CN107447003B - Primer for detecting DGAT1 gene mutation and application thereof in yak milk quality prediction and identification method - Google Patents

Primer for detecting DGAT1 gene mutation and application thereof in yak milk quality prediction and identification method Download PDF

Info

Publication number
CN107447003B
CN107447003B CN201710648270.7A CN201710648270A CN107447003B CN 107447003 B CN107447003 B CN 107447003B CN 201710648270 A CN201710648270 A CN 201710648270A CN 107447003 B CN107447003 B CN 107447003B
Authority
CN
China
Prior art keywords
yak
primer
sscp
pcr
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201710648270.7A
Other languages
Chinese (zh)
Other versions
CN107447003A (en
Inventor
胡江
高小莉
刘秀
石斌刚
李少斌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gansu Agricultural University
Original Assignee
Gansu Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gansu Agricultural University filed Critical Gansu Agricultural University
Priority to CN201710648270.7A priority Critical patent/CN107447003B/en
Publication of CN107447003A publication Critical patent/CN107447003A/en
Application granted granted Critical
Publication of CN107447003B publication Critical patent/CN107447003B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a PCR-SSCP primer pair for detecting DGAT1 gene mutation, wherein the nucleotide sequence of a forward primer of the PCR-SSCP primer pair is SEQ ID NO.1 in a sequence table, and the nucleotide sequence of a reverse primer is SEQ ID NO.2 in the sequence table; and provides the application of the yak milk quality prediction and identification method and the corresponding kit. The invention has the beneficial effects that: the invention designs a pair of primers according to the sequence of the 15 th intron-17 th exon region of the common cattle DGAT1 gene, performs SSCP typing screening detection after performing PCR amplification on yak genome DNA, determines the yak DGAT1 genotype and allele by analyzing banding patterns, determines SNPs mutation by allele sequence comparison, and analyzes the influence of DGAT1 gene mutation on the milk fat rate, thereby predicting the milk fat rate of the cattle.

Description

Primer for detecting DGAT1 gene mutation and application thereof in yak milk quality prediction and identification method
Technical Field
The invention relates to the technical field of molecular biology, in particular to a PCR-SSCP primer for detecting DGAT1 gene mutation and application thereof in a yak milk quality prediction and identification method.
Background
The yaks are distributed in the Qinghai-Tibet plateau and the alpine pasturing area around the Qinghai-Tibet plateau, provide plateau special livestock products such as meat, milk, wool and the like for local herdsmen, and are important production and living resources in the local. The yak milk is rich in nutrition and unique in flavor, and is a main raw material milk for processing plateau special milk products. The milk fat rate, the milk protein rate and the total solid matter content of the yak milk are respectively 5.45-7.22%, 4.86-5.40% and 16.91-17.40%, which are all higher than those of the Holstein cow milk.
Milk fat is an important constituent of milk, and milk fat contains more than 95% of triglycerides, and its synthesis is affected by glycerol-3-phosphate acyltransferase (GPAT), 1-acylglycerol-3-phosphate acyltransferase 6 (AGPAT 6), phosphatidic acid phosphatase 1 (LPIN 1), diacylglycerol acyltransferase (DGAT), etc., wherein DGAT is a key enzyme in the last step of triglyceride synthesis. The DGAT genes include two genes belonging to different gene families, DGAT1 and DGAT 2. The DGAT1 gene belongs to acyl coenzyme A Cholesterol Acyltransferase (ACAT) gene family, participates in the processes of fat synthesis, storage, lipoprotein assembly and the like, and is an important functional candidate gene influencing milk quality traits. The bovine DGAT1 gene is located on chromosome 14 and consists of 17 exons and 16 introns, encoding 489 amino acids. The double base mutation of exon 8 AA → CG of the cattle DGAT1 gene leads the 232 th lysine residue to be mutated into neutral hydrophobic alanine residue which is named as K232A. Research shows that K gene can increase the milk fat rate, the milk protein rate and the milk fat amount of Holstein cows, while A gene has the effect of improving the milk yield and the milk protein amount; mutations in the promoter region and other regions of the DGAT1 gene also have certain influence on milk production traits. In addition, mutations in the DGAT1 gene also affect intramuscular fat content in beef cattle and fat deposition and backfat thickness in pigs.
The high milk fat rate is the main characteristic of yak milk, and in recent years, many molecular inheritance reports are provided for yak milk protein, but the research on the genetic mechanism of the milk fat character is less.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provides a PCR-SSCP primer for detecting DGAT1 gene mutation and application thereof in a yak milk quality prediction and identification method.
In order to achieve the purpose, the technical scheme provided by the invention is as follows: a PCR-SSCP primer pair for detecting DGAT1 gene mutation is characterized in that the nucleotide sequence of a forward primer of the PCR-SSCP primer pair is SEQ ID NO.1 in a sequence table, and the nucleotide sequence of a reverse primer of the PCR-SSCP primer pair is SEQ ID NO.2 in the sequence table.
The second purpose of the invention is to provide the application of the PCR-SSCP primer pair in detecting the DGAT1 gene mutation.
The third purpose of the invention is to provide the application of the PCR-SSCP primer pair in yak milk quality prediction and identification.
The fourth purpose of the invention is to provide a PCR-SSCP detection kit for indicating the yak milk quality, the kit comprises a forward primer of a PCR-SSCP primer pair, a reverse primer, a DNA standard sample of a yak DGAT 1A and a standard sample of a yak DGAT 1B, the nucleotide sequence of the forward primer of the PCR-SSCP primer pair is SEQ ID NO.1 in a sequence table, and the nucleotide sequence of the reverse primer is SEQ ID NO.2 in the sequence table; the nucleotide sequence of the DNA standard sample of the yak DGAT 1A is SEQ ID NO.3 in the sequence table, and the nucleotide sequence of the DNA standard sample of the yak DGAT 1B is SEQ ID NO.4 in the sequence table.
The fifth purpose of the invention is to provide a yak milk quality identification method, which comprises the following steps:
1) collecting a sample and extracting DNA;
PCR amplification of the sample DNA to be detected, wherein the nucleotide sequence of the forward primer of the primer pair is SEQ ID NO.1 in the sequence table, and the nucleotide sequence of the reverse primer is SEQ ID NO.2 in the sequence table;
3) SSCP electrophoresis: performing SSCP electrophoresis on DNA standard samples of the yak DGAT 1A and the DGAT 1B and DNA of a sample to be detected simultaneously, wherein the nucleotide sequence of the DNA standard sample of the yak DGAT 1A is SEQ ID NO.3 in a sequence table, and the nucleotide sequence of the DNA standard sample of the yak DGAT 1B is SEQ ID NO.4 in the sequence table; and after the electrophoresis is finished, determining the genotype by staining, and respectively comparing the milk fat rate, the milk protein rate, the total solid matter percentage content and the non-fat solid matter percentage content of the sample to be detected carrying the DGAT 1A allele and the sample to be detected carrying the DGAT 1B allele.
Further, in the identification method of yak milk quality, the PCR amplification system in the step 2) is as follows: the total volume was 20. mu.L, wherein the DNA template was 0.8. mu.L, the forward and reverse primers were 0.8. mu.L each, TaKaRa Premix Taq polymerase was 10. mu.L, and sterilized ultrapure water was 7.6. mu.L.
Further, in the method for identifying the yak milk variety, in the step 2), the reaction conditions during the PCR amplification are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; finally, extension is carried out for 5min at 72 ℃.
Further, in the identification method of yak milk quality, the SSCP electrophoresis detection process of the PCR product in the step 3) is as follows: and (3) putting 2 mu L of PCR amplification product into a sterilized centrifugal tube, adding 8 mu L of denaturation sample buffer solution, denaturing at 98 ℃ for 10min, quickly carrying out ice bath for 5min, loading the sample to 12% non-denatured polyacrylamide gel, carrying out electrophoresis for 20h at 290V voltage, electrophoresis chamber temperature of 19-25 ℃ and electrophoresis tank water circulation temperature of 22 ℃, and judging the genotype after developing the color by a silver staining method.
Further, in the identification method of yak milk quality, the denatured sample buffer solution comprises the following components: 98% deionized formamide, 0.025% dimethyl benzene cyanide, 0.025% bromophenol blue and 10 mmol/L EDTA, and the pH value of the denaturation loading buffer is 8.0.
Further, in the method for identifying the yak milk quality, in the 12% non-denatured polyacrylamide gel, Acr: bis is 37.5: 1.
the invention has the beneficial effects that: the PCR-SSCP primer for detecting the DGAT1 gene mutation and the application thereof in the yak milk quality prediction and identification method provided by the invention have the advantages that a pair of primers are designed according to the sequence of the region of the 15 th intron-17 th exon of the common cattle DGAT1 gene, SSCP typing screening detection is carried out after the yak genome DNA is subjected to PCR amplification, the yak DGAT1 genotype and allele are determined by analyzing the banding pattern, SNPs mutation is determined by comparing the allele sequences, and the influence of the DGAT1 gene mutation on the milk fat rate is analyzed, so that the milk fat rate of the cattle is predicted, and the PCR-SSCP primer has the advantages of sensitive reaction, strong specificity, simple operation and high accuracy, and can be used for rapid detection.
Drawings
Fig. 1 shows an allelic SSCP banding pattern of the candidate gene DGAT1 for the yak milk quality trait of the present invention.
Detailed Description
The present invention will be described in detail by taking the establishment of the DGAT1 genotyping and milk fat rate predicting techniques of the Gannan yak as an example.
Example 1:
designing a PCR-SSCP detection primer of the candidate gene DGAT1 for the yak milk quality character, which specifically comprises the following steps:
DGAT1-F：5′- CTCCGCCTTCTTCCACGAG -3′；
DGAT1-R：5′- GTCCAACACCCACGAGG -3′。
the primers were synthesized by the Beijing Liuhe Huada Gene Co.
Example 2:
preparing a PCR-SSCP detection kit of the yak milk quality character candidate gene:
the PCR-SSCP detection kit of the yak milk quality character candidate gene DGAT1 comprises PCR reaction solution and a DNA standard sample of DGAT 1A; deionized water, 10% ammonium persulfate, loading denaturation buffer, TEMED (tetramethylethylenediamine), 12% non-denaturing polyacrylamide gel Acr: Bis =37.5: 1;
wherein the sample loading denaturation buffer solution comprises 98% of deionized formamide, 0.025% of bromophenol blue, 0.025% of dimethyl benzonitrile and 10 mmol/L of EDTA, and the pH value is 8.0;
reaction solution for PCR reaction: the total volume is 20. mu.L, wherein the DNA template is 0.8. mu.L, the upstream primer and the downstream primer are 0.8. mu.L respectively, TaKaRa Premix Taq polymerase is 10. mu.L, and the sterilized ultrapure water is 7.6. mu.L.
The nucleotide sequence of the DNA standard sample of DGAT 1A is (SEQ ID NO.3 in the sequence table):
CTCCGCCTTCTTCCACGAGGTCAGTGCACTGAGGGCGCGCCCTGCCCCTGGTGGGGGTGGGGGTGGGGCTCGCTGACGCCTCTCTCCCCTCAGTACTGGTGAGCATCCCCCTGCGCATGTTCCGCCTCTGGGCCTTCACCGGCATGATGGCGCAGGTGAGCAGCCCTGGACCCCCGCTCCGCCCCGCCCCGCGAGCGCAGAGGCTCACTCCCGTCCTGTGTCCCCAGATCCCGCTGGCCTGGATAGTGGGCCGCTTCTTCCGCGGCAACTACGGCAACGCGGCCGTGTGGCTGTCACTCATCATCGG。
example 3:
the method for detecting the yak milk quality character candidate gene by using the kit of the invention comprises the following steps:
(1) collecting samples: collecting 10ml of blood from the jugular vein of the yak, anticoagulating by ACD, and freezing and storing at-70 ℃;
(2) extraction of genomic DNA: extracting genome DNA from the frozen blood sample by a phenol-chloroform method;
(3) polymerase chain reaction:
and (3) PCR reaction system: the total volume is 20 mu L, wherein the DNA template is 0.8 mu L, the upstream primer and the downstream primer are 0.8 mu L respectively, the TaKaRa Premix Taq polymerase is 10 mu L, and the sterilized ultrapure water is 7.6 mu L; reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; finally, extending for 5min at 72 ℃;
the primer sequence is as follows:
DGAT1-F：5′- CTCCGCCTTCTTCCACGAG -3′；
DGAT1-R：5′- GTCCAACACCCACGAGG -3′。
(4) SSCP detection of PCR products:
taking 2 mu L of PCR amplification product, adding 8 mu L of denaturation sample buffer solution (98% deionized formamide, 0.025% dimethyl benzene cyanide, 0.025% bromophenol blue and 10 mmol/L EDTA pH8.0), denaturing at 98 ℃ for 10min, rapidly carrying out ice bath for 5min, loading to 12% non-denaturation polyacrylamide gel (Acr: Bis =37.5:1), carrying out electrophoresis at 290V voltage, electrophoresis chamber temperature of 19-25 ℃, electrophoresis tank water circulation temperature of 22 ℃ for 20h, and determining genotype after developing by silver staining method.
(5) And (5) judging a result:
by aiming yaksDGAT1PCR-SSCP detection of a region of a gene '15 th intron-17 th exon' shows that 3 alleles exist, the alleles capable of obviously improving the yak milk fat rate are DGAT 1A and DGAT 1C, and the alleles capable of obviously reducing the yak milk fat rate are DGAT 1B.
The nucleotide sequence of the DGAT 1A which is an allelic gene for remarkably improving the quality of the yak milk is shown as (SEQ ID NO.3 in a sequence table):
CTCCGCCTTCTTCCACGAGGTCAGTGCACTGAGGGCGCGCCCTGCCCCTGGTGGGGGTGGGGGTGGGGCTCGCTGACGCCTCTCTCCCCTCAGTACTGGTGAGCATCCCCCTGCGCATGTTCCGCCTCTGGGCCTTCACCGGCATGATGGCGCAGGTGAGCAGCCCTGGACCCCCGCTCCGCCCCGCCCCGCGAGCGCAGAGGCTCACTCCCGTCCTGTGTCCCCAGATCCCGCTGGCCTGGATAGTGGGCCGCTTCTTCCGCGGCAACTACGGCAACGCGGCCGTGTGGCTGTCACTCATCATCGG。
the nucleotide sequence of the allele of which the yak milk quality is obviously reduced as DGAT 1B is shown as (SEQ ID NO.4 in the sequence table): CTCCGCCTTCTTCCACGAGGTCAGTGCACTGAGGGCGCGCCCTGCCCCTGGTGGGGGTGGGGGTGGGGCTCGCTGACGCCTCTCTCCCCTCAGTACTGGTGAGCATCCCCCTGCGCATGTTCCGCCTCTGGGCCTTCACCGGCATGATGGCGCAGGTGAGCAGCCCTGGACCCCCGCTCCGCCCCGCCCCGCGAGCGCAGAGGCTCACTCCCGTCCTGTGTCCCCAGATCCCGCTGGCCTGGATAGTGGGCTGCTTCTTCCGCGGCAACTACGGCAACGCGGCCGTGTGGCTGTCACTCATCATCGG are provided.
The nucleotide sequence of the allele DGAT 1C which can obviously improve the yak milk fat rate is shown as (SEQ ID NO.5 in the sequence table):
CTCCGCCTTCTTCCACGAGGTCAGTGCACTGAGGGCGCGCCCTGCCCCTGGTGGGGGTGGGGGTGGGGCTTGCTGACGCCTCTCTCCCCTCAGTACTGGTGAGCATCCCCCTGCGCATGTTCCGCCTCTGGGCCTTCACCGGCATGATGGCGCAGGTGAGCAGCCCTGGACCCCCGCTCCGCCCCGCCCCGCGAGCGCAGAGGCTCACTCCCGTCCTGTGTCCCCAGATCCCGCTGGCCTGGATAGTGGGCTGCTTCTTCCGCGGCAACTACGGCAACGCGGCCGTGTGGCTGTCACTCATCATCGG。
example 4:
the use method of the kit comprises the following steps:
the method comprises the following steps:
the total volume is 20 mu L, wherein the DNA template is 0.8 mu L, the upstream primer and the downstream primer are 0.8 mu L respectively, the TaKaRa Premix Taq polymerase is 10 mu L, and the sterilized ultrapure water is 7.6 mu L; reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; finally, extending for 5min at 72 ℃;
(A) mixing 0.8 muL (50 ng/muL) of yak genome DNA to be detected with PCR amplification solution in the kit to perform PCR reaction, wherein the reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; finally, extending for 5min at 72 ℃;
(B) performing SSCP detection by simultaneously mixing the amplified product of step (A) and DNA standard sample of DGAT 1A with each component of SSCP detection reagent in the kit;
(C) and (C) in the band patterns detected in the step (B), the samples carrying the DGAT1 × A, DGAT1 × B and DGAT1 × C standard sample band patterns are individuals carrying alleles affecting the yak milk fat rate.
Example 5:
the application example is as follows:
firstly, detecting a yak group:
249 head of a Gannan yak, 10ml of blood sample is collected from a jugular vein, and ACD (acid citrate dextrose) is anticoagulated; and simultaneously measuring the milk fat rate, the milk protein rate, the lactose rate, the percentage content of total solid matters and the percentage content of fat-free solid matters of the corresponding blood sample collected yak, and recording the calving time, age and fetal frequency.
II, a test method:
1. primer design and PCR amplification:
the primer sequences are as follows:
DGAT1-F：5′- CTCCGCCTTCTTCCACGAG -3′；
DGAT1-R：5′- GTCCAACACCCACGAGG -3′。
the optimal reaction system and reaction conditions are as follows:
and (3) PCR reaction system: the total volume is 20 mu L, wherein the DNA template is 0.8 mu L, the upstream primer and the downstream primer are 0.8 mu L respectively, the TaKaRa Premix Taq polymerase is 10 mu L, and the sterilized ultrapure water is 7.6 mu L; reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; finally, extension is carried out for 5min at 72 ℃. After the reaction, 5 PCR reaction solutions (5. mu.L) were electrophoresed on 1% agarose gel to detect whether PCR products were amplified.
2. And (3) SSCP detection:
and (2) adding 8 mu L of denaturation sample buffer solution (98% deionized formamide, 0.025% dimethyl benzonitrile, 0.025% bromophenol blue and 10 mmol/L EDTA pH8.0) into 2 mu L of the PCR amplification product obtained in the step (1) of a sterilized centrifugal tube, denaturing at 98 ℃ for 10min, rapidly carrying out ice bath for 5min, loading the sample to 12% non-denaturation polyacrylamide gel (Acr: Bis =37.5:1), carrying out electrophoresis at 290V voltage, electrophoresis chamber temperature of 19-25 ℃, electrophoresis tank water circulation temperature of 22 ℃ for 20h, and determining the genotype after developing by a silver staining method. AA, BB, AB, BC and AC 5 SSCP banding patterns were detected in the 249-headed kanan yaks, corresponding to the 3 alleles DGAT1 a, B, C. The SSCP electropherogram is shown in FIG. 1.
3. Gene sequencing:
according to the SSCP gel pattern judgment result, the allele DGAT 1A and B has homozygous individuals, and the PCR product is used for direct sequencing; allele DGAT1 × C was present only in heterozygous individuals, and specific SSCP bands were cut and reamplified before sequencing. The allelic sequence was determined by the company Beijing Liu-He Hua Dagen. And (3) performing sequence alignment on the determination result through DNAMAN software. The nucleotide sequences of the alleles are shown in the sequence table.
4. The correlation analysis of the yak DGAT1 gene '15 th intron-17 th exon' region allele and milk quality character:
in this example, the influence of alleles in the "15 th intron-17 th exon" region of the gannan DGAT1 gene on milk quality traits was analyzed by using an allele "deletion/presence" method (table 1), and the results showed that the milk fat percentage, milk protein percentage, total solid matter percentage and fat-free solid matter percentage of yak individuals carrying allele a were significantly higher than those of non-carriers (P < 0.05), the milk fat percentage of individuals carrying allele C was significantly higher than those of non-carriers (P < 0.05), and the milk fat percentage and total solid matter percentage of individuals carrying allele B were significantly lower than those of non-carriers (P < 0.05). The selection of individuals carrying the allele A can improve the milk quality of offspring yak groups, and the selection of individuals carrying the allele C can improve the milk fat rate of offspring yak groups. Table 1 shows the correlation analysis of the allele of the region from intron 15 to exon 17 of the DGAT1 gene of yaks and the milk quality traits.
TABLE 1
Figure DEST_PATH_IMAGE001
Wherein (P < 0.01) indicates that the difference is extremely significant; (P < 0.05) indicates significant difference.
Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> university of agriculture in Gansu province
<120> PCR-SSCP primer for detecting DGAT1 gene mutation and application thereof in yak milk quality prediction and identification method
<210> 1
<211> 19
<212> DNA
<213> Forward primer DGAT1-F
<400> 1
ctccgccttc ttccacgag 19
<210> 1
<211> 17
<212> DNA
<213> reverse primer DGAT1-R
<400> 2
gtccaacacc cacgagg 17
<210> 1
<211> 307
<212> DNA
<213> nucleotide sequence of DNA standard of DGAT 1A (the allele that significantly improves the quality of yak milk is the nucleotide sequence of DGAT 1A)
<400> 3
ctccgccttc ttccacgagg tcagtgcact gagggcgcgc cctgcccctg gtgggggtgg 60
gggtggggct cgctgacgcc tctctcccct cagtactggt gagcatcccc ctgcgcatgt 120
tccgcctctg ggccttcacc ggcatgatgg cgcaggtgag cagccctgga cccccgctcc 180
gccccgcccc gcgagcgcag aggctcactc ccgtcctgtg tccccagatc ccgctggcct 240
ggatagtggg ccgcttcttc cgcggcaact acggcaacgc ggccgtgtgg ctgtcactca 300
tcatcgg 307
<210> 1
<211> 307
<212> DNA
<213> nucleotide sequence of DGAT1 xB as allele for remarkably reducing yak milk quality
<400> 4
ctccgccttc ttccacgagg tcagtgcact gagggcgcgc cctgcccctg gtgggggtgg 60
gggtggggct cgctgacgcc tctctcccct cagtactggt gagcatcccc ctgcgcatgt 120
tccgcctctg ggccttcacc ggcatgatgg cgcaggtgag cagccctgga cccccgctcc 180
gccccgcccc gcgagcgcag aggctcactc ccgtcctgtg tccccagatc ccgctggcct 240
ggatagtggg ctgcttcttc cgcggcaact acggcaacgc ggccgtgtgg ctgtcactca 300
tcatcgg 307
<210> 1
<211> 307
<212> DNA
<213> nucleotide sequence of DGAT 1C as allele for remarkably increasing yak milk fat rate
<400> 5
ctccgccttc ttccacgagg tcagtgcact gagggcgcgc cctgcccctg gtgggggtgg 60
gggtggggct tgctgacgcc tctctcccct cagtactggt gagcatcccc ctgcgcatgt 120
tccgcctctg ggccttcacc ggcatgatgg cgcaggtgag cagccctgga cccccgctcc 180
gccccgcccc gcgagcgcag aggctcactc ccgtcctgtg tccccagatc ccgctggcct 240
ggatagtggg ctgcttcttc cgcggcaact acggcaacgc ggccgtgtgg ctgtcactca 300
tcatcgg 307

Claims (7)

1. The kit for detecting the DGAT1 gene is applied to the prediction and identification of the yak milk quality, the kit comprises a forward primer and a reverse primer of a PCR-SSCP primer pair, a DNA standard sample of a yak DGAT 1A, a standard sample of a yak DGAT 1B and a standard sample of a yak DGAT 1C, the nucleotide sequence of the forward primer of the PCR-SSCP primer pair is SEQ ID NO.1 in a sequence table, and the nucleotide sequence of the reverse primer is SEQ ID NO.2 in the sequence table; the nucleotide sequence of the DNA standard sample of the yak DGAT 1A is SEQ ID NO.3 in the sequence table, the nucleotide sequence of the DNA standard sample of the yak DGAT 1B is SEQ ID NO.4 in the sequence table, and the nucleotide sequence of the DNA standard sample of the DGAT 1C is SEQ ID NO.5 in the sequence table.
2. The method for identifying the yak milk quality is characterized by comprising the following steps:
1) collecting a sample and extracting DNA;
2) performing PCR amplification on the DNA of a sample to be detected, wherein the nucleotide sequence of a forward primer of a PCR primer pair is SEQ ID number 1 in a sequence table, and the nucleotide sequence of a reverse primer is SEQ ID number 2 in the sequence table;
3) SSCP electrophoresis detection, namely performing SSCP electrophoresis on the PCR product obtained in the step 2), judging the genotype by silver staining after the electrophoresis is finished, and then determining an allele sequence;
4) and (3) analyzing results by using the determined allele sequence, calculating allele frequency, genotype frequency, degree of purity, genetic heterozygosity and effective allele factors, simultaneously calculating polymorphic information content, and analyzing the correlation of gene mutation with carcass and meat quality traits.
3. The method for identifying the quality of the yak milk according to claim 2, wherein the PCR amplification system in the step 2) is as follows: the total volume was 20. mu.L, wherein the DNA template was 0.8. mu.L, the forward and reverse primers were 0.8. mu.L each, TaKaRa Premix Taq polymerase was 10. mu.L, and sterilized ultrapure water was 7.6. mu.L.
4. The method for identifying the quality of yak milk according to claim 2, wherein in the step 2), the reaction conditions during PCR amplification are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; finally, extension is carried out for 5min at 72 ℃.
5. The method for identifying the quality of yak milk according to claim 2, wherein the SSCP electrophoresis detection process of the PCR product in the step 3) is as follows: and (3) putting 2 mu L of PCR amplification product into a sterilized centrifugal tube, adding 8 mu L of denaturation sample buffer solution, denaturing at 98 ℃ for 10min, quickly carrying out ice bath for 5min, loading the sample to 12% non-denatured polyacrylamide gel, carrying out electrophoresis for 20h at 290V voltage, electrophoresis chamber temperature of 19-25 ℃ and electrophoresis tank water circulation temperature of 22 ℃, and judging the genotype after developing the color by a silver staining method.
6. The method for identifying the quality of the yak milk according to claim 5, wherein the denatured sample buffer consists of: 98% deionized formamide, 0.025% dimethyl benzene cyanide, 0.025% bromophenol blue and 10 mmol/L EDTA, and the pH value of the denaturation loading buffer is 8.0.
7. The method for identifying the quality of yak milk according to claim 5, wherein in the 12% non-denatured polyacrylamide gel, the ratio of Acr: bis is 37.5: 1.
CN201710648270.7A 2017-08-01 2017-08-01 Primer for detecting DGAT1 gene mutation and application thereof in yak milk quality prediction and identification method Expired - Fee Related CN107447003B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710648270.7A CN107447003B (en) 2017-08-01 2017-08-01 Primer for detecting DGAT1 gene mutation and application thereof in yak milk quality prediction and identification method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710648270.7A CN107447003B (en) 2017-08-01 2017-08-01 Primer for detecting DGAT1 gene mutation and application thereof in yak milk quality prediction and identification method

Publications (2)

Publication Number Publication Date
CN107447003A CN107447003A (en) 2017-12-08
CN107447003B true CN107447003B (en) 2021-02-26

Family

ID=60489368

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710648270.7A Expired - Fee Related CN107447003B (en) 2017-08-01 2017-08-01 Primer for detecting DGAT1 gene mutation and application thereof in yak milk quality prediction and identification method

Country Status (1)

Country Link
CN (1) CN107447003B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109652560B (en) * 2018-11-30 2022-08-16 甘肃农业大学 Genetic marker related to yak milk quality and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003004630A2 (en) * 2001-07-06 2003-01-16 Arbeitsgemeinschaft Deutscher Rinderzüchter E.V. (Adr) Method for determining the genetic predisposition of a mammal for its milk fat content and/or for its intramuscular fat content
CN104975101A (en) * 2015-07-21 2015-10-14 甘肃农业大学 PCR-SSCP (polymerase chain reaction-single strand conformation polymorphism) primer pair for indicating tenderness of yak muscles and detection kit

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003004630A2 (en) * 2001-07-06 2003-01-16 Arbeitsgemeinschaft Deutscher Rinderzüchter E.V. (Adr) Method for determining the genetic predisposition of a mammal for its milk fat content and/or for its intramuscular fat content
CN104975101A (en) * 2015-07-21 2015-10-14 甘肃农业大学 PCR-SSCP (polymerase chain reaction-single strand conformation polymorphism) primer pair for indicating tenderness of yak muscles and detection kit

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Genetic association between SNPs in the DGAT1 gene and milk production traits in Murrah buffaloes;Ana Freitas et al.;《Trop Anim Health Prod》;20160628;第48卷;摘要和PCR and sequencing部分 *

Also Published As

Publication number Publication date
CN107447003A (en) 2017-12-08

Similar Documents

Publication Publication Date Title
CN111286541B (en) Haplotype marker related to lambing number in 3&#39; UTR of goat ZBP1 gene and application thereof
Ciecierska et al. The influence of fatty acid synthase polymorphism on milk production traits in Polish Holstein-Friesian cattle.
CN111996264A (en) Application of pig SNP molecular marker in pig breeding character screening and pig breeding
US20210032697A1 (en) Method for discriminating sex of yellowtail group
Doosti et al. Comparative study of β-lactoglobulin gene polymorphism in Holstein and Iranian native cattle
CN107447003B (en) Primer for detecting DGAT1 gene mutation and application thereof in yak milk quality prediction and identification method
Vohra et al. Genetic variants of beta-lactoglobulin gene and its association with milk composition traits in riverine buffalo
Babii et al. A TaqMan PCR assay for detection of DGAT1 K232A polymorphism in cattle
CN115820879B (en) Molecular marker related to intramuscular fat traits of pigs in pig AOPEP gene and application thereof
Wang et al. Calpastatin gene polymorphism is associated with rabbit meat quality traits
Moravcíková et al. HinfI polymorphism of PIT-1 gene in Slovak spotted cattle
Kale et al. FASN gene and its role in bovine milk production
Hristova Genetic polymorphism of alpha S1-casein gene in Bulgarian sheep breeds.
Ozmen et al. Polymorphism of goat DGAT1 gene and their association with milk production traits
CN104975101A (en) PCR-SSCP (polymerase chain reaction-single strand conformation polymorphism) primer pair for indicating tenderness of yak muscles and detection kit
Jain et al. Allele mining in β-lactoglobulin gene of Capra hircus
Kaura et al. Screening and association of polymorphism in alpha-lactalbumin gene in Holstein Friesian Crossbred Cattle
RU2744174C1 (en) Method for cattle genotyping by alleles 878 of scd1 (rs41255693) gene by pcr in real time
CN114182025B (en) SNP molecular marker related to pig feed conversion rate and application thereof
Aboelenin et al. Molecular characterization of tumor necrosis factor-α (tnfα) gene in egyptian river buffaloes
CN117051128B (en) NARS2 gene molecular marker related to pork quality traits and application thereof
CN117363741B (en) Molecular marker related to pig carcass and meat quality traits in pig GPX3 gene 5&#39; UTR and application thereof
CN114231644B (en) SNP molecular marker related to heavy character of spotted deer antler, detection primer, kit and application thereof
KR101444414B1 (en) Composition for predicting of meat quality in Hanwoo
Ropka-Molik et al. New Polymorphisms in Regulatory Regions of Porcine μ-Calpain Gene and Their Association with Transcript Abundance

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20210226

CF01 Termination of patent right due to non-payment of annual fee