CN107475380A - The miRNA marker related to union and its detection primer and application - Google Patents
The miRNA marker related to union and its detection primer and application Download PDFInfo
- Publication number
- CN107475380A CN107475380A CN201710681220.9A CN201710681220A CN107475380A CN 107475380 A CN107475380 A CN 107475380A CN 201710681220 A CN201710681220 A CN 201710681220A CN 107475380 A CN107475380 A CN 107475380A
- Authority
- CN
- China
- Prior art keywords
- mirna
- union
- sequence
- primer
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention discloses a kind of miRNA marker related to union and its detection primer and application.The sequence of the miRNA marker is SEQ ID NO:1：GGCAUCGGCUGAACCUGCGU.The detection primer includes reverse transcriptase primer and real-time fluorescence quantitative PCR primer；Wherein, the sequence of reverse transcriptase primer is SEQ ID NO:2：TACCGTAGCCGACTTGGACGCACC；The sequence of real-time fluorescence quantitative PCR primer is ACTTGACGCTAATACCAT and SEQ ID NO:4：CTACCGTTGAATTACTTA.MiRNA marker provided by the invention is a kind of new miRNA marker, and the whether good situation of union can be predicted with the mark, when it expresses relative increase in union patient's poroma, you can to show malunion of fracture.
Description
Technical field
The invention belongs to field of biomedicine technology, and in particular to a kind of miRNA marker related to union and
Its detection primer and application.
Background technology
The standard of union has locally without tenderness, without longitudinal percussion pain；Local activity without exception；X-ray photo shows bone
Broken line obscures, has continuous osseous callus to pass through fracture line etc..The basis of union is Osteoblastic Cells Derived from Periosteum regeneration.Typically by bone
Folding healing is divided into three phases, i.e. organization of hematoma phase, stage of formation of primary callus and poroma transforms the moulding phase；Also with good grounds fracture is cured
The histology and physiologic character of conjunction process are divided into shock phase, induction period, inflammatory phase, cartilage scab phase, os osseum scab phase and reconstruction phase 6
The individual different stage.A variety of bone growth factors are relevant with union, and their collective effects can stimulate the activity of Gegenbaur's cell, adjust
Save local skeletonization.Whether good existing union detection method be limited.
MicroRNA (miRNA) is the tiny RNA that raw, length is about 20-24 nucleotides in one kind, and it has in the cell
There are a variety of important adjustment effects, each miRNA there can be multiple target genes, and several miRNA can also adjust same base
Cause, this complicated regulating networks both can regulate and control the expression of multiple genes by a miRNA, can also be by several
MiRNA combination carrys out the expression of some gene of finely regulating.Small molecule (Small RNA, sRNA) obtained by HiSeq deep sequencings
Almost cover all RNA, including miRNA, siRNA, piRNA, rRNA, tRNA, snRNA, snoRNA, exon or intron drop
Fragment etc. is solved, wherein miRNA, siRNA and piRNA is the focus of research.Identification for the sequence of sequencing gained, biology letter
Typically by being compared, being found between sample and database on genomic locations with all kinds of known databases in breath analysis
Covering the methods of, to sRNA carry out annotation category.
The content of the invention
It is an object of the invention to overcome the above-mentioned deficiency of prior art, there is provided a kind of miRNA related to union
Mark and its detection primer and application, it is intended to solve the limited technology of the whether good diagnostic method of existing union and ask
Topic.
For achieving the above object, the technical solution adopted by the present invention is as follows：
On the one hand, the present invention provides a kind of miRNA marker related to union, the sequence of the miRNA marker
It is classified as SEQ ID NO:1：GGCAUCGGCUGAACCUGCGU.
On the other hand, the present invention provides the detection primer of one group of above-mentioned miRNA marker, and the detection primer includes reversing
Record primer and real-time fluorescence quantitative PCR primer；Wherein, the sequence of the reverse transcriptase primer is SEQ ID NO:2：
TACCGTAGCCGACTTGGACGCACC；The sequence of the real-time fluorescence quantitative PCR primer is SEQ ID NO:3：
ACTTGACGCTAATACCAT and SEQ ID NO:4：CTACCGTTGAATTACTTA.
Finally, the present invention also provides a kind of above-mentioned detection primer answering in terms of union auxiliary diagnostic box is prepared
With.
MiRNA marker provided by the invention is a kind of new miRNA marker, is proved by testing, with the mark
The whether good situation of union can be predicted, when the miRNA marker expresses relative increasing in union patient's poroma
Gao Shi, you can, therefore, can be as the molecular marker of prediction union quality to show malunion of fracture.
Detection primer provided by the invention can realize the expression quantity detection to above-mentioned miRNA marker, so as to further pre-
Survey whether union is good, and therefore, the detection primer is flexibly practical, convenient detection, examined available for union auxiliary is prepared
Disconnected kit.
Brief description of the drawings
Fig. 1 is the fluorescent quantitative PCR result schematic diagram of the embodiment of the present invention 3.
Embodiment
In order that technical problems, technical solutions and advantageous effects to be solved by the present invention are more clearly understood, below in conjunction with
Drawings and examples, the present invention will be described in further detail.It should be appreciated that specific embodiment described herein is only used
To explain the present invention, it is not intended to limit the present invention.
The embodiment of the present invention provides a kind of miRNA marker related to union, and the sequence of the miRNA marker is
SEQ ID NO:1：GGCAUCGGCUGAACCUGCGU.
MiRNA marker provided in an embodiment of the present invention is a kind of new miRNA marker, is defined as novel-
miR-116；The whether good situation of union can be predicted with the mark, when novel-miR-116 suffers from union
When relative increase is expressed in person's poroma, you can to show malunion of fracture, because of point that can be fine or not as prediction union
Sub- mark.
On the other hand, the embodiment of the present invention also provides the detection primer of one group of above-mentioned miRNA marker of detection, and the detection is drawn
Thing includes reverse transcriptase primer and real-time fluorescence quantitative PCR primer；Wherein, the sequence of reverse transcriptase primer is SEQ ID NO:2：
TACCGTAGCCGACTTGGACGCACC；The sequence of real-time fluorescence quantitative PCR primer is SEQ ID NO:3：
ACTTGACGCTAATACCAT and SEQ ID NO:4：CTACCGTTGAATTACTTA.It can be realized pair with this group of detection primer
The expression quantity detection of miRNA marker (i.e. novel-miR-116), so as to further predict whether union is good；Therefore,
The detection primer is flexibly practical, convenient detection, available for preparation union auxiliary diagnostic box.
Finally, the present invention also provides one kind and utilizes above-mentioned detection primer in terms of union auxiliary diagnostic box is prepared
Application.
The candidate's miRNA Forecasting Methodologies of embodiment 1
What candidate miRNA prediction was mainly obtained by the screening of the biological characteristic for miRNA, miRNA initially turns
Site is recorded more on the inverted repeats of intergenic region, introne and coded sequence, its precursor has significant
Hairpin structure, the formation of ripe body is realized by the shearing of Dicer enzymes, by considering whole miRNA growth course, this reality
Apply example and use a set of miRNA forecasting softwares Mireap.
Some key conditions of the present embodiment are described as follows：
(1) miRNA prediction basic data include by tiny RNA classification annotate after do not annotate any database but can
To compare the sequence to genome, compare to the sequence for including subregion and the data compared to extron antisense strand；
(2) precursor sequences of the miRNA of candidate on genome can form neck ring structure, and its ripe body sequence position
In on the arm of precursor；
(3) there is 2nt suspension at miRNA/miRNA* complexs both ends after precursor folds；
(4) without larger bubble on precursor arm, while without more projection；
(5) precursor minimum free energy overall after folding should be not more than -18kcal/mol；
(6) minimum support number in the comparison result of the ripe body sequence of precursor is predicted to should be greater than being equal to 5.
The new miRNA express spectras structure predicted：MiRNA its expression quantity predicted, sequence are calculated according to comparison result
Row are no more than 3nt mispairing with ripe body sequence at both ends, and centre needs to match completely, meets the expression quantity of the sequence of such condition
Add and the expression quantity as the miRNA.
The present embodiment is predicted using the software-Mireap of Hua Da gene independent research, the software design patterns animal parameters
It is as follows：
Minimal miRNA sequence length (18) are that miRNA minimum lengths are 18；
Maximal miRNA sequence length (26) are that miRNA maximum lengths are 26；
Minimal miRNA reference sequence length (20) are that miRNA minimum reference sequences length is
20；
Maximal miRNA reference sequence length (24) are that miRNA minimum reference sequences length is
24；Minimal depth of Drosha/Dicer cutting site (3) are that Drosha/Dicer cleavage sites are minimum deep
Spend for 3；
Maximal copy number of miRNAs on reference (20) are that miRNA maximums are copied on reference sequences
Shellfish number is 20；
Maximal free energy allowed for a miRNA precursor (- 18kcal/mol) are miRNA
Maximum free energy is -18kcal/mol；
Maximal space between miRNA and miRNA* (35) are that miRNA and miRNA* maximum spaces are
35；
Minimal base pairs of miRNA and miRNA* (14) are that miRNA and miRNA* minimum base-pairs are
14；
Maximal bulge of miRNA and miRNA* (4) are that miRNA and miRNA* maximums projection is 4；
Maximal asymmetry of miRNA/miRNA*duplex (5) be miRNA and miRNA* compounds most very much not
To being referred to as 5；
Flank sequence length of miRNA precursor (10) are that miRNA precursor flanking sequence length is
10。
The high-flux sequence of embodiment 2 is analyzed
From 3 malunion of fracture patient's poroma tissues, the poroma of 3 good patients of union is carried out as control
High-flux sequence is analyzed.
2.1RNA extraction
1ug poroma tissues are taken, liquid nitrogen is added, fully grinds, be placed in 2ml EP pipes in grinding；Added into EP pipes
TRIzol (Thermofisher companies) reagent 1ml, stand 15min；0.2ml chloroform (chloroform is added into EP pipes again：
TRIzol reagent=1:5) 15s, is firmly acutely rocked up and down, and room temperature is put into refrigerated centrifuge after placing 2-3min, is adjusted
It is 4 DEG C, rotating speed 12000rpm to save centrifuge temperature, centrifuges 15min；After centrifugation, it is seen that upper strata aqueous phase, middle mixed phase, under
Layer phenol phase.With without RNase pipette tips draw upper strata colourless aqueous phase (about 0.5ml/1ml TRIzol) be transferred to a new 1.5ml without
In the EP pipes of RNase, often pipe adds the isopropanol of equivalent, overturns room temperature after mixing and places 15min；Place into refrigerated centrifuge,
Temperature is 4 DEG C, rotating speed 12000rpm, centrifuges 10min, discards supernatant (visible gummy white precipitation after centrifugation), then often manages
The ethanol of 1ml 75% is added (with absolute ethyl alcohol and DEPC water to be matched somebody with somebody, absolute ethyl alcohol：DEPC water=3:4), mix, clean RNA precipitate
Once；Refrigerated centrifuge is put into, temperature is 4 DEG C, rotating speed 7500rpm, and centrifugation 5min discards supernatant, drying at room temperature 5min.
25ul DEPC water is added, RNA lysates are put into -80 DEG C and preserved；With the biological analyser system measurements of Agilent 2100
The integrality of total serum IgE.
2.2Small RNA are sequenced
(1) structure in Small RNA libraries and sequence analysis
Total serum IgE is cut into 16-35nt RNA fragments, and purified from PAGE gels.5 are connect with T4RNA ligases and
3, which connect end, is attached, and the microRNA (Small RNA) being connected according to 5 ' ends with 3 ' ends, passes through PCR amplification technique reverse transcriptions
Construction cDNA library, and the cDNA library of structure is purified with Ago-Gel, then using Illumina Genome
Analyzer sequencing softwares carry out sequencing analysis.
(2) Small RNA comparison and annotation result
Initial data is handled first with Illumina 1G Genome Analyzer sequencing software, is then carried again
Intersection number is purged reading according to being filtered, by filtering low-quality reading and trimming adapter sequence.
(the version 18 of miRBase 19 that the data after clearing up will be filtered with initially searched；
http://www.mirbase.org/) contrasted to identify known miRNAs, reflected for what can not be read
Penetrate the Ensemble (ftp for then referring to non-coding RNA://ftp.ensembl.org/pub/release-69/fasta/sus_
Scrofa/ncrna/), piRNA (http://pirnabank.ibab.ac.in/) and Rfam (version 10；http://
Rfam.sanger.ac.uk/) database is annotated, can sequence of mapping will be for further analysis.Meanwhile it is many not
The sequence not annotated with any of the above databases will pass through miRDeep (http://deepbase.sysu.edu.cn/
Mirdeep.php new miRNA) is predicted, these miRNA hairpin structure uses RNAfold software analysis (http://
Rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi), only with typical stem ring type hairpin structure and freedom
Sequence that can be less than -20kcal/mol is considered new potential miRNA.After the completion of all annotation steps, respectively
The analysis of size distribution and saturation degree is carried out using sequence storehouse.
2.3 sequencing result
After being sequenced and analyzing, obtained novel-miR-116 is as shown in table 1 below：
Table 1
Note:*Multiple=(poor healing/healing is normal)
The quantitative fluorescent PCR of embodiment 3 is analyzed
Detection point is carried out to expressions of the novel-miR-116 in large sample tissue using Real-time RT-PCR
Analysis：It has selected the poroma of 47 malunion of fracture patients, and the bone of the union normal patient of corresponding number (47)
Scab is control, detects novel-miR-116 expressions with fluorescence quantifying PCR method, the reverse transcriptase primer used during being somebody's turn to do
All it is the customization of Applied biosystems companies with real-time fluorescence quantitative PCR primer.
The sequence of reverse transcriptase primer is SEQ ID NO:2：TACCGTAGCCGACTTGGACGCACC；Real time fluorescent quantitative
The sequence of PCR primer is SEQ ID NO:3：ACTTGACGCTAATACCAT and SEQ ID NO:4：
CTACCGTTGAATTACTTA。
3.1RNA reverse transcription
CDNA is synthesized with the miRNA specific reverse transcriptases primer of Applied biosystems companies, and reverse transcription reaction is pressed
Reverse transcription reaction is carried out according to Applied biosystems companies Reverse Transcriptase kit operation sequence, using total serum IgE as template, is reversed
Record synthesis cDNA.
Table 2
Detailed process is：Reaction system as shown in Table 2 above is configured on ice with centrifuge tube, then of short duration centrifugation is mixed
It is even, then carry out reverse transcription reaction by following response procedures：
16 DEG C, 30min；42 DEG C, 30min；85 DEG C, 5min；- 20 DEG C save backup.
3.2 quantitative fluorescent PCRs quantify
Using the cDNA that reverse transcription reaction obtains as template, while using U6RNA as internal reference, novel-miR-116 phases are detected
To expression；The reaction system is as shown in table 3 below.
Table 3
After all reagents in above-mentioned table 3 are made into reaction system in PCR reaction tubes, of short duration centrifugation mixes, and then will
PCR reaction tubes insert progress Real-time RT-PCR experiments in Roche lightCycler 480II quantitative real time PCR Instruments.Instead
The condition is answered to be：95 DEG C, 10min；95 DEG C, 15s；60 DEG C, 1min, 35 circulations.Every group of experiment is repeated 3 times, miRNA tables in sample
Standardized up to level with U6 genes.MiRNAs relative expression levels are with 2-ΔΔCTMethod calculates, the TaqMan Real-Time-
PCR method can realize the quantitative analysis to ripe miRNAs.
3.3 testing result
The result of quantitative fluorescent PCR shown as shown in figure 1, it can be seen that compared with the normal healing patient that fractures,
Novel-miR-116 express in malunion of fracture patient's poroma and significantly increase (malunion of fracture/fracture normally heals=
47；P=0.0016).Therefore, novel-miR-116 can be as the molecular marked compound of prediction malunion of fracture.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
All any modification, equivalent and improvement made within refreshing and principle etc., should be included in the scope of the protection.
SEQUENCE LISTING
<110>Shenzhen City Second People's Hospital
<120>The miRNA marker related to union and its detection primer and application
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>People
<400> 1
ggcaucggcu gaaccugcgu 20
<210> 2
<211> 24
<212> DNA
<213>It is artificial synthesized
<400> 2
taccgtagcc gacttggacg cacc 24
<210> 3
<211> 18
<212> DNA
<213>It is artificial synthesized
<400> 3
acttgacgct aataccat 18
<210> 4
<211> 18
<212> DNA
<213>It is artificial synthesized
<400> 4
ctaccgttga attactta 18
Claims (3)
1. a kind of miRNA marker related to union, it is characterised in that the sequence of the miRNA marker is SEQ
ID NO:1：GGCAUCGGCUGAACCUGCGU.
2. the detection primer of one group of miRNA marker as claimed in claim 1, it is characterised in that the detection primer includes
Reverse transcriptase primer and real-time fluorescence quantitative PCR primer；Wherein, the sequence of the reverse transcriptase primer is SEQ ID NO:2：
TACCGTAGCCGACTTGGACGCACC；The sequence of the real-time fluorescence quantitative PCR primer is SEQ ID NO:3：
ACTTGACGCTAATACCAT and SEQ ID NO:4：CTACCGTTGAATTACTTA.
3. application of the detection primer in terms of union auxiliary diagnostic box is prepared as claimed in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710681220.9A CN107475380A (en) | 2017-08-10 | 2017-08-10 | The miRNA marker related to union and its detection primer and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710681220.9A CN107475380A (en) | 2017-08-10 | 2017-08-10 | The miRNA marker related to union and its detection primer and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107475380A true CN107475380A (en) | 2017-12-15 |
Family
ID=60599200
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710681220.9A Pending CN107475380A (en) | 2017-08-10 | 2017-08-10 | The miRNA marker related to union and its detection primer and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107475380A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016126844A1 (en) * | 2015-02-03 | 2016-08-11 | The Trustees Of The University Of Pennsylvania | Novel methods for early identification of bone healing ability in injured patients |
| CN106687602A (en) * | 2014-06-13 | 2017-05-17 | 维也纳自然资源与生命科学大学 | Compositions and methods for the diagnosis and treatment of bone fractures and disorders |
-
2017
- 2017-08-10 CN CN201710681220.9A patent/CN107475380A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106687602A (en) * | 2014-06-13 | 2017-05-17 | 维也纳自然资源与生命科学大学 | Compositions and methods for the diagnosis and treatment of bone fractures and disorders |
| WO2016126844A1 (en) * | 2015-02-03 | 2016-08-11 | The Trustees Of The University Of Pennsylvania | Novel methods for early identification of bone healing ability in injured patients |
Non-Patent Citations (3)
| Title |
|---|
| BING HE等: "Bioinformatics and Microarray Analysis of miRNAs in Aged Female Mice Model Implied New Molecular Mechanisms for Impaired Fracture Healing", 《INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES》 * |
| WAKI, T 等: "Profiling microRNA expression in fracture nonunions: Potential role of microRNAs in nonunion formation studied in a rat model", 《BONE & JOINT JOURNAL》 * |
| 陈磊等: "骨折延迟愈合相关miRNAs检测", 《中华临床医师杂志(电子版)》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220136054A1 (en) | Diagnostic, Prognostic And Therapeutic Uses Of Long Noncoding RNAs For Heart Disease And Regenerative Medicine | |
| Alvarez-Dominguez et al. | Global discovery of erythroid long noncoding RNAs reveals novel regulators of red cell maturation | |
| Du et al. | Integrative analyses reveal a long noncoding RNA-mediated sponge regulatory network in prostate cancer | |
| Tseng et al. | Next-generation sequencing for microRNA profiling: microRNA-21-3p promotes oral cancer metastasis | |
| Khella et al. | MicroRNAs in kidney disease: an emerging understanding | |
| Xu et al. | Integrated microRNA-mRNA analyses reveal OPLL specific microRNA regulatory network using high-throughput sequencing | |
| Zhang et al. | Long noncoding RNA ASB16-AS1 promotes proliferation, migration, and invasion in glioma cells | |
| Wang et al. | Long noncoding RNA lung cancer associated transcript 1 promotes proliferation and invasion of clear cell renal cell carcinoma cells by negatively regulating miR‐495‐3p | |
| Sun et al. | RETRACTED ARTICLE: Long Noncoding RNA PVT1 Promotes Prostate Cancer Metastasis by Increasing NOP2 Expression via Targeting Tumor Suppressor MicroRNAs | |
| Yi et al. | RNA-seq identified a super-long intergenic transcript functioning in adipogenesis | |
| CN103080334A (en) | Micro-RNA biomarkers and methods for diagnosis of early colorectal carcinoma and high-grade adenoma | |
| Sand et al. | Next-generation sequencing of the basal cell carcinoma miRNome and a description of novel microRNA candidates under neoadjuvant vismodegib therapy: an integrative molecular and surgical case study | |
| CN107881249A (en) | LncRNA and its target gene are applied in seed selection high-quality livestock and poultry species | |
| Chen et al. | miR-548d-3p inhibits osteosarcoma by downregulating KRAS | |
| Wei et al. | Experimental study of expression profile and specific role of human microRNAs in regulating atrophic bone nonunion | |
| CN107519193A (en) | Esophageal squamous cell carcinoma early molecule diagnosis marker and its application | |
| CN107058579A (en) | Adenocarcinoma of lung related miRNA, composition and its application | |
| CN107904242B (en) | The new lncRNA of one boar intramuscular fat tissue extraction and its application | |
| CN107475380A (en) | The miRNA marker related to union and its detection primer and application | |
| WO2019161472A1 (en) | Method and kit for the classification of thyroid nodules | |
| CN102876789B (en) | Kit for detecting bone metastasis of lung cancer | |
| CN108823300A (en) | Application of the circRNA on the product of preparation diagnosis osteoarthritis | |
| CN109722474A (en) | MiRNA marker miR-19b relevant to bone metabolic disease and its application | |
| Chan et al. | Sex‐specific analysis of microRNA profiles in HBV‐associated cirrhosis by small RNA‐sequencing | |
| Muggerud et al. | Data integration from two microarray platforms identifies bi-allelic genetic inactivation of RIC8A in a breast cancer cell line |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171215 |