CN107540745A - A kind of polypeptide and its expression for suppressing function with trypsase - Google Patents
A kind of polypeptide and its expression for suppressing function with trypsase Download PDFInfo
- Publication number
- CN107540745A CN107540745A CN201710729905.6A CN201710729905A CN107540745A CN 107540745 A CN107540745 A CN 107540745A CN 201710729905 A CN201710729905 A CN 201710729905A CN 107540745 A CN107540745 A CN 107540745A
- Authority
- CN
- China
- Prior art keywords
- expression
- hw11c40j
- polypeptide
- trypsase
- suppressing function
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to bioengineering field, it is desirable to provide a kind of inhibitory specificity is strong, without the Selenocosmiahuwena trypsin inhibitor of neurotoxicity, and provides a kind of method transformed and express such spider toxin polypeptide.Method：Selenocosmiahuwena novel gene HW11c40 is mutated with PCR fixed-point mutation methods, structure forms mutant expression vector pET 40b (+) HW11c40J, converts the carrier and successful expression and obtains the recombinant protein of high-purity in particular host cell.The recombinant protein is very weak to potassium channel inhibitory action, is the trypsin inhibitor that a species specificity is strong, specificity is high without neurotoxicity, newtype drug molecule is provided for diseases such as treatment acute pancreatitis.
Description
Technical field
The invention belongs to proteomics field, and in particular to a kind of polypeptide and its table for suppressing function with trypsase
Up to method.
Background technology
Selenocosmiahuwena, which is that the distinctive one kind of China is large-scale, tarantula, is distributed mainly on south China alpine region.Tiger
Various active material is included in veins bird-catching spider venom.Belonging to the HWTX-XI (HWTX-XI) of Kunitz type toxin is
A kind of very strong trypsin inhibitor is higher than being widely used in the inhibitory activity of bovine pancreatic trypsin inhibitor (BPTI) of clinic
28.5 times, can also have the function that to block potassium-channel simultaneously, show weaker neurotoxicity in animals.It is Chinese special
The HWTX-XI mutant of sharp CN101979411A reports still maintains neurotoxicity, real in the animal for the treatment of acute pancreatitis
It is unsatisfactory to test middle effect.HW11c40 is the new gene being cloned into from Selenocosmiahuwena poison gland.Utilize bioinformatic analysis
Kunitz type spider polypeptides coded by new gene HW11c40, and HWTX-XI are compared, and sequence identity 85.4%, have pancreas
Albumen enzyme level critical active residue K14, but the critical active residue R25 suppressed without potassium-channel.With HWTX-XI's
Structure (PDB indexed numbers：It is 2JOT) template, the modeling of three-D space structure is carried out using SWISS-MODEL work stations, finds
HW11c40 and HWTX-XI containing two separate functional areas, has similar space structure, so that the two is showed
Go out same trypsin inhibition activity, but three pairs of disulfide bond that 6 cysteines having compared to HWTX-XI are formed,
HW11c40 only has 5 cysteines, forms two pairs of disulfide bond, easily causes the stability of the toxin to reduce.
The problem of limitation HW11c40 researchs at present, first, toxin corresponding to HW11c40 includes 55 amino acid, it is impossible to from
Extract in the thick poison of Selenocosmiahuwena, the new gene that can only be cloned into from Selenocosmiahuwena poison gland, then reached by labor statement
Obtain.Second, the toxoid unstable expression, easily degrades during expression, between two and amino acid sulfide linkage mispairing easily cause
Difficulty is not expressed or expressed to the toxin.Due to the diversity of spider toxin structure etc., presently, without which kind of expression system energy
As the system that expression spider toxin is general.There is the saccharomyces cerevisiae system that researcher has been demonstrated to express HWTX-XI and its mutant
System can not give expression to HW11c40, and patent inventor of the present invention confirms that this expression system can not also give expression to by repeatedly attempting
HW11c40 mutant, and there has been no the research report that successful expression goes out HW11c40 and its mutant.This is for filtering out treatment
The HW11c40 mutant research of pancreatitis and HW11c40 26S Proteasome Structure and Function research are individual it is difficult to the obstacle gone beyond.
The content of the invention
The invention provides a kind of polypeptide (being named as HW11c40J) for suppressing function with trypsase, itself and SEQ ID
NO:1 has the polypeptid coding sequence of the homology of 95% and the above.
SEQ ID NO:1 sequence is：
Ile-Asp-Thr-Cys-Arg-Leu-Pro-Ser-Asp-Arg-Gly-Arg-Cys-Lys-Ala-Ser-Phe-
Glu-Arg-Trp-Tyr-Phe-Asn-Gly-Thr-Thr-Cys-Thr-Lys-Phe-Val-Tyr-Gly-Gly-Tyr-Gly-
Gly-Asn-Asp-Asn-Arg-Phe-Pro-Thr-Glu-Lys-Ala-Cys-Met-Lys-Arg-Cys-Ala-Lys-Ala。
In addition, the invention provides a kind of expression of aforementioned polypeptides, its technical scheme is：
1. it is by stencil design and synthetic primer, primer sequence of the cloning vector containing HW11c40 genes：
HW11c40J-1f:CCGGAATTCCATAGATACATGCCTTGAACCC,
HW11c40J-1r:CCGCTCGAGTTACGCTTTTGCACACCTTTTC,
Enter performing PCR rite-directed mutagenesis with above-mentioned primer, build the expression vector pET- than 15 amino acid of protogene odd encoder
40b(+)-HW11c40J；
2. with antibiotic resistance Screening of Media Positive mutants and carry out gene sequencing；
3. using pET-40b (+)-HW11c40J expression vectors as template design primer, primer sequence is：
HW11c40J-2f:ACGACAAGATAGATACATGCCTTGAACCCTCTGAC,
HW11c40J-2r:ATGTATCTATCTTGTCGTCGTCATCGGTACCCAGATC,
The coded sequence of 15 unnecessary amino acid is deleted by PCR, and purifies amplification expression vector；
4. expression vector obtained by previous step is converted into competence EHEC, the LB cultures containing kanamycins are coated with
Plate, 37 DEG C are incubated overnight, and carry out bacterium colony PCR identifications, and positive colony bacterium send company to be sequenced；
5. positive colony bacterium obtained by previous step is subjected to Secondary Culture and induced expression, purification of recombinant proteins.
Preferably, the method for culture, expression and the purifying described in step (5) is：Engineering bacteria is inoculated into containing 100 μ g/ml
In the LB liquid of kanamycins, shaken cultivation to A600 values extremely contains 100 μ g/ml kanamycins 0.5~1.0, with 1: 100 transferred species
In LB liquid, 37 DEG C proceed to A600 values as 0.5~1.0, and in the case where being induced without IPTG, 30 DEG C are continued culture 15~20h, and 4
Supernatant is removed into expression culture medium centrifugation at DEG C, adds 50ml pH 8.0 PBS liquid, carries out carrying out ultrasonic bacteria breaking, after centrifugal filtration, on
Clear liquid crosses Ni-NTA posts, is eluted with 100mmol/L imidazoles, and HPLC, which is purified, after being handled with enterokinase produces.
The beneficial effects of the invention are as follows：The trypsin inhibitor of offer is very weak to potassium channel inhibitory action, without nerve
Toxicity, be a kind of inhibitory specificity it is strong, with more specific efficient trypsin inhibitor.The expression that the present invention uses
Expression quantity is big, and the expression cycle is short, and it is good to obtain albumen solubility, is not required to oxidizing and refolding, and it is malicious that Kunitz types tarantula is caught to such brave line
The expression of element has very big pardon, can be as the general-purpose system of such spider toxin.On the induction mode of expression, employ
Without the automatic induction culture medium system of artificial detection bacteria growing, the efficiency of toxin expression is more accelerated, saves preciousness
Time and efforts, laid a good foundation to obtain the expression of recombinant toxin on a large scale in the future.
Brief description of the drawings
Fig. 1 is HW11c40J fusion protein digestion Tricine-SDS-PAGE analysis charts；1- fusion proteins in figure；2- digestions
Obtained destination protein；M- protein molecular quality standards.
Fig. 2 is HW11c40J high-efficient liquid phase chromatogram purification figures, and eluent is 28.1% acetonitrile, and chromatographic column is that C18 is anti-phase
Post.
Fig. 3 is HW11c40J Mass Spectrometric Identification figures.
Fig. 4 is the collection of illustrative plates that HWTX-XI suppresses potassium-channel.
Fig. 5 is the collection of illustrative plates that HW11c40J suppresses potassium-channel.
Embodiment
As described below is the preferred embodiment of the present invention, and what the present invention was protected is not limited to the following side of being preferable to carry out
Formula.It should be pointed out that for those skilled in the art on the basis of this innovation and creation design, some deformations for making and
Improve, belong to protection scope of the present invention.
Embodiment 1
1) to have recombinated the HW11c40 on pVT102U/a carriers as template, primer is prepared,
HW11c40J-1f:CCGGAATTCCATAGATACATGCCTTGAACCC,
HW11c40J-1r:CCGCTCGAGTTACGCTTTTGCACACCTTTTC,
It is mutated with PCR fixed-point mutation methods, and carries out gene magnification, structure obtains HW11c40J；
2) EcoR I and the double digestion fragments of Xho I are connected in the case where being connected enzyme effect with pET-40b (+) carrier, structure is corresponding
Have more the expression vector of 15 amino acid；
3) these expression vectors are converted into competence Escherichia coli BL21 (DE3) respectively, coating contains kanamycins
LB culture plates, 37 DEG C are incubated overnight, and carry out bacterium colony PCR screenings, positive colony bacterium send company to be sequenced；
4) correct recombinant bacterium is sequenced, extracts plasmid, then respectively using these expression vectors as template design primer
(HW11c40J-2f：ACGACAAGATAGATACATGCCTTGAACCCTCTGAC, HW11c40J-2f:
ATGTATCTATCTTGTCGTCGTCATCGGTACCCAGATC)
15 unnecessary amino acid are deleted by PCR, with the digestions of Dpn I to remove template, purifying expands expression vector.Table
Converted up to carrier into competence Escherichia coli BL21 (DE3), be coated with the LB culture plates containing kanamycins, 37 DEG C of trainings overnight
Support, carry out bacterium colony PCR identifications, positive colony bacterium send company to be sequenced.
5) positive colony bacterium of sequencing identification is inoculated into the LB liquid containing 100 μ g/ml kanamycins, shaken cultivation is extremely
A600 values are 0.5~1.0.With 1: 100 transferred species into the LB liquid containing 100 μ g/ml kanamycins, 37 DEG C proceed to A600 values and are
0.5~1.0, in the case where being induced without IPTG, 30 DEG C are continued culture 15~20h, go expression culture medium centrifugation at 4 DEG C
Clearly, 50ml pH8.0 PBS liquid is added, carries out carrying out ultrasonic bacteria breaking, after centrifugal filtration, supernatant crosses Ni-NTA posts, uses 100mmol/L
Imidazoles enters de-；
6) HPLC is purified after enterokinase digestion, standby with being freezed after MALDI-TOF Mass Spectrometric Identifications.
Embodiment 2
1) to have recombinated the HW11c40 on pVT102U/a carriers as template, primer is prepared,
HW11c40J-1f:CCGGAATTCCATAGATACATGCCTTGAACCC,
HW11c40J-1r:CCGCTCGAGTTACGCTTTTGCACACCTTTTC,
It is mutated with PCR fixed-point mutation methods, and carries out gene magnification, structure obtains HW11c40J；
2) EcoR I and the double digestion fragments of Xho I are connected in the case where being connected enzyme effect with pET-40b (+) carrier, structure is corresponding
Have more the expression vector of 15 amino acid；
3) these expression vectors are converted into competence Escherichia coli BL21 (DE3) respectively, coating contains kanamycins
LB culture plates, 37 DEG C are incubated overnight, and carry out bacterium colony PCR screenings, positive colony bacterium send company to be sequenced；
4) correct recombinant bacterium is sequenced, extracts plasmid, then respectively using these expression vectors as template design primer
(HW11c40J-2f：ACGACAAGATAGATACATGCCTTGAACCCTCTGAC,
HW11c40J-2f:ATGTATCTATCTTGTCGTCGTCATCGGTACCCAGATC)
15 unnecessary amino acid are deleted by PCR, with the digestions of Dpn I to remove template, purifying expands expression vector.Table
Converted up to carrier into competence Escherichia coli BL21 (DE3), be coated with the LB culture plates containing kanamycins, 37 DEG C of trainings overnight
Support, carry out bacterium colony PCR identifications, positive colony bacterium send company to be sequenced.
5) positive colony bacterium of sequencing identification is inoculated into the LB liquid containing 100 μ g/ml kanamycins, shaken cultivation is extremely
A600 values are 0.5.With 1: 100 transferred species into the LB liquid containing 100 μ g/ml kanamycins, it is 0.5 that 37 DEG C, which proceed to A600 values,
In the case of being induced without IPTG, 30 DEG C are continued to cultivate 15h, are centrifuged expression culture medium at 4 DEG C and are removed supernatant, add 50ml pH8.0
PBS liquid, carry out carrying out ultrasonic bacteria breaking, after centrifugal filtration, supernatant crosses Ni-NTA posts, is entered with 100mmol/L imidazoles de-；
6) HPLC purifies (the embodiment Chinese medicine specifically how done using how many enterokinase is write clearly) after enterokinase digestion,
It is standby with being freezed after MALDI-TOF Mass Spectrometric Identifications.
Embodiment 3
With spectrophotometric determination HW11c40J to trypsin inhibition activity.With N- benzene first phthalein-DL- arginine-
Paranitroanilinum is substrate, is added a certain amount of (specific single experiment, it is impossible to write a certain amount of and to write specific single dose)
Trypsase, take not same amount (specific single experiment, it is impossible to write a certain amount of and to write specific single not same amount)
HW11c40J is reacted, and whole reaction is carried out in pH8.0, the TriS- hydrochloride buffer systems that concentration is 0.05mol/L, instead
It is 25 DEG C to answer temperature.Absorbance value is determined in 405nm, and has obtained HW11c40J with double counting backward techniques and has suppressed flat with trypsase
Weigh constant.As a result show:HW11c40J is to the inhibition constant of trypsase and HWTX-XI in the same order of magnitude.
Embodiment 4
Potassium channel is expressed on dorsal root ganglion neurons.Show that HW11c40J is to rat DRG by patch-clamp detection
Potassium channel current inhibitory action is weaker on cell, its IC50Value has exceeded 200pM (see Fig. 4), and HWTX-XI exists to potassium channel
60% electric current can be suppressed under 10pM concentration (see Fig. 3).
Embodiment 5
Intracerebroventricular (intraCerbroventriCular, iCV) administrable decaptitating pico farad surveys half lethal dose.Take elder brother
Each 9 of bright kind of mouse male and female, body weight 18-22g.Etherization is implemented to mouse before experiment, centered on the midpoint of two ear lines
Cut off skin about 5x5mm, inject decoction with micro syringe between sagittal suture and lambdoidal suture intersection point 1~2cm of side during experiment
15pL, reaction of animals is observed after having injected immediately, observed 48 hours.As a result show:Mouse intracerebroventricular HW11c40J react with
Physiological saline group is identical, and dosage has no that overt toxicity reacts when reaching 50mg/kg, mouse can survive.And after injecting HWTX-XI,
Show to be on wires, phenomena such as acutely running, roll, the twitch of serious whole body, finally die of exhaustion, half lethal dose
LD50It is worth for 220.17pg/kg.
To sum up, test result indicates that HW11c40J be it is a kind of have more specific very strong trypsin inhibitor, it
It is very weak to potassium channel inhibitory action, and there is no neurotoxicity.
Claims (5)
1. a kind of polypeptide for suppressing function with trypsase, it is characterised in that with SEQ ID NO:1 have 95% and the above it is same
The polypeptid coding sequence of source property.
2. a kind of expression for the polypeptide for suppressing function with trypsase, it is characterised in that comprise the steps of：
(1) using the cloning vector containing HW11c40 genes as stencil design and synthetic primer, enter performing PCR rite-directed mutagenesis, build ratio
Expression vector pET-40b (+)-HW11c40J of 15 amino acid of protogene odd encoder；
(2) screen Positive mutants and carry out gene sequencing；
(3) using pET-40b (+)-HW11c40J expression vectors as template design primer, 15 unnecessary amino are deleted by PCR
The coded sequence of acid, and purify amplification expression vector；
(4) expression vector obtained by step (3) is converted to host cell and screens acquisition positive colony；
(5) step (4) positive colony bacterium is subjected to Secondary Culture and induced expression, purification of recombinant proteins.
A kind of 3. expression of polypeptide for suppressing function with trypsase according to claim 2, it is characterised in that
Primer sequence described in step (1) is：
HW11c40J-1f:CCGGAATTCCATAGATACATGCCTTGAACCC,
HW11c40J-1r:CCGCTCGAGTTACGCTTTTGCACACCTTTTC。
A kind of 4. expression of polypeptide for suppressing function with trypsase according to claim 2, it is characterised in that
Primer sequence described in step (3) is：
HW11c40J-2f:ACGACAAGATAGATACATGCCTTGAACCCTCTGAC,
HW11c40J-2r:ATGTATCTATCTTGTCGTCGTCATCGGTACCCAGATC。
A kind of 5. expression of polypeptide for suppressing function with trypsase according to claim 2, it is characterised in that
The method of culture, expression and purifying described in step (5) is：Engineering bacteria is inoculated into the LB liquid containing 100 μ g/ml kanamycins
In, shaken cultivation to A600 values is 0.5~1.0, with 1: 100 transferred species into the LB liquid containing 100 μ g/ml kanamycins, 37 DEG C after
It is 0.5~1.0 to continue to A600 values, and in the case where being induced without IPTG, 30 DEG C are continued culture 15~20h, will expression culture at 4 DEG C
Supernatant is removed in base centrifugation, adds 50ml pH8.0 PBS liquid, carries out carrying out ultrasonic bacteria breaking, and after centrifugal filtration, supernatant crosses Ni-NTA posts,
Eluted with 100mmol/L imidazoles, HPLC, which is purified, after being handled with enterokinase produces.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710729905.6A CN107540745A (en) | 2017-08-23 | 2017-08-23 | A kind of polypeptide and its expression for suppressing function with trypsase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710729905.6A CN107540745A (en) | 2017-08-23 | 2017-08-23 | A kind of polypeptide and its expression for suppressing function with trypsase |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107540745A true CN107540745A (en) | 2018-01-05 |
Family
ID=60958909
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710729905.6A Pending CN107540745A (en) | 2017-08-23 | 2017-08-23 | A kind of polypeptide and its expression for suppressing function with trypsase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107540745A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113880930A (en) * | 2021-10-15 | 2022-01-04 | 湖南师范大学 | Polypeptide toxin THTX-Cl19 and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101979411A (en) * | 2010-10-21 | 2011-02-23 | 湖南师范大学 | Ornithoctonus huwena protease inhibitor |
| CN103740730A (en) * | 2014-01-02 | 2014-04-23 | 潍坊医学院 | Optimized king cobra venom protease inhibitor gene OH-TCI as well as expression method and application thereof |
-
2017
- 2017-08-23 CN CN201710729905.6A patent/CN107540745A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101979411A (en) * | 2010-10-21 | 2011-02-23 | 湖南师范大学 | Ornithoctonus huwena protease inhibitor |
| CN103740730A (en) * | 2014-01-02 | 2014-04-23 | 潍坊医学院 | Optimized king cobra venom protease inhibitor gene OH-TCI as well as expression method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| XING TANG等: "Molecular diversification of peptide toxins from the tarantula Haplopelma hainanum (Ornithoctonus hainana) venom based on transcriptomic, peptidomic, and genomic analyses", 《J PROTEOME RES.》 * |
| 罗玉娇等: "虎纹捕鸟蛛Kunitz型毒素基因的分子改造和表达", 《中国病原生物学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113880930A (en) * | 2021-10-15 | 2022-01-04 | 湖南师范大学 | Polypeptide toxin THTX-Cl19 and application thereof |
| CN113880930B (en) * | 2021-10-15 | 2023-06-16 | 湖南师范大学 | Polypeptide toxin THTX-Cl19 and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107532190A (en) | Fusion partner for peptide production | |
| CN110791494B (en) | Aspartic enzyme mutant, recombinant expression vector and recombinant bacterium containing aspartic enzyme mutant and application | |
| CN104711245A (en) | Chondroitin sulfateyase ABC (ChSase ABC) mutant fusion protein and application thereof | |
| WO2024046404A1 (en) | Recombinant botulinum toxin and preparation method therefor | |
| WO2019135559A1 (en) | Fusion tag for increasing solubility and expression of target protein, and use thereof | |
| CN107400666B (en) | A kind of aminopeptidase and its encoding gene and application | |
| CN103992993A (en) | Chondroitin sulfate ABC fusion protein, encoding gene, preparation method and applications thereof | |
| CN115819526A (en) | Recombinant botulinum neurotoxin and preparation method and application thereof | |
| CN104710536A (en) | Chondroitin sulfateyase ABC (ChSase ABC) mutant fusion protein and application thereof | |
| CN107540745A (en) | A kind of polypeptide and its expression for suppressing function with trypsase | |
| CN112725315B (en) | Application of chitosanase and mutant thereof in preparation of chitosan oligosaccharide | |
| CN102250938B (en) | Preparation method of cardiactide | |
| CN109371047A (en) | Method for constructing and expressing heat-resistant antibacterial peptide fusion protein by using protein IHF- α | |
| CN104846001B (en) | A kind of foreign protein prokaryotic secretion expression system and its application | |
| CN105441471B (en) | Chondroitin sulfate A (CSA) BC enzyme fusion proteins preparation method and applications | |
| CN102277327B (en) | Colon bacillus for over-expressing RimL and application on preparing N-extrasin alpha acetylate | |
| CN101962654B (en) | Overexpression of thymidylate synthase in colon bacillus | |
| CN108531465A (en) | A kind of Cyclic dipeptides synzyme and its application | |
| CN100339475C (en) | Colibacillns strain for recombination producing lectin of snowdrop and method thereof | |
| CN107119035A (en) | Phenylalanine mutase, encoding gene, recombinant vector, host cell, multiple PCR primer and their application | |
| CN117448365A (en) | Preparation method and application of cyclic peptide | |
| CN118255868A (en) | Type I humanized collagen and high-yield strain thereof | |
| CN104151405A (en) | Application of phosphorylated bacterioprotein NopL | |
| CN118530975A (en) | Endolysin polypeptide with improved thermal stability | |
| Guo et al. | Expression and purification of soluble B lymphocyte stimulator from recombinant Escherichia coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180105 |