate, and the cell strain is determined. Hybridoma cell strains M12 and M14 both have higher titer, and then the hybridoma cell strains are further subjected to antibody variable region sequence sequencing analysis.

Example 2 determination of variable region sequences of antibodies of hybridoma cell lines

The sequences of the variable regions of the M12 and M14 antibodies secreted by the hybridoma cell lines were determined.

Extraction of RNA: total RNA extraction was performed on the hybridoma cell lines M12 and M14 and reverse transcription was immediately performed with reference to the instructions of a cell total RNA extraction kit (purchased from Roche Co.);

reverse transcription of RNA into DNA: performing reverse transcription on the total RNA extracted in the previous step with reference to Thermo Scientific reversed First strand and cDNAsSynthesis Kit (purchased from Thermo Co., Ltd.), preparing cDNA, and freezing and storing at-20 deg.C for later use;

c. PCR amplification and recovery of variable region sequences: performing PCR amplification on variable region sequences of heavy chains and light chains by using cDNA obtained in the above step as a template and a universal primer for the variable region sequences of a mouse IgG subtype monoclonal antibody as a primer, and recovering the PCR product by using a DNA gel recovery kit (purchased from TIANGEN company), wherein the DNA gel recovery kit is shown in figure 1;

d. cloning and sequencing of variable region sequences the heavy and light chain variable region genes were ligated to pMD18-T vector, respectively, according to the cloning vector pMD18-T kit (available from Takara), transformed into E.coli DH5 α, and positive clones were selected and sequenced by Nanjing Kingsry Biotech Co.

The amino acid sequence of the heavy chain variable region of the antibody M12 secreted by the hybridoma cell strain is shown as SEQ ID NO: shown in fig. 8. The Vbase2 database analyzes the above sequences, and the amino acid sequences of the complementarity determining regions of the heavy chain variable region are: as shown in sequence SEQ ID NO:1, HCDR1 as set forth in sequence SEQ ID NO:2, HCDR2 as shown in sequence SEQ ID NO: HCDR3 shown at 3; the amino acid sequence of each complementarity determining region of the light chain variable region is: as shown in sequence SEQ ID NO: 4, LCDR1 shown as a sequence SEQ ID NO: 5, LCDR2 shown as a sequence SEQ ID NO: LCDR3 shown in fig. 6.

The amino acid sequence of the heavy chain variable region of the antibody M14 secreted by the hybridoma cell strain is obtained by sequencing and is shown as SEQ ID NO: shown at 16. The Vbase2 database analyzes the above sequences, and the amino acid sequences of the complementarity determining regions of the heavy chain variable region are: as shown in sequence SEQ ID NO: 9, HCDR1 as shown in sequence SEQ ID NO: 10, HCDR2 as shown in sequence SEQ ID NO: HCDR3 shown in fig. 11; the amino acid sequence of each complementarity determining region of the light chain variable region is: as shown in sequence SEQ ID NO: 12, LCDR1 as shown in sequence SEQ ID NO: 13, LCDR2 as shown in sequence SEQ ID NO: LCDR3 shown at 14.

Example 3 recombinant expression and purification of Single chain antibodies

According to the sequencing results of example 2, a linker peptide (GGGGS) was added between the heavy and light chain variable regions of the antibodies of hybridoma cell lines M12 and M14, respectively₃Six histidines are introduced, and the whole gene is artificially synthesized and constructed into pichia pastoris to carry out the recombinant expression of the single-chain antibody. The expressed single-chain antibodies were named antibody C12 and antibody C14, respectively, and their structural compositions are shown in FIG. 2. The recombinant expression of the single-chain antibody is specifically as follows:

1. construction of expression plasmid for Single chain antibody Gene

The gene sequence of the artificially synthesized single-chain antibody C12 is shown as SEQ ID NO. 37, and the amino acid sequence is shown as SEQ ID NO. 33; the nucleotide sequence of the artificially synthesized single-chain antibody C14 is shown as SEQ ID NO. 38, and the amino acid sequence is shown as SEQ ID NO. 34.

The DNA sequence of the XhoI sequence in the pPICZ α A vector is introduced into the upstream of the artificially synthesized single-chain antibody C12 and the fragment synthesized by the whole gene C14, the XbaI restriction enzyme site is introduced into the downstream, and the fragment is constructed into a pUC57 plasmid (provided by Nanjing Kingsry Biotech Co., Ltd.) to obtain a long-term storage plasmid, which is marked as pUC57-C12-scFv- (HIS)₆And pUC57-C14-scFv- (HIS)₆PCR amplification was performed, wherein the upstream primer P1 was CGCCAGGGTTTTCCCAGTCAC GAC and the downstream primer P2 was AGCGGATAACAATTCACACACAGGA after conventional PCR procedure, agarose gel electrophoresis analysis (FIG. 3) showed that the sizes of both products were consistent with the expected sizes (706bp, 725 bp). after recovery and purification of the PCR-obtained gene product, XhoI (# R0146S, purchased from New England Biolabs) and XbaI (# R0145V, purchased from New England Biolabs) were double digested and ligated to pPICZ α A (V19520, purchased from Invitrogen) plasmid using T4 ligaseThen, the cells were transformed into DH5 α competent cells, cultured overnight at 37 ℃ on LB plates containing Zeocin (R250-01, purchased from Invitrogen Co.), screened positive clones the next day, sequenced, aligned and completely identical to the expected sequences to obtain expression plasmids of antibodies C12 and C14, which are respectively designated as pPICZ α -C12-scFv- (HIS)₆And pPICZ α -C14-scFv- (HIS)₆。

2. Construction, screening and expression of single-chain antibody gene in pichia host engineering strain

YPDS solid medium preparation: refer to the Invitrogen company EasySelectPichia Expression Kit Specification; pichia competent cells: refer to the EasySelectPichia Expression Kit Specification; preparing a BMGY culture medium: refer to the Multi-Copy Pichia Expression Kit Specification by Invitrogen; preparing a BMMY culture medium: refer to the Multi-Copy Pichia Expression Kit Specification by Invitrogen.

Mixing pPICZ α -C12-scFv- (HIS)₆And pPICZ α -C14-scFv- (HIS)₆The plasmid was linearized by restriction with SacI restriction enzyme. After ethanol precipitation, the linearized vectors are respectively transformed into X-33 competent yeast cells, and are respectively spread on YPDS solid culture media containing Zeocin, and cultured for 3-5 days at 30 ℃, so that positive clones are generated.

The single clone obtained above was picked up and cultured to OD at 30 ℃ in 5mL of BMGY medium₆₀₀When the concentration is 2.0-6.0, 1mL of the preserved strain is taken, the residual bacterial liquid is transferred to BMMY after being resuspended, and small-amount induction expression is carried out, and methanol is supplemented every 24 hours until the final concentration is 1% (v/v). After one week, the supernatant of the bacterial liquid is collected by centrifugation, and the expression condition of the target protein is observed by protein immunoblot analysis (Western blot). The primary antibody in Westernblot was an anti-HIS-Tag antibody (His-Tag (2A8) Mouse mAb, M20001, available from Ebbitt biomedical (Shanghai) Co., Ltd.).

Inoculating the obtained recombinant fusion protein gene engineering strains of C12 and C14 in BMGY culture medium, respectively, culturing at 30 deg.C and 220rpm until the thallus density reaches OD₆₀₀Methanol was added every 24 hours to a final concentration of 1.0% (v/v) 2.0 to 6.0. After one week, the fermentation broth was collected.

3. Single chain antibody purification

The method adopts a histidine-tag affinity column to purify the single-chain antibodies C12 and C14 fusion protein, and selects HisTrap HP as a pre-packed column, and comprises the following specific steps:

(1) impurity removal pretreatment of fermentation liquor: supernatant of the fermentation liquid of the fusion protein of the antibodies C12 and C14 obtained by the expression is centrifuged to collect the supernatant, and binding buffer is added to ensure that the final concentration of the supernatant is 300mM NaCl and 20mM NaH₂PO₄10mM amidazole, adjusted to pH7.5, and filtered through a 0.45 μm filter.

(2) HisTrap HP affinity column purification: the antibody C12 and C14 fusion protein fermentation broth obtained by the pretreatment was subjected to affinity purification using a fully automated intelligent protein purification system (AKTA avant150, available from GE healthcare Co.), and the column was HisTrap HP (17-5248-02, available from GE healthcare Co.). The binding buffer was 300mM NaCl, 20mM NaH2PO4, 10mM Imidazole, pH7.5, and the elution buffer was 300mM NaCl, 20mM NaH2PO4, 500mM Imidazole, pH 7.5. Linear elution was performed during elution and the individual elution peaks were collected. Purity was verified by SDS-PAGE, collection tubes meeting the requirements were pooled, buffer changed to PBS and concentrated by ultrafiltration (1mg/mL), filter sterilized and stored at-20 ℃ for future use.

Example 4 evaluation of Single chain antibody Performance

1. Western blot identification of single-chain antibodies C12 and C14

a. Polyacrylamide gel electrophoresis: preparing 12% separation gel and 5% concentrated gel, loading standard protein and native CysC protein (purchased from HyTest company), and performing electrophoresis at constant pressure for 1 hr;

b. film transfer: the membranes were spun for 1 hour under constant flow (35 mA/membrane) conditions, and the proteins on the two polyacrylamide gels were transferred to two nitrocellulose membranes, respectively. Staining SDS-PAGE gel subjected to membrane transfer by Coomassie brilliant blue G250, and observing the residual condition of protein;

c. and (3) sealing: TBST buffer containing 5% skimmed milk was blocked (blocking solution) overnight at 4 ℃; washing with a washing solution (TBST, for details, TBST buffer of TaKaRa) once for 10 minutes after blocking;

d. antigen-antibody reaction: diluting a confining liquid (according to a volume ratio of 1: 400), adding horseradish peroxidase labeled C12(C12-HRP, 1mg/mL, labeled by a classic sodium periodate method in the company, the same below) and horseradish peroxidase labeled C14(C14-HRP, 1mg/mL, labeled by a classic sodium periodate method in the company, the same below) into the two cellulose nitrate membranes respectively, and reacting at room temperature for 1 hour; TBST washes 5 times for 10 minutes each;

e. and (3) color development and photographing: sucking up residual liquid on the nitrocellulose membranes, adding a mixed solution (purchased from Thermo company) of 2mL of a stable peroxidase solution (1mL) and a luminol/enhancer solution (1mL) into each nitrocellulose membrane, uniformly wetting the surface of the nitrocellulose membranes, carrying out a reaction at room temperature in a dark place for one minute, and then photographing in a gel imaging system (purchased from GE company) (figure 4-a, figure 4-b) to obtain a result.

As seen in the detection results, C12 and C14 have better specificity, and can specifically detect CysC protein.

2. Evaluation of single-chain antibodies C14 and C12 on colloidal gold detection platform

The purified antibodies in the embodiment 3 are paired and combined to be respectively used as coating antibodies or labeled antibodies to be paired and detected for cystatin C (CysC), and the detection steps are as follows:

1) diluting C14 or C12 to 1mg/mL with antibody coating solution, and streaking on nitrocellulose membrane;

2) c14 or C12 labeled with colloidal gold is diluted 3 times with 0.01M PB buffer solution and then is spread on the bonding pad;

3) pasting, slitting and clipping the film as shown in FIG. 5 (see example 5 for details of preparation)

4) Diluting CysC standard substance (manufactured by Zhonghong) with sample diluent to reach the concentration of 7mg/L and 1mg/L, respectively adding 50ul of the two concentration standard substances and the zero concentration standard substance (namely the sample diluent) into a colloidal gold detection card (C12 is coated with-C14 marker or C14 is coated with-C12 marker), and after 10min, placing the detection card on a reading instrument for reading. The results are shown in the following table:

from the results, it can be seen that the double-antibody sandwich detection system composed of C14 as a coating antibody and C12 as a labeled antibody can be applied to a colloidal gold detection platform for CysC detection.

Example 5 preparation of colloidal gold immunoassay card against human cystatin C

1. Solution preparation

1)0.01M PB buffer preparation: weighing Na₂HPO₄·12H₂O 3.22g，NaH₂PO₄·2H₂0.15g of O, 1000mL of purified water, stirring with a rotor until dissolved, measuring the pH with a pH meter to 7.4. + -. 0.1, and filtering with a 0.45um filter membrane.

2) Preparing a sealing liquid: bovine Serum Albumin (BSA)5g was weighed, 50mL of 0.01M PB solution (pH 7.4. + -. 0.1) was added, and the mixture was stirred on a rotor until dissolved.

3) Preparation of antibody coating solution: 0.2mL of isopropanol was added to 9.8mL of 0.01M PB solution (pH 7.4. + -. 0.1) and the mixture was stirred on a rotor for 5-10 min.

4) Preparing a gold-labeled antibody re-solution: weighing 1g bovine serum albumin and 5g trehalose, adding 100mL 0.01M PB solution (pH7.4 + -0.1), stirring with rotor until dissolved, adding 25ul Tween-20, and stirring with rotor for 5-10 min.

5) Preparation of sample diluent: weighing 12.5g bovine serum albumin, adding 500mL 0.01M PB solution (pH7.4 + -0.1), stirring with a rotor until dissolved, adding 0.5mL Proclin300, and stirring with a rotor for 5-10 min.

2. Preparation of human cystatin C colloidal gold detection card

1) Labeling of colloidal gold

Colloidal gold labeling of antibody C12 (exemplified with 1mL of colloidal gold solution): by K₂CO₃Adjusting the pH value of the colloidal gold (4 ul 0.2M K is added into each 1mL of the colloidal gold₂CO₃) Stirring for 5-10min, slowly adding antibody C12 (25 ug antibody C12 per 1mL of colloidal gold), and stirring at low speed for 30 min; adding the confining liquid until the final concentration is 10% (mass percent), and stirring for 20 minutes; standing for 30min, and centrifuging at 12000rpm for 30 min; the supernatant was removed and the precipitate was redissolved with 100ul of gold-labeled antibody redissolved to obtain the colloidal gold-labeled C12 antibody.

2) Gold label pad and reaction film preparation

Diluting the C12 gold-labeled antibody by 3 times, spraying the diluted antibody on a gold-labeled pad 6, and drying for later use;

after diluting the antibody C14 to 0.8mg/mL with an antibody diluent, coating the antibody C14 at the position of the T line 5 of the reaction membrane 2 (nitrocellulose membrane); after the anti-His tag antibody is diluted to 0.2mg/mL by using an antibody diluent, the anti-His tag antibody is coated on the position of the C line 4 of the reaction membrane 2 (nitrocellulose membrane), and the reaction membrane is dried for later use.

3) Sticking, cutting and assembling film

The sample pad 1, the gold-labeled pad 6, the nitrocellulose membrane 2 coated with the antibody and the absorbent pad 3 are sequentially arranged from left to right (as shown in figure 5), and are slightly contacted with each other, the T line 5 of the nitrocellulose membrane coated with the antibody is arranged on the left, the C line 4 is arranged on the right, the nitrocellulose membrane coated with the antibody is cut according to the size of the shell, and the nitrocellulose membrane is loaded into the shell, so that the preparation of the detection card is completed.

4) Kit assembly

Packing the assembled detection card and drying agent into an aluminum foil bag, sealing the aluminum foil bag by a heat sealing machine, and labeling;

subpackaging the sample diluent according to 1 mL/tube, filling into a self-sealing bag according to the specification of the kit, and labeling;

according to the specification of a finished product, putting a certain number of parts of inner bags, 1 self-sealing bag containing sample diluent, 1 part of specification and 1 qualified label into a packaging box, and sticking the label outside the packaging box.

3. Method for using human cystatin C colloidal gold detection card

1) The outer package was opened and the test card was removed from the sealed aluminum foil pouch and placed on a flat table.

2) Aspirate 2.5 μ l of serum/plasma sample, add to the sample dilution, and mix well.

3) 50ul of the treated sample was taken and added to the well of the test card, and allowed to stand at room temperature for 10 min.

4) The detection card is put into an immunochromatography quantitative analyzer, the detection is started by pressing a 'quick detection' key, and the detection card is automatically scanned by the analyzer.

5) The detection result is read/printed from the display screen of the immunochromatographic quantitative analyzer.

4. Evaluation of detection effect of human cystatin C colloidal gold detection card

1) Precision: the detection card of C14 (coating) -C12 (marking) detects CysC reference substances of 1mg/L and 7mg/L respectively for 10 times of repeated measurement according to the using method of the detection card, and the precision of the detection card is calculated after outliers are removed. The experimental result shows that the coefficient of variation CV of the three concentration detection results is less than 10%.

Concentration point (mg/L)	1	7
			CV	9.43％	9.75％

2) Detection range: c14 (coating) -C12 (marking) detection card is used for detecting CysC recombinant protein with different concentrations of 0.15, 0.3, 0.625, 1.25, 2.5, 5 and 10mg/L, and the fitting curve and the detection range are 0.2-10mg/L (as shown in figure 6).

3) Linear range: preparing 5 series concentration samples from the high-value sample and the sample diluent according to a certain proportion, detecting by using a C14 (coating) -C12 (marking) detection card, detecting each sample for 3 times, performing regression statistics on the result and the theoretical concentration, and judging whether the linear concentration is in the concentration range. The linear range is 0.2-10mg/L (as shown in figure 7). The sensitivity of the detection card is 0.2 mg/L.

4) Accuracy: c14 (coating) -C12 (marking) detection card detects 1 and 7mg/L CysC reference substances according to the using method of the detection card, each 3 times of repetition is carried out, the relative deviation between the average value and the theoretical value is calculated, and the experimental result shows that the relative deviation B of the detection results of three concentrations is less than 5%.

Concentration point (mg/L)	1	7
			B	3.4％	4.14％

5. Accuracy-methodological alignment:

the cystatin C quantitative detection reagent (immunochromatography) of Guangzhou Wanfu biotechnology, Inc. which obtains good reputation in the market at present is selected as a comparison product for verification. 30 clinical patient specimens were selected, numbered in the order of 1 to 20, and the test was performed simultaneously with the control product and the colloidal gold test card of C14 (coated) -C12 (labeled) to be evaluated, and the test was performed in the order of 1, 2, 3. Correlation coefficient R of detection results of comparison and product to be evaluated²The result obtained by the two methods is better correlated with 0.953 (as shown in fig. 8).

6. Formulation screening

In addition to the above-mentioned best preparation example 1, the applicant tried various preparation schemes, for example, the following sets of test cards were prepared and applied as follows:

SEQUENCE LISTING

<110> Jiangsu Zhonghong bioengineering institute of drug creation Limited

<120> anti-human cystatin C antibody and application thereof

<130> anti-human cystatin C antibody and application thereof

<160>38

<170>PatentIn version 3.3

<210>1

<211>8

<212>PRT

<213>mouse

<400>1

Gly Tyr Thr Phe Thr Ser Tyr Trp

1 5

<210>2

<211>8

<212>PRT

<213>mouse

<400>2

Val Asp Pro Gly Ser Gly Thr Thr

1 5

<210>3

<211>6

<212>PRT

<213>mouse

<400>3

Thr Ala Gly Phe Asp Tyr

1 5

<210>4

<211>6

<212>PRT

<213>mouse

<400>4

Gln Asn Ile Asn Val Trp

1 5

<210>5

<211>3

<212>PRT

<213>mouse

<400>5

Lys Ala Ser

1

<210>6

<211>9

<212>PRT

<213>mouse

<400>6

Gln Gln Gly Gln Thr Tyr Pro Leu Thr

1 5

<210>7

<211>113

<212>PRT

<213>mouse

<400>7

Gln Val Gln Leu Gln Gln Pro Gly Ser Glu Leu Val Arg Pro Gly Thr

1 5 10 15

Ser Val Lys Leu Ser Cys Arg Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Met His Trp Val Lys Gln Arg His Gly GlnGly Leu Glu Trp Leu

35 40 45

Gly Asn Val Asp Pro Gly Ser Gly Thr Thr Asn Tyr Glu Glu Asn Phe

50 55 60

Lys Thr Lys Gly Thr Leu Thr Val Asp Thr Ser Ser Ser Thr Val Tyr

65 70 75 80

Met His Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Ala Gly Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser

100 105 110

Ala

<210>8

<211>107

<212>PRT

<213>mouse

<400>8

Asp Ile Gln Met Asn Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly

1 5 10 15

Asp Thr Ile Thr Ile Thr Cys His Ala Ser Gln Asn Ile Asn Val Trp

20 25 30

Leu Gly Trp Phe Gln Gln Lys Pro Glu Asn Ile Pro Lys Leu Leu Ile

35 40 45

Tyr Lys Ala Ser Thr Leu His Thr Gly Val Pro Ser Arg Phe Ser Gly

50 5560

Ser Gly Ser Gly Thr Val Phe Thr Leu Thr Ile Ser Ser Pro Gln Pro

65 70 75 80

Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Gly Gln Thr Tyr Pro Leu

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys

100 105

<210>9

<211>8

<212>PRT

<213>mouse

<400>9

Gly Tyr Thr Phe Thr Asp Phe Tyr

1 5

<210>10

<211>8

<212>PRT

<213>mouse

<400>10

Ile Trp Pro Gly Ser Gly Asn Thr

1 5

<210>11

<211>11

<212>PRT

<213>mouse

<400>11

Ala Arg Gly Thr Gly Thr Gly Tyr Phe Asp Val

1 5 10

<210>12

<211>7

<212>PRT

<213>mouse

<400>12

Gln Val Gln Ile Phe Ser Asn

1 5

<210>13

<211>3

<212>PRT

<213>mouse

<400>13

Ala Ala Lys

1

<210>14

<211>9

<212>PRT

<213>mouse

<400>14

Gln His Phe Trp Gly Thr Pro Tyr Thr

1 5

<210>15

<211>118

<212>PRT

<213>mouse

<400>15

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Phe

20 25 30

Tyr Leu Asn Trp Val Lys Gln Arg Thr Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Trp Pro Gly Ser Gly Asn Thr Tyr Tyr Asn Glu Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met His Phe Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys

85 90 95

Ala Arg Gly Thr Gly Thr Gly Tyr Phe Asp Val Trp Gly Ala Gly Thr

100 105 110

Thr Val Thr Val Ser Ala

115

<210>16

<211>109

<212>PRT

<213>mouse

<400>16

Arg Trp Glu Leu Ser His Met Val Asp Leu Gln Ala Ala Ala Asn Ser

1 5 10 15

Leu Val Tyr Pro Arg Phe Thr Met Asp Phe Gln Val Gln Ile Phe Ser

20 25 30

Asn Leu Ala Trp Tyr Gln Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu

35 40 45

Val Tyr Ala Ala Lys Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Gln Tyr Ser Leu Lys Ile Asn Ser Leu Gln

65 70 75 80

Ser Glu Asp Phe Gly Ser Tyr Tyr Cys Gln His Phe Trp Gly Thr Pro

85 90 95

Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105

<210>17

<211>24

<212>DNA

<213>mouse

<400>17

ggctacacat tcaccagcta ctgg 24

<210>18

<211>24

<212>DNA

<213>mouse

<400>18

gttgatcctg gtagcggtac tact 24

<210>19

<211>18

<212>DNA

<213>mouse

<400>19

accgcggggt ttgactac 18

<210>20

<211>18

<212>DNA

<213>mouse

<400>20

cagaacatta atgtttgg 18

<210>21

<211>9

<212>DNA

<213>mouse

<400>21

aaggcttcc 9

<210>22

<211>27

<212>DNA

<213>mouse

<400>22

caacagggtc aaacttatcc gctcacg 27

<210>23

<211>339

<212>DNA

<213>mouse

<400>23

caggtccaac tgcagcaacc tgggtctgag ctggtgaggc ctggaacttc agtgaagctg 60

tcctgcaggg cttctggcta cacattcacc agctactgga tgcactgggt gaagcagagg 120

catggacaag gccttgagtg gctaggaaat gttgatcctg gtagcggtac tactaactac 180

gaggagaatt tcaagaccaa gggcacactg actgtggaca cttcctccag tacagtctac 240

atgcacctca gcagcctgac atctgaggac tctgcggtct attattgtac cgcggggttt 300

gactactggg gccaaggcac cactctcact gtctctgca 339

<210>24

<211>321

<212>DNA

<213>mouse

<400>24

gacatccaga tgaaccagtc tccatccagt ctgtctgcat cccttggaga cacaattacc 60

atcacttgcc atgccagtca gaacattaat gtttggttag gctggttcca gcagaaacca 120

gaaaatattc ctaaactatt gatctataag gcttccacct tgcacacagg cgtcccatca 180

cggtttagtg gcagtggatc tggaacagtt ttcacattaa ccatcagcag cccgcagcct 240

gaagacattg ccacttacta ctgtcaacag ggtcaaactt atccgctcac gttcggtgct 300

gggaccaagt tggaaatcaa a 321

<210>25

<211>24

<212>DNA

<213>mouse

<400>25

ggctacacct tcactgactt ctat 24

<210>26

<211>24

<212>DNA

<213>mouse

<400>26

atttggcctg gaagtggtaa tact 24

<210>27

<211>33

<212>DNA

<213>mouse

<400>27

gcaagaggga ctgggacggg gtacttcgat gtc 33

<210>28

<211>21

<212>DNA

<213>mouse

<400>28

caagtgcaga ttttcagtaa t 21

<210>29

<211>9

<212>DNA

<213>mouse

<400>29

gctgcaaaa 9

<210>30

<211>27

<212>DNA

<213>mouse

<400>30

tgtcaacatt tttggggtac tccgtac 27

<210>31

<211>354

<212>DNA

<213>mouse

<400>31

caggttcagc tgcagcagtc tggagctgag ctggcgaggc ccggggcttc agtgaagctg 60

tcctgcaagg cttctggcta caccttcact gacttctatc taaactgggt gaagcagagg 120

actggacagg gccttgagtg gattggagag atttggcctg gaagtggtaa tacttactac 180

aatgagaagt tcaaggacaa ggccacactg actgcagaca aatcctccag cacagcctac 240

atgcacttca gcagcctgac atctgaggac tctgcagtct atttctgcgc aagagggact 300

gggacggggt acttcgatgt ctggggcgca gggaccacgg tcaccgtctc cgca 354

<210>32

<211>324

<212>DNA

<213>mouse

<400>32

cgttgggagc tctcccatat ggtcgacctg caggcggccg cgaattcact agtgtatcca 60

agattcacca tggattttca agtgcagatt ttcagtaatt tagcatggta tcagcagaaa 120

cagggaaaat ctcctcagctcctggtctat gctgcaaaaa acttagcaga tggtgtgcca 180

tcaaggttca gtggcagtgg atcaggcaca cagtattccc tcaagatcaa tagcctgcag 240

tctgaagatt ttgggagtta ttactgtcaa catttttggg gtactccgta cacgttcgga 300

ggggggacca agctggaaat caaa 324

<210>33

<211>235

<212>PRT

<213>mouse

<400>33

Gln Val Gln Leu Gln Gln Pro Gly Ser Glu Leu Val Arg Pro Gly Thr

1 5 10 15

Ser Val Lys Leu Ser Cys Arg Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Met His Trp Val Lys Gln Arg His Gly Gln Gly Leu Glu Trp Leu

35 40 45

Gly Asn Val Asp Pro Gly Ser Gly Thr Thr Asn Tyr Glu Glu Asn Phe

50 55 60

Lys Thr Lys Gly Thr Leu Thr Val Asp Thr Ser Ser Ser Thr Val Tyr

65 70 75 80

Met His Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Ala Gly Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser

100 105110

Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Asp Ile Gln Met Asn Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly

130 135 140

Asp Thr Ile Thr Ile Thr Cys His Ala Ser Gln Asn Ile Asn Val Trp

145 150 155 160

Leu Gly Trp Phe Gln Gln Lys Pro Glu Asn Ile Pro Lys Leu Leu Ile

165 170 175

Tyr Lys Ala Ser Thr Leu His Thr Gly Val Pro Ser Arg Phe Ser Gly

180 185 190

Ser Gly Ser Gly Thr Val Phe Thr Leu Thr Ile Ser Ser Pro Gln Pro

195 200 205

Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Gly Gln Thr Tyr Pro Leu

210 215 220

Thr Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys

225 230 235

<210>34

<211>241

<212>PRT

<213>mouse

<400>34

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala

15 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Phe

20 25 30

Tyr Leu Asn Trp Val Lys Gln Arg Thr Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Trp Pro Gly Ser Gly Asn Thr Tyr Tyr Asn Glu Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met His Phe Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys

85 90 95

Ala Arg Gly Thr Gly Thr Gly Tyr Phe Asp Val Trp Gly Ala Gly Thr

100 105 110

Thr Val Thr Val Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Arg Trp Glu Leu Ser His Met Val Asp Leu Gln

130 135 140

Ala Ala Ala Asn Ser Leu Val Tyr Pro Arg Phe Thr Met Asp Phe Gln

145 150 155 160

Val Gln Ile Phe Ser Asn Leu Ala Trp Tyr Gln Gln Lys Gln Gly Lys

165170 175

Ser Pro Gln Leu Leu Val Tyr Ala Ala Lys Asn Leu Ala Asp Gly Val

180 185 190

Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Tyr Ser Leu Lys

195 200 205

Ile Asn Ser Leu Gln Ser Glu Asp Phe Gly Ser Tyr Tyr Cys Gln His

210 215 220

Phe Trp Gly Thr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile

225 230 235 240

Lys

<210>35

<211>15

<212>PRT

<213>mouse

<400>35

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210>36

<211>45

<212>DNA

<213>mouse

<400>36

ggtggtggtg gatccggagg tggtggttct ggtggtggtg gttct 45

<210>37

<211>705

<212>DNA

<213>mouse

<400>37

caggtccaac tgcagcaacc tgggtctgag ctggtgaggc ctggaacttc agtgaagctg 60

tcctgcaggg cttctggcta cacattcacc agctactgga tgcactgggt gaagcagagg 120

catggacaag gccttgagtg gctaggaaat gttgatcctg gtagcggtac tactaactac 180

gaggagaatt tcaagaccaa gggcacactg actgtggaca cttcctccag tacagtctac 240

atgcacctca gcagcctgac atctgaggac tctgcggtct attattgtac cgcggggttt 300

gactactggg gccaaggcac cactctcact gtctctgcag gtggtggtgg atccggaggt 360

ggtggttctg gtggtggtgg ttctgacatc cagatgaacc agtctccatc cagtctgtct 420

gcatcccttg gagacacaat taccatcact tgccatgcca gtcagaacat taatgtttgg 480

ttaggctggt tccagcagaa accagaaaat attcctaaac tattgatcta taaggcttcc 540

accttgcaca caggcgtccc atcacggttt agtggcagtg gatctggaac agttttcaca 600

ttaaccatca gcagcccgca gcctgaagac attgccactt actactgtca acagggtcaa 660

acttatccgc tcacgttcgg tgctgggacc aagttggaaa tcaaa 705

<210>38

<211>723

<212>DNA

<213>mouse

<400>38

caggttcagc tgcagcagtc tggagctgag ctggcgaggc ccggggcttc agtgaagctg 60

tcctgcaagg cttctggcta caccttcact gacttctatc taaactgggt gaagcagagg 120

actggacagg gccttgagtg gattggagag atttggcctg gaagtggtaa tacttactac 180

aatgagaagt tcaaggacaa ggccacactg actgcagaca aatcctccag cacagcctac 240

atgcacttca gcagcctgac atctgaggac tctgcagtct atttctgcgc aagagggact 300

gggacggggt acttcgatgt ctggggcgca gggaccacgg tcaccgtctc cgcaggtggt 360

ggtggatccg gaggtggtgg ttctggtggt ggtggttctc gttgggagct ctcccatatg 420

gtcgacctgc aggcggccgc gaattcacta gtgtatccaa gattcaccat ggattttcaa 480

gtgcagattt tcagtaattt agcatggtat cagcagaaac agggaaaatc tcctcagctc 540

ctggtctatg ctgcaaaaaa cttagcagat ggtgtgccat caaggttcag tggcagtgga 600

tcaggcacac agtattccct caagatcaat agcctgcagt ctgaagattt tgggagttat 660

tactgtcaac atttttgggg tactccgtac acgttcggag gggggaccaa gctggaaatc 720

aaa 723

Claims (8)

1. An anti-human cystatin C single chain antibody comprising:

the heavy chain variable region comprises the following complementarity determining regions: the amino acid sequence is shown as SEQ ID NO:1, HCDR1 as shown in seq id NO:2 and HCDR2 as shown in SEQ ID NO: HCDR3 shown at 3;

and the light chain variable region sequence comprises the following complementarity determining regions: the amino acid sequence is shown as SEQ ID NO: 4, LCDR1 as shown in SEQ ID NO: 5 and LCDR2 as shown in SEQ ID NO: LCDR3 shown in fig. 6.

2. The anti-human cystatin C single-chain antibody of claim 1, characterized in that the amino acid sequence of the heavy chain variable region of the antibody is shown as SEQ ID No. 7, and the amino acid sequence of the light chain variable region is shown as SEQ ID No. 8.

3. The anti-human cystatin C single-chain antibody of claim 1, characterized in that the amino acid sequence of said antibody is represented by SEQ ID NO. 33.

4. A nucleotide sequence encoding the single chain antibody of claim 3, wherein the nucleotide sequence is shown in SEQ ID No. 37.

5. An expression vector comprising the nucleotide sequence of claim 4.

6. A recombinant host cell comprising the expression vector of claim 5.

7. A method of producing the antibody of claim 3, comprising:

1) culturing the recombinant host cell of claim 6 under suitable conditions to express the antibody;

2) the antibody is then purified from the host cell and collected.

8. Use of the anti-human cystatin C single-chain antibody of any one of claims 1-3 in the preparation of a card for the quantitative determination of cystatin C content in a sample.

Images