CN107446895B - Secretory porcine circovirus type 2 recombinant adenovirus and construction method thereof - Google Patents
Secretory porcine circovirus type 2 recombinant adenovirus and construction method thereof Download PDFInfo
- Publication number
- CN107446895B CN107446895B CN201710607801.8A CN201710607801A CN107446895B CN 107446895 B CN107446895 B CN 107446895B CN 201710607801 A CN201710607801 A CN 201710607801A CN 107446895 B CN107446895 B CN 107446895B
- Authority
- CN
- China
- Prior art keywords
- recombinant adenovirus
- adenovirus
- secretory
- cap
- cd40l
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/53—Colony-stimulating factor [CSF]
- C07K14/535—Granulocyte CSF; Granulocyte-macrophage CSF
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10041—Use of virus, viral particle or viral elements as a vector
- C12N2710/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Toxicology (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Plant Pathology (AREA)
- Pharmacology & Pharmacy (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention provides a secretory porcine circovirus type 2 recombinant adenovirus and a construction method thereof. The recombinant adenovirus is obtained by packaging adenovirus by using recombinant adenovirus plasmid, wherein the recombinant adenovirus plasmid is formed by homologous recombination of a secretory porcine circovirus type 2 recombinant adenovirus shuttle vector and an adenovirus skeleton vector. The recombinant adenovirus shuttle vector inserts the targeted gene fragments, including Intron A, co-expressed secreted CD40L, PCV2Cap and GMCSF, and WPRE. By increasing the protein expression level, CD40L, Cap and GMCSF can be co-expressed and secreted out of cells, and can be better and faster recognized by antigen presenting cells. The recombinant adenovirus combines two different action mechanisms, and can enhance the immunogenicity of the adenovirus vector vaccine.
Description
Technical Field
The invention belongs to the field of genetic engineering vaccines, and particularly relates to construction of a secretory porcine circovirus type 2 (PCV2) recombinant adenovirus Ad-A-spCD 40L-spCap-spGMCSF-W.
Background
Adenovirus has the advantages of low pathogenicity, wide host range, good stability, easy recombinant DNA operation, high virus titer, easy concentration and storage, capability of accommodating larger gene segments and the like, and the biological background of the adenovirus is quite clearly researched, so that the adenovirus vector is widely researched and applied in the aspects of vaccine preparation, gene therapy of cancers, infectious diseases and genetic diseases and the like and is considered as one of the most promising vectors.
The biggest problem of adenovirus as a commonly used vaccine vector is that the self-protein of adenovirus can induce the host to generate strong immune response, thereby limiting the application of the vaccine in clinical practice.
One of the methods for reducing the adenovirus autoimmune response is to increase the expression level of the target protein, thereby reducing the adenovirus immune dose and further reducing the adenovirus autoimmune response. Intron A, the first Intron of human cytomegalovirus, is used as a transcription regulatory element, and is used together with hCMV promoter/enhancer to increase the expression of target genes with deleted introns. Introns may increase the efficiency of gene expression by several different mechanisms, which are generally classified into two categories: one is the protection mechanism; another class is the enhancement mechanism. The protective mechanisms emphasize the protective capacity of the intron, and it is believed that certain sequences of the intron can stabilize the primary transcript by folding on themselves or by binding to other proteins to form a secondary structure. In addition, the intron sequence can also be used as a target sequence of an RNA protective factor to stabilize a primary transcript, so that the stability of mRNA in a nucleus is indirectly increased, more mature mRNA is accumulated in cytoplasm, and the expression efficiency of a target gene is further enhanced. The enhancement mechanism emphasizes the pro-transcriptional capacity of the intron. Certain introns have sequences that function like enhancers or other cis-regulatory elements, which bind to certain proteins and thereby affect the initiation and elongation of transcription, opening up the chromosomal domain. Another element for regulating gene expression is a woodchuck hepatitis virus post-transcriptional regulatory element WPRE, which mainly has the functions of increasing the stability of mRNA, processing the 3' end and promoting the mRNA to be nucleated and the accumulation of mRNA in cytoplasm, thereby enhancing the expression level of the target gene which is not spliced.
Another approach is to enhance the immune effect of adenoviral vector vaccines, and a common approach is to introduce cytokines as molecular adjuvants to enhance the immune effect of the vaccine. CD40L is one of the Tumor Necrosis Factor (TNF) family members, and CD40 is its receptor. CD40-CD40L cross-linking plays an important role not only in humoral immunity, but also in the regulation of cell-mediated immune responses. On the one hand, CD40-CD40L cross-linking plays an important role in B cell activation and proliferation, antibody production and Ig class conversion. On the other hand, CD40-CD40L crosslinking can promote CD4+T cells are activated themselves, express CD25 and CD40L more, promote secretion of IL-12, and the latter participates in CTL production and differentiation of T cells into Th cells. Another cytokine is GMCSF, which not only stimulates hematopoietic progenitor cell proliferation, differentiation and maturation, but also activates neutrophils, macrophages, Dendritic Cells (DCs) and other monocytes, playing an important role in the cytokine network. GMCSF can induce hematopoietic precursor cell to differentiate and proliferateThe vaccine has the advantages of maintaining the survival of hematopoietic precursor cells and mature blood cells, enhancing the activity and biological function of DC, promoting the proliferation and differentiation of Langerhans cells in the skin, attracting DC to gather and mature to an injection part, and improving the antigen presenting capability of the DC, thereby playing a role in enhancing the immune effect of the vaccine.
Porcine circovirus associated disease (PCVAD) is a very popular porcine infectious disease caused by porcine circovirus type 2 (PCV 2). The disease was first outbreak in canada in 1991 and was subsequently reported in many countries, with PCVAD having caused significant economic losses to the swine industry. PCV2 recombinant adenovirus vector vaccines have been studied, such as unmodified PCV2 recombinant adenovirus vector vaccine Ad-Cap, but no corresponding commercial PCV2 recombinant adenovirus vector vaccine has been applied in clinical practice. The analysis reason results in that: the adenovirus vector self-protein can induce the organism to generate strong immune response reaction, and the immune response reaction of the organism aiming at the target protein is seriously influenced.
Disclosure of Invention
The invention aims to provide a secretory porcine circovirus type 2 recombinant adenovirus and a construction method thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
a secretory porcine circovirus type 2 recombinant adenovirus shuttle vector is an adenovirus shuttle plasmid inserted with a target gene segment, the target gene segment comprises a secretory protein coding region and an expression enhancing element, the expression enhancing element comprises a first Intron Intron A of human cytomegalovirus and a post-transcriptional regulatory element WPRE of woodchuck hepatitis virus, the secretory protein coding region comprises a tumor necrosis factor-related activator protein CD40L sequence with a secretory signal peptide sp, a porcine circovirus type 2capsid protein Cap sequence with a secretory signal peptide sp and a granulocyte-cytomegalo colony stimulating factor GMCSF sequence with a secretory signal peptide sp, and the CD40L, Cap and GMCSF are co-expressed.
The secretory protein coding region also includes a sequence of self-cleaving 2A peptide disposed between each of the CD40L, Cap, and GMCSF sequences.
The recombinant adenovirus shuttle vector specifically comprises a promoter, a target gene segment, a polyA tail, a left homologous arm sequence and a right homologous arm sequence which are sequentially arranged.
The construction method of the secretory porcine circovirus type 2 recombinant adenovirus shuttle vector comprises the following steps:
1) construction of a Gene fragment of interest
1.1) respectively amplifying the three fragments of the CD40L sequence, the Cap sequence and the GMCSF sequence, connecting the three fragments by using overlap PCR to obtain an intermediate fragment, wherein a sequence of self-cutting 2A peptide is inserted between any two fragments;
1.2) connecting the intermediate fragment with Intron A and WPRE sequences to obtain a target gene fragment;
2) cloning the target gene segment into adenovirus shuttle plasmid.
The step 1.1) specifically comprises the following steps:
1.1.1) using PS-CD40L-Cap-GMCSF plasmid as amplification template, respectively amplifying by primers P1 and P2, P3 and P4, and P7 and P8 to obtain sp-CD40L-2A-sp fragment containing CD40L sequence, sp-Cap-2A-sp fragment containing PCV2Cap sequence and sp-GMCSF fragment containing GMCSF sequence; the sequence of P1 is shown as SEQ.I D.NO.1, the sequence of P2 is shown as SEQ.ID.NO.2, the sequence of P3 is shown as SEQ.ID.NO.3, the sequence of P4 is shown as SEQ.ID.NO.4, the sequence of P7 is shown as SEQ.ID.NO.7, and the sequence of P8 is shown as SEQ.ID.NO. 8;
1.1.2) performing overlapped PCR on an sp-CD40L-2A-sp fragment and an sp-Cap-2A-sp fragment through primers P5 and P6 to obtain an sp-CD40L-2A-sp-Cap-2A-sp fragment, and performing overlapped PCR on the sp-CD40L-2A-sp-Cap-2A-sp fragment and an sp-GMCSF fragment through primers P5 and P8 to obtain an intermediate fragment sp-CD40L-2A-sp-Cap-2A-s P-GMCSF; the sequence of P5 is shown in SEQ.ID.NO.5, and the sequence of P6 is shown in SEQ.ID.NO. 6.
The step 1.2) specifically comprises the following steps: replacing the Cap sequence in the puc-Intron A-Cap-WPRE plasmid with the intermediate fragment (such as sp-CD40L-2A-sp-Cap-2A-sp-GMCSF) to obtain an amplification template, and then amplifying by using primers P9 and P10 to obtain a target gene fragment Intron A-sp-CD 40L-2A-sp-Cap-2A-sp-GMCSF-WPRE; the sequence of P9 is shown in SEQ.ID.NO.9, and the sequence of P10 is shown in SEQ.ID.NO. 10.
The step 2) specifically comprises the following steps: the gene fragment of interest was inserted into the multiple cloning site of the adenovirus shuttle plasmid pShuttle-C MV.
The recombinant adenovirus is obtained by adenovirus packaging by using recombinant adenovirus plasmid, wherein the recombinant adenovirus plasmid is formed by homologous recombination of the shuttle vector and an adenovirus skeleton vector of the secretory porcine circovirus type 2 recombinant adenovirus.
The sequence of the recombinant adenovirus plasmid is shown in SEQ ID No. 11.
The secretory porcine circovirus type 2 recombinant adenovirus shuttle vector is used for preparing porcine circovirus type 2 genetic engineering vaccines.
The invention has the beneficial effects that:
according to the invention, Intron A and WPRE are added into an adenovirus vector, so that the capsid protein (Cap) expression quantity is improved; the CD40L and the GMCSF are introduced simultaneously, and a secretory signal peptide is added, so that the CD40L, Cap and GMCSF can be co-expressed and secreted out of cells, and can be better and faster recognized by antigen presenting cells. The secretory PCV2 recombinant adenovirus constructed by the method combines two different action mechanisms, and can enhance the immunogenicity of the adenovirus vector vaccine.
Drawings
FIG. 1 shows the result of PCR identification of pShuttle-A-spCD 40L-spCap-spGMCSF-W; lane 1: pShuttle-A-spCD 40L-spCap-spGMCSF-W; lane 2: negative control (pShuttle-CMV); lane 3: 2K Plus Ma rker.
FIG. 2 is a photograph of HEK293 cells infected with recombinant adenovirus Ad-A-spCD40L-spCap-spGMCSF-W for 48 h; a: Ad-A-spCD 40L-spCap-spGMCSF-W; b: normal cell control.
FIG. 3 shows the result of Ad-A-spCD40L-spCap-spGMCSF-W western blotting; a: rabbit anti-Cap primary antibody; b: rabbit anti-CD 40L primary antibody; c: rabbit anti-GMCSF primary antibody; lane 1: Ad-A-spCD40L-spCap-spG MCSF-W; lane 2: ad-blank; lane 3: normal cells.
FIG. 4 is a schematic diagram showing the construction of the adenoviral shuttle vector pShuttle-A-spCD 40L-spCap-spGMCSF-W; a: pShuttle-CMV map; b: a restriction enzyme cutting site distribution diagram on a pShuttle-CMV Multiple Cloning Site (MCS); c: schematic representation of the insertion position of fragment A-spCD40L-spCap-spGMCSF-W on the adenoviral shuttle vector.
FIG. 5 is a map of the recombinant adenovirus vector pAd-A-spCD 40L-spCap-spGMCSF-W.
FIG. 6 shows the result of detecting the level of PCV2 specific antibody of the recombinant adenovirus immunized pig; the Ad-Cap immunised group and Ad-a-spCD40L-spCap-spGMCSF-W immunised group represented the same time points were significantly different (p < 0.05).
FIG. 7 shows the results of detecting the level of neutralizing antibodies in pigs immunized with recombinant adenovirus; the Ad-Cap immunised group and Ad-a-spCD40L-spCap-spGMCSF-W immunised group represented the same time points were significantly different (p < 0.05).
FIG. 8 shows the result of detecting the lymphocyte proliferation level of the pig immunized with the recombinant adenovirus; the Ad-Cap immunised group and Ad-a-spCD40L-spCap-spGMCSF-W immunised group represented the same time points were significantly different (p < 0.05).
FIG. 9 shows the result of detecting the secretion levels of IFN-. gamma.A and IL-13(B) in pigs immunized with recombinant adenovirus; the Ad-Cap immunised group and Ad-a-spCD40L-spCap-spGMCSF-W immunised group represented the same time points were significantly different (p < 0.05).
FIG. 10 shows the result of the virus load detection of the serum of the immunized pig with the recombinant adenovirus after challenge; Ad-Cap immunization group and Ad-A-spCD40L-spCap-spGMCSF-W immunization group representing the same time point were significantly different (p<0.05), the real-time fluorescent quantitative PCR detection sensitivity is 103Number of copies/ml.
Detailed Description
The present invention will be described in further detail with reference to the accompanying drawings and examples.
Adenovirus vectors are one of the most widely used live virus vectors because of their advantages of high transduction efficiency, wide host cell range, and the ability to infect cells at different stages. However, since the adenovirus self-protein (mainly adenovirus penton protein and hexon protein) can induce the host to generate strong immune response reaction, the application of the vaccine in clinical practice is limited, and how to reduce the autoimmune response reaction becomes a key scientific problem which must be solved for the large-scale application of the recombinant adenovirus vector vaccine.
The invention increases PCV2Cap expression quantity by adding human cytomegalovirus first Intron (Intron A) and woodchuck hepatitis virus transcription regulation and control element (WPRE) into adenovirus vector; tumor necrosis factor-related activator protein (TRAP/CD 40L) and granulocyte-macrophage colony stimulating factor (GMC SF) are introduced at the same time, and porcine IL-2 secretion signal peptide (sp) is added at the N ends of CD40L, Cap and GMCSF respectively, so that CD40L, Cap and GMCSF can be secreted out of cells and better and faster recognized by antigen presenting cells, and porcine foot-and-mouth disease virus 2A sequences are added at the C ends of CD40L and Cap so that 3 proteins can be cleaved by 2A protease to avoid forming fusion protein, thereby constructing secretory PCV2 recombinant Ad-A-spCD 40L-spCap-spGMCSF-W. Combining two different action mechanisms, the immunogenicity of the adenovirus vector vaccine is enhanced.
The secretory PCV2 recombinant adenovirus Ad-A-spCD40L-spCap-spGMCSF-W is constructed by the following steps:
cloning of target Gene A-spCD40L-spCap-spGMCSF-W
1. Amplification primers for sp-CD40L-2A-sp, sp-Cap-2A-sp, and sp-CD40L-2A-sp-Cap-2A-sp were designed.
sp-CD40L-2A-sp upstream primer P1: 5' -AATTCTAGA ATGATCGAAACGTACAGC-3 '(the underlined part at the 5' end is the Xba I restriction enzyme cutting site, and the italic part is the secretion signal peptide sequence); the downstream primer P2: 5' - GGGTCCAGGGTTGGACTCAA-3 '(the 5' italic part is a secretion signal peptide sequence);
sp-Cap-2A-sp upstream primer P3: AATGGCTTTTTCAACAGCCG-3 '(the 5' italic part is a secretion signal peptide sequence); the downstream primer P4: 5' - GGGTCCAGGGTTGGACTCAA-3 '(the 5' italic part is a secretion signal peptide sequence);
sp-CD40L-2A-sp-Cap-2A-sp upstream primer P5: 5' -AATTCTAGAATGTATAAGATGCAGCTCTTG-3 '(the underlined part at the 5' end is the Xba I restriction enzyme cutting site); the downstream primer P6: 5'-ACCGTTTGCCATGAGTGCAAGGGTTAGTG-3' are provided.
2. Using PS-CD40L-Cap-GMCSF plasmid (constructed and stored by the laboratory, and constructed references: Delon gLi et al, CD40 Ligand and GMCSF Coexpression and engineering of Immune and protective Efficacy of PCV2 Adenoviral Vaccine, VIRAL IMMUNOLOGY 2016, volume e29, Pp.148-158, DOI10.1089/vim.2015.0109) as template, and using primers P1 and P2 to amplify sp-CD40L-2A-sp (fragment size is 954 bp); the sp-Cap-2A-sp (fragment size 750bp) was amplified with primers P3 and P4. sp-CD40L-2A-sp-Cap-2A-sp (fragment size 1644bp) was amplified by overlap PCR using sp-CD40L-2A-sp and sp-Cap-2A-sp as templates and primers P5 and P6. The amplification system is shown in Table 1, and the reaction conditions are shown in Table 2.
TABLE 1 PCR reaction System
TABLE 2 PCR reaction conditions
3. Designing gene sp-GMCSF amplification primer. sp-GMCSF upstream primer P7: 5' TATGTGGCTGCAGAACCTGCT-3 '(the 5' italic part is a secretion signal peptide sequence); the downstream primer P8: 5' -ATTGTCGACTTACTTT TTGAC-3 '(the underlined part at the 5' end is the Sal I restriction enzyme cleavage site).
4. Using PS-CD40L-Cap-GMCSF plasmid as template, and using primers P7 and P8 to amplify sp-GMCSF (fragment size is 495 bp); sp-CD40L-2A-sp-Cap-2A-sp-GMCSF (fragment size: 2079bp) was amplified by overlap PCR using sp-CD40L-2A-sp-Cap-2A-sp and sp-GMCSF as templates and primers P5 and P8. The amplification system and PCR reaction conditions are shown in tables 1 and 2.
After recovering sp-CD40L-2A-sp-Cap-2A-sp-GMCSF (2079 bp fragment size), Xba I and Sal I by double digestion of sp-CD40L-2A-sp-Cap-2A-sp-GMCSF and puc-Intron A-Cap-WPRE plasmid (constructed and stored in the laboratory, see D.L.LI et al, Modified recombinant adenovirus expression gene expression and expression gene, Acvirology 60:271, 280,2016, doi10.4149/av _ 2016-03-271) by nucleic acid electrophoresis, they were linked by T4DN A ligase at 16 ℃ and transformed into Escherichia coli competent 5 α (Beijing university DH 37 ℃, Onco culture incubator overnight culture, Inc.)+Screening plate resistance, selecting a monoclonal, shaking the bacteria for 12h by a constant temperature shaking table (LB culture medium) at 220rpm and 37 ℃, extracting plasmids by using a plasmid extraction kit, carrying out PCR (polymerase chain reaction) and enzyme digestion (Xba I and Sal I) identification on the bacteria liquid to carry out sequencing (4110bp and 2079bp) after the bacteria liquid is identified to be correct, and naming the bacteria liquid as puc-A-spCD40L-spCap-spG MCSF-W (i.e., replacement of the original Cap sequence in puc-Intron A-Cap-WPRE with a fragment of sp-CD 40L-2A-sp-Cap-2A-sp-GMCSF). Wherein the electrophoresis condition is 120V and 30 min; see table 3 for the double cleavage system and table 4 for the ligation system.
TABLE 3 double enzyme digestion System
TABLE 4 connection system
Secondly, construction of shuttle vector pShuttle-A-spCD40L-spCap-spGMCSF-W
A-spCD40L-spCap-spGMCSF-W (fragment size 3479bp, i.e., Intron A-sp-CD40L-2A-sp-Cap-2A-sp-GMCSF-WPRE) was amplified by PCR using puc-A-spCD40L-spCap-spGMCSF-W plasmid as a template. The primers used were respectively the upstream primer P9: 5' -AATCTCGAGGTAAGTACCGC CTATAGACT CTATAGGCAC-3 '(the underlined part at the 5' end is the Xho I restriction enzyme cutting site); the downstream primer P10: 5' -TCAGATATCGCCCAAAGGGAGATCCGACTC-3'(5' underlined part is EcoR V restriction enzyme cutting site). The PCR amplification system is shown in Table 1, and the reaction conditions are shown in Table 2.
Referring to FIG. 4, after the A-spCD40L-spCap-spGMCSF-W PCR product was recovered using a gel recovery kit, the A-spCD40L-spCap-spGMCSF-W and pShuttle-CM V (Agilent Technologies, Inc., 7.5kb) were double digested with restriction enzymes Xho I and EcoRV, and then the gene of interest A-spCD40L-spCap-spGMCSF-W (gene of interest) was ligated to pShuttle-CMV, transformed E.coli competent DH5a, cultured overnight at 37 ℃, and Kana was cultured+Screening plate resistance, picking single clone, shaking the bacteria for 12h at 37 ℃, extracting plasmids by a plasmid extraction kit, carrying out enzyme digestion identification on the extracted plasmids by using bacterial liquid PCR and Xho I and EcoR V, carrying out sequencing on the plasmids after accurate identification (7500bp and 3500 bp, shown in figure 1) by Nanjing Kingshi Biotech limited company, and naming the plasmids as pShuttle-A-spCD40L-spCap-spGMCSF-W after accurate sequencing, namely the plasmids in pShuttle-CMVIn the multiple cloning site, Intron A, sp, CD40L, 2A, sp, PCV2Cap, 2A, sp, GMC SF and WPRE are inserted in turn by using Xho I and Eco R V at the downstream of CMV, and SV40polyA is inserted at the downstream of the insertion position. The double-restriction system (except for the endonuclease) is shown in Table 3, and the ligation system is shown in Table 4.
Thirdly, packaging of recombinant adenovirus Ad-A-spCD40L-spCap-spGMCSF-W
After linearization of pShuttle-A-spCD40L-spCap-spGMCSF-W with restriction enzyme Pme I, homologous recombination (homologus recombination) was carried out with the backbone vector AdEasy-1(Agilent Technologies) in BJ5183 strain competent cells (Agilent Technologies), Kana+Screening plate resistance, selecting positive clones, extracting plasmids, carrying out bacterial liquid PCR and Pac I enzyme digestion identification (about 30000bp and about 5000bp) on correct plasmids, and naming the plasmids as pAd-A-spCD40L-spCap-spGMCSF-W (figure 5). The plasmid mass extraction kit extracts plasmids and determines the concentration of the plasmids.
Linearization: the enzyme digestion of pAd-A-spCD40L-spCap-spGMCSF-W is carried out by Pac I, and the plasmid after the enzyme digestion is recovered by a nucleic acid gel recovery kit.
HEK293 cells (Agilent Technologies) were cultured in DMEM medium containing 10% FBS and plated evenly on 24-well plates at approximately 5X 10 cells per well 1d before transfection4And (4) respectively. After 24h plating, according to LipofectamineTM2000 the transfection kit operation shows, using liposome method to transfect HEK293 cells with recombinant adenovirus vector pAd-A-spCD40L-spCap-spGMC SF-W, the specific transfection method is as follows: (1) the linearized recombinant adenovirus plasmid is dissolved in 50 mu L of serum-free and antibiotic-free plasmidMixing with Medium culture solution, and incubating at room temperature for 5 min; (2) adding an appropriate amount of LipofectamineTM2000 dissolved in 50. mu.L serum-free antibiotic-freeMixing in Medium culture solution, and incubating at room temperature for 5 min; (3) mixing the above two mixtures (total volume 100 μ L), mixing gently, and incubating at room temperature for 20min (no spray precipitation); (4) the above operationsAt the same time, the cells to be transfected were washed twice with PBS and 100. mu.L of serum-free and antibiotic-free medium was added to each well (24-well plates)Adding the Medium culture solution into the cell hole to be transfected immediately after mixing the DNA plasmid/Lipofectamine compound for 20min, mixing uniformly, and then placing the cell at 37 ℃ and 5% CO2Culturing in a cell culture box, changing into DMEM cell culture solution containing 2% FBS after about 4h, continuing culturing, and regularly observing the growth condition of the cells by using a microscope. And (3) collecting cells after 7-10 days of transfection, transferring the cells into a 15mL centrifuge tube, repeatedly freezing and thawing the cells for 3 times to lyse the cells, performing short-time centrifugation, collecting adenovirus supernatant (namely supernatant obtained by centrifugation), namely the 1 st generation recombinant adenovirus, preserving at-80 ℃, and naming the recombinant adenovirus as Ad-A-spCD 40L-spCap-spGMCSF-W.
Fourth, recombinant adenovirus Ad-A-spCD40L-spCap-spGMCSF-W western blotting identification
The titer of the 1 st generation recombinant adenovirus is low, and continuous passage is needed to propagate the virus (the virus propagation process is shown in Chinese patent 201610164590.0), and the continuous passage is realized. HEK293 cells were infected with Ad-A-spCD40L-spCap-spGMCSF-W generation 5 and Ad-blank vector adenovirus (blank vector adenovirus control) for about 48h to develop cytopathic effects (FIG. 2) and cell supernatants were harvested (supernatants from centrifugation).
1. Determination of cell supernatant protein concentration
The albumin content of the cell supernatant was determined using the Bradford assay protein quantification kit. The specific method comprises the following steps: respectively adding 0 mu L, 1 mu L, 2 mu L, 4 mu L, 6 mu L, 8 mu L and 10 mu L of protein standard solution L mg/mL into No. 0-6 wells of a 96-well plate, and then respectively adding 100 mu L, 99 mu L, 98 mu L, 96 mu L, 94 mu L, 92 mu L and 90 mu L of deionized water into No. 0-6 wells. Meanwhile, 100. mu.L of the 10-fold diluted protein sample to be tested was added to the other well. And adding 100 mu L of Coomassie brilliant blue G-250 dye solution into each hole, shaking and uniformly mixing, and standing at room temperature for 10 min. The absorbance at 595n m wavelength was measured with a microplate reader, and wells No. 0 were used as blank controls. And determining the concentration of the protein sample to be detected according to a standard curve equation.
SDS-PAGE electrophoresis
The collected cell supernatants of normal HEK293 cells, recombinant adenovirus Ad-A-spCD40L-spCap-spGMCSF-W and Ad-blank infected HEK293 cells were mixed with 5 Xloading buffer at l:4, and boiled at 100 ℃ for 10min on a micro-thermostat. Boiled protein samples were added to the wells in sequence, pre-stained with a protein Marker control. And (3) starting electrophoresis at a constant voltage of 90V for about 30min, changing the voltage to 120V when the bromophenol blue reaches the boundary line between the concentrated gel and the separation gel, and stopping electrophoresis until the bromophenol blue reaches a distance of about 1cm from the bottom of the separation gel.
3. Rotary film
According to the size of the gel, 6 qualitative filter papers and one PVDF membrane were cut with gloves, marked, and immersed in the transfer buffer together with the sponge. And marking the cut corners of the glue. The following sequence is sequentially carried out: sponge-filter paper (3 sheets) -film-glue-filter paper (3 sheets) -sponge are stacked and precisely aligned to ensure no air bubbles. Then, the membrane was immersed in a transfer buffer solution, and the membrane was connected to the positive electrode and the gel was connected to the negative electrode, and the membrane was transferred at 300mA for 1.5 hours. Turning off power supply, taking out membrane, and drying the membrane protein surface in air for 30 min.
4. Antibody incubation
After the membrane transfer was complete, the membrane was removed and washed 5 times in PBST and the PVDF membrane l h was blocked with 5% skim milk powder on a shaker at room temperature. After blocking was complete, wash 3 times with PBST for 5min each. The rabbit anti-Cap, rabbit anti-CD 40L and rabbit anti-GMCSF primary antibodies were diluted in PBS on blocked PVDF membranes, incubated overnight at 4 ℃ and washed 3 times with PBST, 10min each. HRP-labeled goat anti-rabbit secondary antibody (1: 10000) was diluted with PBS and incubated at room temperature for 1h, and washed 3 times with PBST.
5. Chemiluminescence, development
Mixing ECL color developing solution A and B on preservative film according to the equal volume of 1:1, fully contacting the mixed solution for 1min with the membrane protein surface facing downwards, transferring the film to another preservative film, packaging, and placing in a cassette. Color development is carried out in a dark room, so that the background is prevented from being too heavy. And after the color development is finished, photographing the film. As shown in FIG. 3, it can be seen that CD40L, Cap and GMCSF can all be expressed, and the conclusion is that the construction of the secretory PCV2 recombinant adenovirus Ad-A-spCD40L-spCap-spGMCSF-W is successful.
The recombinant adenovirus packaging process and the adenovirus propagation process are vaccine preparation processes, and the vaccine purification process is shown in Chinese patent 201610164590.0.
Fifth, evaluation of vaccine immunization effect
5.1 grouping of Experimental animals
25 weaned piglets of 28 days old are divided into 5 groups with the weight of 5.5 +/-0.8 kg, and the weaned piglets are separately fed, wherein each group has 5 piglets. The commercial ELISA kit detects no PCV2, PPV, PRRSV and CSFV antibodies, and PCR detects no PCV2, PP V, PRRSV and CSFV viremia. Group 1 intramuscular injection 1011TCID50Recombinant adenovirus Ad-Cap. Group 2 intramuscular injection 1010TCID50Recombinant adenovirus Ad-A-spCD 40L-spCap-spGMCSF-W. Group 3 intramuscular injection 1010TCID50Empty vector adenovirus Ad-blank. Group 4 was the PBS group. Group 5 was blank control group (untreated controlled). 2w later 1 booster immunization with the same dose. 28 days after immunization, groups 1-5 nose-drop toxin-attacking PCV25 multiplied by 105TCID50. Pigs were sacrificed 70d after the first immunization. Blood was collected 1 time every 7d after primary immunization, and the specific antibody level and the neutralizing antibody level were determined. At 28d after the first immunization, peripheral blood lymphocytes of the pigs were isolated, and the proliferation level of the lymphocytes and the level of cytokines were measured. Viral load was tested 1 time every 7d, starting 28d after the primary immunization.
5.2 results
5.2.1 specific antibody levels
Referring to fig. 6, commercial ELISA kits detected PCV2 Cap-specific antibody levels from 0d after primary immunization to 70d after primary immunization. After the primary immunization, the specific antibodies in the Ad-Cap immunization group and the Ad-A-spCD40L-spCap-spGMCSF-W immunization group turned positive 14d, and the peak was reached at 35d after the primary immunization. The Ad-A-spCD40L-spCap-spGMCSF-W immune group specific antibody was significantly higher after 14d after one-to 70d after one-immunization than in the Ad-Cap immune group (p < 0.05).
5.2.2 neutralizing antibody levels
Referring to FIG. 7, neutralizing antibodies were positive in the Ad-Cap immunization group and Ad-A-spCD40L-spCap-spGMCSF-W immunization group 14d after the primary immunization, and the peak was reached at 35d after the primary immunization. The neutralizing antibody of the Ad-A-spC D40L-spCap-spGMCSF-W immune group was significantly higher from 21D after one-immunization to 70D after one-immunization (p < 0.05).
5.2.3 lymphocyte proliferation level
Referring to fig. 8, the level of peripheral blood lymphocyte proliferation was measured for each group of pigs 28d after the first immunization. The proliferation level of lymphocytes in the Ad-A-spCD40L-spCap-spGMCSF-W immune group is remarkably higher than that in the Ad-Cap immune group (p < 0.05).
5.2.4 cytokine levels
Referring to FIG. 9, each group of proliferating lymphocytes was assayed for IFN-. gamma.and IL-13 secretion 28d after the primary immunization. The IFN-gamma and IL-13 secretion amount of the Ad-A-spCD40L-spCap-spGMCSF-W immune group is remarkably higher than that of the Ad-Cap immune group (p < 0.05).
5.2.5 viral load detection
Referring to fig. 10, levels of viral load in serum were measured 28d after one-immunization to 70d after one-immunization. No PCV2 was detected in each group of sera 28d after the primary immunization. The viral load was significantly lower in the Ad-A-spCD40L-spCap-spGMCS F-W immunization group than in the Ad-Cap immunization group (p <0.05) 42d after the primary immunization and 49d after the primary immunization.
From the above, it follows that the immunogenicity of recombinant adenovirus Ad-A-spCD40L-spCap-spGMCSF-W against PCV2 is enhanced (compared to the use of non-secretory PCV2Cap only), despite the fact that the virus titer used for immunization is one order of magnitude lower.
5.3 results of other experiments
The invention also compares two other groups of recombinant adenovirus Ad-A-spCap-W, Ad-A-CD40L-Cap-GMCSF-W with recombinant adenovirus Ad-A-spCD 40L-spCap-spGMCSF-W. Under the same virus titer, the immune effect (specific antibody level, neutralizing antibody level, lymphocyte proliferation level, cytokine level and virus load) of the Ad-A-spCD40L-spCap-spGMCSF-W is obviously better than that of the Ad-A-spCap-W, Ad-A-CD40L-Cap-GMC SF-W, and the Ad-Cap has no obvious difference with the Ad-A-spCap-W, Ad-A-CD 40L-Cap-GMCSF-W. The invention has the following advantages:
intron A as a gene transcription regulatory element, together with hCMV (human cytomegalovirus) promoter (CMV on pShuttle-CMV), increases the expression level of a target gene. The WPRE can enhance gene expression efficiency by improving mRNA stability, 3' end processing, promoting mRNA nuclear and cytoplasmic mRNA accumulation. The addition of Intron A and WPRE into an adenovirus vector can increase the expression level of PCV2Cap, thereby reducing the immune dose of the adenovirus vaccine without influencing the immune effect against Cap protein.
Intron A and WPRE can improve protein expression quantity, and CD40L and GMCSF can perform immune regulation, and the patent mainly solves the problem of how to give full play to the advantages of the Intron A and WPRE, so that the problem of enhancing the immune effect of the recombinant adenovirus can be realized by combining two different mechanisms. From the experimental result 5.2, it is proved that the recombinant adenovirus Ad-A-spCD40L-spCap-spGMC SF-W indeed solves the problem, and further combining with the experimental result 5.3, it can be seen that in order to combine two different action mechanisms to induce stronger immune response reaction; after the recombinant adenovirus enters a host cell, the expressed CD40L and GMCSF are secreted to the outside of the cell to better exert the immune regulation function, and the Cap secreted to the outside of the cell can be better recognized by an antigen presenting cell, so that the enhanced immune effect is realized.
<110> northwest agriculture and forestry science and technology university
<120> secretory porcine circovirus 2 type recombinant adenovirus and construction method thereof
<160>11
<210>1
<211>87
<212>DNA
<213> primer P1
<400>1
aattctagaa tgtataagat gcagctcttg tgttgcattg cactaaccct tgcactcatg 60
gcaaacggta tgatcgaaac gtacagc 87
<210>2
<211>80
<212>DNA
<213> primer P2
<400>2
accgtttgcc atgagtgcaa gggttagtgc aatgcaacac aagagctgcatcttatacat 60
gggtccaggg ttggactcaa 80
<210>3
<211>80
<212>DNA
<213> primer P3
<400>3
atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60
aatggctttt tcaacagccg 80
<210>4
<211>80
<212>DNA
<213> primer P4
<400>4
accgtttgcc atgagtgcaa gggttagtgc aatgcaacac aagagctgcatcttatacat 60
gggtccaggg ttggactcaa 80
<210>5
<211>30
<212>DNA
<213> primer P5
<400>5
aattctagaa tgtataagat gcagctcttg 30
<210>6
<211>29
<212>DNA
<213> primer P6
<400>6
accgtttgcc atgagtgcaa gggttagtg 29
<210>7
<211>80
<212>DNA
<213> primer P7
<400>7
atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60
atgtggctgc agaacctgct 80
<210>8
<211>21
<212>DNA
<213> primer P8
<400>8
attgtcgact tactttttga c 21
<210>9
<211>39
<212>DNA
<213> primer P9
<400>9
aatctcgagg taagtaccgc ctatagactc tataggcac 39
<210>10
<211>30
<212>DNA
<213> primer P10
<400>10
tcagatatcg cccaaaggga gatccgactc 30
<210>11
<211>37670
<212>DNA
<213>pAd-A-spCD40L-spCap-spGMCSF-W
<400>11
nnnttaatta annntccctt ccagctctct gccccttttg gattgaagcc aatatgataa 60
tgagggggtg gagtttgtga cgtggcgcgg ggcgtgggaa cggggcgggt gacgtagtag 120
tgtggcggaa gtgtgatgtt gcaagtgtgg cggaacacat gtaagcgacg gatgtggcaa 180
aagtgacgtt tttggtgtgc gccggtgtac acaggaagtg acaattttcg cgcggtttta 240
ggcggatgtt gtagtaaatt tgggcgtaac cgagtaagat ttggccattt tcgcgggaaa 300
actgaataag aggaagtgaa atctgaataa ttttgtgtta ctcatagcgc gtaannnnta 360
atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 420
acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 480
aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 540
gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 600
ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 660
atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 720
gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 780
tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 840
aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 900
ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagagat ctggtaccgt 960
cgacgcggcc gctcgaggta agtaccgcct atagactcta taggcacacc cctttggctc 1020
ttatgcatgc tatactgttt ttggcttggg gcctatacac ccccgctcct tatgctatag 1080
gtgatggtat agcttagcct ataggtgtgg gttattgacc attattgacc actcccctat 1140
tggtgacgat actttccatt actaatccat aacatggctc tttgccacaa ctatctctat 1200
tggctatatg ccaatactct gtccttcaga gactgacacg gactctgtat ttttacagga 1260
tggggtccca tttattattt acaaattcac atatacaaca acgccgtccc ccgtgcccgc 1320
agtttttatt aaacatagcg tgggatctcc acgcgaatct cgggtacgtg ttccggacat 1380
gggctcttct ccggtagcgg cggagcttcc acatccgagc cctggtccca tgcctccagc 1440
ggctcatggt cgctcggcag ctccttgctc ctaacagtgg aggccagact taggcacagc 1500
acaatgccca ccaccaccag tgtgccgcac aaggccgtgg cggtagggta tgtgtctgaa 1560
aatgagctcg gagattgggc tcgcaccgtg acgcagatgg aagacttaag gcagcggcag 1620
aagaagatgc aggcagctga gttgttgtat tctgataaga gtcagaggta actcccgttg 1680
cggtgctgtt aacggtggag ggcagtgtag tctgagcagt actcgttgct gccgcgcgcg 1740
ccaccagaca taatagctga cagactaaca gactgttcct ttccatgggt cttttctgca 1800
gatgtataag atgcagctct tgtgttgcat tgcactaacc cttgcactca tggcaaacgg 1860
tatgatcgaa acgtacagcc aaccttcgcc ccgctctgtg gccgctggac cacccgtcag 1920
tatgaaaatc tttatgtatt tacttactgt ttttcttatc acccagatga ttgggtcagc 1980
actttttgca gcgtaccttc acagaagatt ggacaagata gaagatgaaa ggaatcttca 2040
tgaagatttt gtgttcataa aaacgataca gagatgcaag caaggagagg ggtccttatc 2100
cttattgaac tgtgaggaaa tcagaagcca gtttgaagac ctggtcaagg gtataatgca 2160
aagcaaagaa gtgaagaaga aagaaaaaag ctttgaaatg cacaaaggcg atcaggatcc 2220
tcaaattgcg gcacatgtca taagcgaggc cagtagtaaa acagcatctg tcctgcagtg 2280
ggcccccaaa gggtactaca ccctcagcac caacttggtg accctggaaa acgggagaca 2340
gctggccgtc aaaagacaag gaatctatta catctacgcc caagtcacct tctgctccaa 2400
ccgggacgcc gcgggtcaag ctcccttcat agccagcctc tgcctgaggt ccccaagcgg 2460
gtcggagaga atcttactcc gcgcggccaa cacccacagt tcctccaagc cctgcgggca 2520
gcaatccatt cacttgggcg gagtcttcga gttgcaaccc ggcgcttcgg tgttcgtcaa 2580
cgtgactgat ccaagccaag tgagccacgg gaccggcttc acgtcttttg gcctcctcaa 2640
actcaacttt gaccttctca agttggcagg ggacgttgag tccaaccctg gacccatgta 2700
taagatgcag ctcttgtgtt gcattgcact aacccttgca ctcatggcaa acggtaatgg 2760
ctttttcaac agccgcctct cccgcacctt cggatatact gtcaaggcta ccacagtcac 2820
aacgccctcc ggggcggggg acatgctcaa atttaatatt gacgactttc ttccccgggg 2880
aggggggacc aacaaaatct ctataccctt tgaatactac aaaataaaaa aggttaaggt 2940
tgaattctgg ccctgctccc caatcaccca gggggacagg ggagttggat ccagtgctgt 3000
tattctaaat gataattttt tccctaagtc cacagcccta acctatgacc cctacgtaaa 3060
ctactcctcc cgccatacca taccccagcc cttctcctac cactcccggt actttacccc 3120
caaacctgtc cttgattcca ccattgatta cttccaaccg aataacaaaa gaaatcagct 3180
gtggatgaaa attcaaacca gtaaaaatgt aaaccacgta ggcctcggca ctgcgttcga 3240
aaacagtaaa tacaaccagg actacaatat ctgtgtaacc atgtatgtac aattcagaga 3300
atttaatctg aaagaccccc cactaaaacc caactttgac cttctcaagt tggcagggga 3360
cgttgagtcc aaccctggac ccatgtataa gatgcagctc ttgtgttgca ttgcactaac 3420
ccttgcactc atggcaaacg gtatgtggct gcagaacctg cttctcctgg gcactgtggt 3480
ctgcagcatc tccgctccca cccgcccacc cagccctgtc acccggccct ggcagcatgt 3540
ggatgccatc aaagaagccc tgagccttct aaacaacagt aatgacacag cggctgtgat 3600
gaatgaaacc gtagacgtcg tctgtgaaat gtttgacccc caggagccga catgcgtgca 3660
gactcgcctg aacctgtaca agcagggcct gcggggcagc ctcactaggc tcaagagccc 3720
cttgactctg ttggccaagc actatgagca gcactgcccc ctcaccgagg aaacttcctg 3780
tgaaacccag tctatcacct tcaaaagttt caaagacagt ctgaacaaat ttctttttac 3840
catccccttt gactgctggg ggccagtcaa aaagtaatca acctctggat tacaaaattt 3900
gtgaaagatt gactggtatt cttaactatg ttgctccttt tacgctatgt ggatacgctg 3960
ctttaatgcc tttgtatcat gctattgctt cccgtatggc tttcattttc tcctccttgt 4020
ataaatcctg gttgctgtct ctttatgagg agttgtggcc cgttgtcagg caacgtggcg 4080
tggtgtgcac tgtgtttgct gacgcaaccc ccactggttg gggcattgcc accacctgtc 4140
agctcctttc cgggactttc gctttccccc tccctattgc cacggcggaa ctcatcgccg 4200
cctgccttgc ccgctgctgg acaggggctc ggctgttggg cactgacaat tccgtggtgt 4260
tgtcggggaa gctgacgtcc tttccatggc tgctcgcctg tgttgccacc tggattctgc 4320
gcgggacgtc cttctgctac gtcccttcgg ccctcaatcc agcggacctt ccttcccgcg 4380
gcctgctgcc ggctctgcgg cctcttccgc gtcttcgcct tcgccctcag acgagtcgga 4440
tctccctttg ggcgatatcc gatccaccgg atctagataa ctgatcataa tcagccatac 4500
cacatttgta gaggttttac ttgctttaaa aaacctccca cacctccccc tgaacctgaa 4560
acataaaatg aatgcaattg ttgttgttaa cttgtttatt gcagcttata atggttacaa 4620
ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg 4680
tggtttgtcc aaactcatca atgtatctta acgcnnnnta agggtgggaa agaatatata 4740
aggtgggggt cttatgtagt tttgtatctg ttttgcagca gccgccgccg ccatgagcac 4800
caactcgttt gatggaagca ttgtgagctc atatttgaca acgcgcatgc ccccatgggc 4860
cggggtgcgt cagaatgtga tgggctccag cattgatggt cgccccgtcc tgcccgcaaa 4920
ctctactacc ttgacctacg agaccgtgtc tggaacgccg ttggagactg cagcctccgc 4980
cgccgcttca gccgctgcag ccaccgcccg cgggattgtg actgactttg ctttcctgag 5040
cccgcttgca agcagtgcag cttcccgttc atccgcccgc gatgacaagt tgacggctct 5100
tttggcacaa ttggattctt tgacccggga acttaatgtc gtttctcagc agctgttgga 5160
tctgcgccag caggtttctg ccctgaaggc ttcctcccct cccaatgcgg tttaaaacat 5220
aaataaaaaa ccagactctg tttggatttg gatcaagcaa gtgtcttgct gtctttattt 5280
aggggttttg cgcgcgcggt aggcccggga ccagcggtct cggtcgttga gggtcctgtg 5340
tattttttcc aggacgtggt aaaggtgact ctggatgttc agatacatgg gcataagccc 5400
gtctctgggg tggaggtagc accactgcag agcttcatgc tgcggggtgg tgttgtagat 5460
gatccagtcg tagcaggagc gctgggcgtg gtgcctaaaa atgtctttca gtagcaagct 5520
gattgccagg ggcaggccct tggtgtaagt gtttacaaag cggttaagct gggatgggtg 5580
catacgtggg gatatgagat gcatcttgga ctgtattttt aggttggcta tgttcccagc 5640
catatccctc cggggattca tgttgtgcag aaccaccagc acagtgtatc cggtgcactt 5700
gggaaatttg tcatgtagct tagaaggaaa tgcgtggaag aacttggaga cgcccttgtg 5760
acctccaaga ttttccatgc attcgtccat aatgatggca atgggcccac gggcggcggc 5820
ctgggcgaag atatttctgg gatcactaac gtcatagttg tgttccagga tgagatcgtc 5880
ataggccatt tttacaaagc gcgggcggag ggtgccagac tgcggtataa tggttccatc 5940
cggcccaggg gcgtagttac cctcacagat ttgcatttcc cacgctttga gttcagatgg 6000
ggggatcatg tctacctgcg gggcgatgaa gaaaacggtt tccggggtag gggagatcag 6060
ctgggaagaa agcaggttcc tgagcagctg cgacttaccg cagccggtgg gcccgtaaat 6120
cacacctatt accgggtgca actggtagtt aagagagctg cagctgccgt catccctgag 6180
caggggggcc acttcgttaa gcatgtccct gactcgcatg ttttccctga ccaaatccgc 6240
cagaaggcgc tcgccgccca gcgatagcag ttcttgcaag gaagcaaagt ttttcaacgg 6300
tttgagaccg tccgccgtag gcatgctttt gagcgtttga ccaagcagtt ccaggcggtc 6360
ccacagctcg gtcacctgct ctacggcatc tcgatccagc atatctcctc gtttcgcggg 6420
ttggggcggc tttcgctgta cggcagtagt cggtgctcgt ccagacgggc cagggtcatg 6480
tctttccacg ggcgcagggt cctcgtcagc gtagtctggg tcacggtgaa ggggtgcgct 6540
ccgggctgcg cgctggccag ggtgcgcttg aggctggtcc tgctggtgct gaagcgctgc 6600
cggtcttcgc cctgcgcgtc ggccaggtag catttgacca tggtgtcata gtccagcccc 6660
tccgcggcgt ggcccttggc gcgcagcttg cccttggagg aggcgccgca cgaggggcag 6720
tgcagacttt tgagggcgta gagcttgggc gcgagaaata ccgattccgg ggagtaggca 6780
tccgcgccgc aggccccgca gacggtctcg cattccacga gccaggtgag ctctggccgt 6840
tcggggtcaa aaaccaggtt tcccccatgc tttttgatgc gtttcttacc tctggtttcc 6900
atgagccggt gtccacgctc ggtgacgaaa aggctgtccg tgtccccgta tacagactnn 6960
ngtttaaacg aattcnnnat ataaaatgca aggcttgggc gcgagaaata ccgattccgg 7020
ggagtaggca tccgcgccgc aggccccgca gacggtctcg cattccacga gccaggtgag 7080
ctctggccgt tcggggtcaa aaaccaggtt tcccccatgc tttttgatgc gtttcttacc 7140
tctggtttcc atgagccggt gtccacgctc ggtgacgaaa aggctgtccg tgtccccgta 7200
tacagacttg agaggcctgt cctcgagcgg tgttccgcgg tcctcctcgt atagaaactc 7260
ggaccactct gagacaaagg ctcgcgtcca ggccagcacg aaggaggcta agtgggaggg 7320
gtagcggtcg ttgtccacta gggggtccac tcgctccagg gtgtgaagac acatgtcgcc 7380
ctcttcggca tcaaggaagg tgattggttt gtaggtgtag gccacgtgac cgggtgttcc 7440
tgaagggggg ctataaaagg gggtgggggc gcgttcgtcc tcactctctt ccgcatcgct 7500
gtctgcgagg gccagctgtt ggggtgagta ctccctctga aaagcgggca tgacttctgc 7560
gctaagattg tcagtttcca aaaacgagga ggatttgata ttcacctggc ccgcggtgat 7620
gcctttgagg gtggccgcat ccatctggtc agaaaagaca atctttttgt tgtcaagctt 7680
ggtggcaaac gacccgtaga gggcgttgga cagcaacttg gcgatggagc gcagggtttg 7740
gtttttgtcg cgatcggcgc gctccttggc cgcgatgttt agctgcacgt attcgcgcgc 7800
aacgcaccgc cattcgggaa agacggtggt gcgctcgtcg ggcaccaggt gcacgcgcca 7860
accgcggttg tgcagggtga caaggtcaac gctggtggct acctctccgc gtaggcgctc 7920
gttggtccag cagaggcggc cgcccttgcg cgagcagaat ggcggtaggg ggtctagctg 7980
cgtctcgtcc ggggggtctg cgtccacggt aaagaccccg ggcagcaggc gcgcgtcgaa 8040
gtagtctatc ttgcatcctt gcaagtctag cgcctgctgc catgcgcggg cggcaagcgc 8100
gcgctcgtat gggttgagtg ggggacccca tggcatgggg tgggtgagcg cggaggcgta 8160
catgccgcaa atgtcgtaaa cgtagagggg ctctctgagt attccaagat atgtagggta 8220
gcatcttcca ccgcggatgc tggcgcgcac gtaatcgtat agttcgtgcg agggagcgag 8280
gaggtcggga ccgaggttgc tacgggcggg ctgctctgct cggaagacta tctgcctgaa 8340
gatggcatgt gagttggatg atatggttgg acgctggaag acgttgaagc tggcgtctgt 8400
gagacctacc gcgtcacgca cgaaggaggc gtaggagtcg cgcagcttgt tgaccagctc 8460
ggcggtgacc tgcacgtcta gggcgcagta gtccagggtt tccttgatga tgtcatactt 8520
atcctgtccc ttttttttcc acagctcgcg gttgaggaca aactcttcgc ggtctttcca 8580
gtactcttgg atcggaaacc cgtcggcctc cgaacggtaa gagcctagca tgtagaactg 8640
gttgacggcc tggtaggcgc agcatccctt ttctacgggt agcgcgtatg cctgcgcggc 8700
cttccggagc gaggtgtggg tgagcgcaaa ggtgtccctg accatgactt tgaggtactg 8760
gtatttgaag tcagtgtcgt cgcatccgcc ctgctcccag agcaaaaagt ccgtgcgctt 8820
tttggaacgc ggatttggca gggcgaaggt gacatcgttg aagagtatct ttcccgcgcg 8880
aggcataaag ttgcgtgtga tgcggaaggg tcccggcacc tcggaacggt tgttaattac 8940
ctgggcggcg agcacgatct cgtcaaagcc gttgatgttg tggcccacaa tgtaaagttc 9000
caagaagcgc gggatgccct tgatggaagg caatttttta agttcctcgt aggtgagctc 9060
ttcaggggag ctgagcccgt gctctgaaag ggcccagtct gcaagatgag ggttggaagc 9120
gacgaatgag ctccacaggt cacgggccat tagcatttgc aggtggtcgc gaaaggtcct 9180
aaactggcga cctatggcca ttttttctgg ggtgatgcag tagaaggtaa gcgggtcttg 9240
ttcccagcgg tcccatccaa ggttcgcggc taggtctcgc gcggcagtca ctagaggctc 9300
atctccgccg aacttcatga ccagcatgaa gggcacgagc tgcttcccaa aggcccccat 9360
ccaagtatag gtctctacat cgtaggtgac aaagagacgc tcggtgcgag gatgcgagcc 9420
gatcgggaag aactggatct cccgccacca attggaggag tggctattga tgtggtgaaa 9480
gtagaagtcc ctgcgacggg ccgaacactc gtgctggctt ttgtaaaaac gtgcgcagta 9540
ctggcagcgg tgcacgggct gtacatcctg cacgaggttg acctgacgac cgcgcacaag 9600
gaagcagagt gggaatttga gcccctcgcc tggcgggttt ggctggtggt cttctacttc 9660
ggctgcttgt ccttgaccgt ctggctgctc gaggggagtt acggtggatc ggaccaccac 9720
gccgcgcgag cccaaagtcc agatgtccgc gcgcggcggt cggagcttga tgacaacatc 9780
gcgcagatgg gagctgtcca tggtctggag ctcccgcggc gtcaggtcag gcgggagctc 9840
ctgcaggttt acctcgcata gacgggtcag ggcgcgggct agatccaggt gatacctaat 9900
ttccaggggc tggttggtgg cggcgtcgat ggcttgcaag aggccgcatc cccgcggcgc 9960
gactacggta ccgcgcggcg ggcggtgggc cgcgggggtg tccttggatg atgcatctaa 10020
aagcggtgac gcgggcgagc ccccggaggt agggggggct ccggacccgc cgggagaggg 10080
ggcaggggca cgtcggcgcc gcgcgcgggc aggagctggt gctgcgcgcg taggttgctg 10140
gcgaacgcga cgacgcggcg gttgatctcc tgaatctggc gcctctgcgt gaagacgacg 10200
ggcccggtga gcttgagcct gaaagagagt tcgacagaat caatttcggt gtcgttgacg 10260
gcggcctggc gcaaaatctc ctgcacgtct cctgagttgt cttgataggc gatctcggcc 10320
atgaactgct cgatctcttc ctcctggaga tctccgcgtc cggctcgctc cacggtggcg 10380
gcgaggtcgt tggaaatgcg ggccatgagc tgcgagaagg cgttgaggcc tccctcgttc 10440
cagacgcggc tgtagaccac gcccccttcg gcatcgcggg cgcgcatgac cacctgcgcg 10500
agattgagct ccacgtgccg ggcgaagacg gcgtagtttc gcaggcgctg aaagaggtag 10560
ttgagggtgg tggcggtgtg ttctgccacg aagaagtaca taacccagcg tcgcaacgtg 10620
gattcgttga tatcccccaa ggcctcaagg cgctccatgg cctcgtagaa gtccacggcg 10680
aagttgaaaa actgggagtt gcgcgccgac acggttaact cctcctccag aagacggatg 10740
agctcggcga cagtgtcgcg cacctcgcgc tcaaaggcta caggggcctc ttcttcttct 10800
tcaatctcct cttccataag ggcctcccct tcttcttctt ctggcggcgg tgggggaggg 10860
gggacacggc ggcgacgacg gcgcaccggg aggcggtcga caaagcgctc gatcatctcc 10920
ccgcggcgac ggcgcatggt ctcggtgacg gcgcggccgt tctcgcgggg gcgcagttgg 10980
aagacgccgc ccgtcatgtc ccggttatgg gttggcgggg ggctgccatg cggcagggat 11040
acggcgctaa cgatgcatct caacaattgt tgtgtaggta ctccgccgcc gagggacctg 11100
agcgagtccg catcgaccgg atcggaaaac ctctcgagaa aggcgtctaa ccagtcacag 11160
tcgcaaggta ggctgagcac cgtggcgggc ggcagcgggc ggcggtcggg gttgtttctg 11220
gcggaggtgc tgctgatgat gtaattaaag taggcggtct tgagacggcg gatggtcgac 11280
agaagcacca tgtccttggg tccggcctgc tgaatgcgca ggcggtcggc catgccccag 11340
gcttcgtttt gacatcggcg caggtctttg tagtagtctt gcatgagcct ttctaccggc 11400
acttcttctt ctccttcctc ttgtcctgca tctcttgcat ctatcgctgc ggcggcggcg 11460
gagtttggcc gtaggtggcg ccctcttcct cccatgcgtg tgaccccgaa gcccctcatc 11520
ggctgaagca gggctaggtc ggcgacaacg cgctcggcta atatggcctg ctgcacctgc 11580
gtgagggtag actggaagtc atccatgtcc acaaagcggt ggtatgcgcc cgtgttgatg 11640
gtgtaagtgc agttggccat aacggaccag ttaacggtct ggtgacccgg ctgcgagagc 11700
tcggtgtacc tgagacgcga gtaagccctc gagtcaaata cgtagtcgtt gcaagtccgc 11760
accaggtact ggtatcccac caaaaagtgc ggcggcggct ggcggtagag gggccagcgt 11820
agggtggccg gggctccggg ggcgagatct tccaacataa ggcgatgata tccgtagatg 11880
tacctggaca tccaggtgat gccggcggcg gtggtggagg cgcgcggaaa gtcgcggacg 11940
cggttccaga tgttgcgcag cggcaaaaag tgctccatgg tcgggacgct ctggccggtc 12000
aggcgcgcgc aatcgttgac gctctaccgt gcaaaaggag agcctgtaag cgggcactct 12060
tccgtggtct ggtggataaa ttcgcaaggg tatcatggcg gacgaccggg gttcgagccc 12120
cgtatccggc cgtccgccgt gatccatgcg gttaccgccc gcgtgtcgaa cccaggtgtg 12180
cgacgtcaga caacggggga gtgctccttt tggcttcctt ccaggcgcgg cggctgctgc 12240
gctagctttt ttggccactg gccgcgcgca gcgtaagcgg ttaggctgga aagcgaaagc 12300
attaagtggc tcgctccctg tagccggagg gttattttcc aagggttgag tcgcgggacc 12360
cccggttcga gtctcggacc ggccggactg cggcgaacgg gggtttgcct ccccgtcatg 12420
caagaccccg cttgcaaatt cctccggaaa cagggacgag cccctttttt gcttttccca 12480
gatgcatccg gtgctgcggc agatgcgccc ccctcctcag cagcggcaag agcaagagca 12540
gcggcagaca tgcagggcac cctcccctcc tcctaccgcg tcaggagggg cgacatccgc 12600
ggttgacgcg gcagcagatg gtgattacga acccccgcgg cgccgggccc ggcactacct 12660
ggacttggag gagggcgagg gcctggcgcg gctaggagcg ccctctcctg agcggtaccc 12720
aagggtgcag ctgaagcgtg atacgcgtga ggcgtacgtg ccgcggcaga acctgtttcg 12780
cgaccgcgag ggagaggagc ccgaggagat gcgggatcga aagttccacg cagggcgcga 12840
gctgcggcat ggcctgaatc gcgagcggtt gctgcgcgag gaggactttg agcccgacgc 12900
gcgaaccggg attagtcccg cgcgcgcaca cgtggcggcc gccgacctgg taaccgcata 12960
cgagcagacg gtgaaccagg agattaactt tcaaaaaagc tttaacaacc acgtgcgtac 13020
gcttgtggcg cgcgaggagg tggctatagg actgatgcat ctgtgggact ttgtaagcgc 13080
gctggagcaa aacccaaata gcaagccgct catggcgcag ctgttcctta tagtgcagca 13140
cagcagggac aacgaggcat tcagggatgc gctgctaaac atagtagagc ccgagggccg 13200
ctggctgctc gatttgataa acatcctgca gagcatagtg gtgcaggagc gcagcttgag 13260
cctggctgac aaggtggccg ccatcaacta ttccatgctt agcctgggca agttttacgc 13320
ccgcaagata taccataccc cttacgttcc catagacaag gaggtaaaga tcgaggggtt 13380
ctacatgcgc atggcgctga aggtgcttac cttgagcgac gacctgggcg tttatcgcaa 13440
cgagcgcatc cacaaggccg tgagcgtgag ccggcggcgc gagctcagcg accgcgagct 13500
gatgcacagc ctgcaaaggg ccctggctgg cacgggcagc ggcgatagag aggccgagtc 13560
ctactttgac gcgggcgctg acctgcgctg ggccccaagc cgacgcgccc tggaggcagc 13620
tggggccgga cctgggctgg cggtggcacc cgcgcgcgct ggcaacgtcg gcggcgtgga 13680
ggaatatgac gaggacgatg agtacgagcc agaggacggc gagtactaag cggtgatgtt 13740
tctgatcaga tgatgcaaga cgcaacggac ccggcggtgc gggcggcgct gcagagccag 13800
ccgtccggcc ttaactccac ggacgactgg cgccaggtca tggaccgcat catgtcgctg 13860
actgcgcgca atcctgacgc gttccggcag cagccgcagg ccaaccggct ctccgcaatt 13920
ctggaagcgg tggtcccggc gcgcgcaaac cccacgcacg agaaggtgct ggcgatcgta 13980
aacgcgctgg ccgaaaacag ggccatccgg cccgacgagg ccggcctggt ctacgacgcg 14040
ctgcttcagc gcgtggctcg ttacaacagc ggcaacgtgc agaccaacct ggaccggctg 14100
gtgggggatg tgcgcgaggc cgtggcgcag cgtgagcgcg cgcagcagca gggcaacctg 14160
ggctccatgg ttgcactaaa cgccttcctg agtacacagc ccgccaacgt gccgcgggga 14220
caggaggact acaccaactt tgtgagcgca ctgcggctaa tggtgactga gacaccgcaa 14280
agtgaggtgt accagtctgg gccagactat tttttccaga ccagtagaca aggcctgcag 14340
accgtaaacc tgagccaggc tttcaaaaac ttgcaggggc tgtggggggt gcgggctccc 14400
acaggcgacc gcgcgaccgt gtctagcttg ctgacgccca actcgcgcct gttgctgctg 14460
ctaatagcgc ccttcacgga cagtggcagc gtgtcccggg acacatacct aggtcacttg 14520
ctgacactgt accgcgaggc cataggtcag gcgcatgtgg acgagcatac tttccaggag 14580
attacaagtg tcagccgcgc gctggggcag gaggacacgg gcagcctgga ggcaacccta 14640
aactacctgc tgaccaaccg gcggcagaag atcccctcgt tgcacagttt aaacagcgag 14700
gaggagcgca ttttgcgcta cgtgcagcag agcgtgagcc ttaacctgat gcgcgacggg 14760
gtaacgccca gcgtggcgct ggacatgacc gcgcgcaaca tggaaccggg catgtatgcc 14820
tcaaaccggc cgtttatcaa ccgcctaatg gactacttgc atcgcgcggc cgccgtgaac 14880
cccgagtatt tcaccaatgc catcttgaac ccgcactggc taccgccccc tggtttctac 14940
accgggggat tcgaggtgcc cgagggtaac gatggattcc tctgggacga catagacgac 15000
agcgtgtttt ccccgcaacc gcagaccctg ctagagttgc aacagcgcga gcaggcagag 15060
gcggcgctgc gaaaggaaag cttccgcagg ccaagcagct tgtccgatct aggcgctgcg 15120
gccccgcggt cagatgctag tagcccattt ccaagcttga tagggtctct taccagcact 15180
cgcaccaccc gcccgcgcct gctgggcgag gaggagtacc taaacaactc gctgctgcag 15240
ccgcagcgcg aaaaaaacct gcctccggca tttcccaaca acgggataga gagcctagtg 15300
gacaagatga gtagatggaa gacgtacgcg caggagcaca gggacgtgcc aggcccgcgc 15360
ccgcccaccc gtcgtcaaag gcacgaccgt cagcggggtc tggtgtggga ggacgatgac 15420
tcggcagacg acagcagcgt cctggatttg ggagggagtg gcaacccgtt tgcgcacctt 15480
cgccccaggc tggggagaat gttttaaaaa aaaaaaagca tgatgcaaaa taaaaaactc 15540
accaaggcca tggcaccgag cgttggtttt cttgtattcc ccttagtatg cggcgcgcgg 15600
cgatgtatga ggaaggtcct cctccctcct acgagagtgt ggtgagcgcg gcgccagtgg 15660
cggcggcgct gggttctccc ttcgatgctc ccctggaccc gccgtttgtg cctccgcggt 15720
acctgcggcc taccgggggg agaaacagca tccgttactc tgagttggca cccctattcg 15780
acaccacccg tgtgtacctg gtggacaaca agtcaacgga tgtggcatcc ctgaactacc 15840
agaacgacca cagcaacttt ctgaccacgg tcattcaaaa caatgactac agcccggggg 15900
aggcaagcac acagaccatc aatcttgacg accggtcgca ctggggcggc gacctgaaaa 15960
ccatcctgca taccaacatg ccaaatgtga acgagttcat gtttaccaat aagtttaagg 16020
cgcgggtgat ggtgtcgcgc ttgcctacta aggacaatca ggtggagctg aaatacgagt 16080
gggtggagtt cacgctgccc gagggcaact actccgagac catgaccata gaccttatga 16140
acaacgcgat cgtggagcac tacttgaaag tgggcagaca gaacggggtt ctggaaagcg 16200
acatcggggt aaagtttgac acccgcaact tcagactggg gtttgacccc gtcactggtc 16260
ttgtcatgcc tggggtatat acaaacgaag ccttccatcc agacatcatt ttgctgccag 16320
gatgcggggt ggacttcacc cacagccgcc tgagcaactt gttgggcatc cgcaagcggc 16380
aacccttcca ggagggcttt aggatcacct acgatgatct ggagggtggt aacattcccg 16440
cactgttgga tgtggacgcc taccaggcga gcttgaaaga tgacaccgaa cagggcgggg 16500
gtggcgcagg cggcagcaac agcagtggca gcggcgcgga agagaactcc aacgcggcag 16560
ccgcggcaat gcagccggtg gaggacatga acgatcatgc cattcgcggc gacacctttg 16620
ccacacgggc tgaggagaag cgcgctgagg ccgaagcagc ggccgaagct gccgcccccg 16680
ctgcgcaacc cgaggtcgag aagcctcaga agaaaccggt gatcaaaccc ctgacagagg 16740
acagcaagaa acgcagttac aacctaataa gcaatgacag caccttcacc cagtaccgca 16800
gctggtacct tgcatacaac tacggcgacc ctcagaccgg aatccgctca tggaccctgc 16860
tttgcactcc tgacgtaacc tgcggctcgg agcaggtcta ctggtcgttg ccagacatga 16920
tgcaagaccc cgtgaccttc cgctccacgc gccagatcag caactttccg gtggtgggcg 16980
ccgagctgtt gcccgtgcac tccaagagct tctacaacga ccaggccgtc tactcccaac 17040
tcatccgcca gtttacctct ctgacccacg tgttcaatcg ctttcccgag aaccagattt 17100
tggcgcgccc gccagccccc accatcacca ccgtcagtga aaacgttcct gctctcacag 17160
atcacgggac gctaccgctg cgcaacagca tcggaggagt ccagcgagtg accattactg 17220
acgccagacg ccgcacctgc ccctacgttt acaaggccct gggcatagtc tcgccgcgcg 17280
tcctatcgag ccgcactttt tgagcaagca tgtccatcct tatatcgccc agcaataaca 17340
caggctgggg cctgcgcttc ccaagcaaga tgtttggcgg ggccaagaag cgctccgacc 17400
aacacccagt gcgcgtgcgc gggcactacc gcgcgccctg gggcgcgcac aaacgcggcc 17460
gcactgggcg caccaccgtc gatgacgcca tcgacgcggt ggtggaggag gcgcgcaact 17520
acacgcccac gccgccacca gtgtccacag tggacgcggc cattcagacc gtggtgcgcg 17580
gagcccggcg ctatgctaaa atgaagagac ggcggaggcg cgtagcacgt cgccaccgcc 17640
gccgacccgg cactgccgcc caacgcgcgg cggcggccct gcttaaccgc gcacgtcgca 17700
ccggccgacg ggcggccatg cgggccgctc gaaggctggc cgcgggtatt gtcactgtgc 17760
cccccaggtc caggcgacga gcggccgccg cagcagccgc ggccattagt gctatgactc 17820
agggtcgcag gggcaacgtg tattgggtgc gcgactcggt tagcggcctg cgcgtgcccg 17880
tgcgcacccg ccccccgcgc aactagattg caagaaaaaa ctacttagac tcgtactgtt 17940
gtatgtatcc agcggcggcg gcgcgcaacg aagctatgtc caagcgcaaa atcaaagaag 18000
agatgctcca ggtcatcgcg ccggagatct atggcccccc gaagaaggaa gagcaggatt 18060
acaagccccg aaagctaaag cgggtcaaaa agaaaaagaa agatgatgat gatgaacttg 18120
acgacgaggt ggaactgctg cacgctaccg cgcccaggcg acgggtacag tggaaaggtc 18180
gacgcgtaaa acgtgttttg cgacccggca ccaccgtagt ctttacgccc ggtgagcgct 18240
ccacccgcac ctacaagcgc gtgtatgatg aggtgtacgg cgacgaggac ctgcttgagc 18300
aggccaacga gcgcctcggg gagtttgcct acggaaagcg gcataaggac atgctggcgt 18360
tgccgctgga cgagggcaac ccaacaccta gcctaaagcc cgtaacactg cagcaggtgc 18420
tgcccgcgct tgcaccgtcc gaagaaaagc gcggcctaaa gcgcgagtct ggtgacttgg 18480
cacccaccgt gcagctgatg gtacccaagc gccagcgact ggaagatgtc ttggaaaaaa 18540
tgaccgtgga acctgggctg gagcccgagg tccgcgtgcg gccaatcaag caggtggcgc 18600
cgggactggg cgtgcagacc gtggacgttc agatacccac taccagtagc accagtattg 18660
ccaccgccac agagggcatg gagacacaaa cgtccccggt tgcctcagcg gtggcggatg 18720
ccgcggtgca ggcggtcgct gcggccgcgt ccaagacctc tacggaggtg caaacggacc 18780
cgtggatgtt tcgcgtttca gccccccggc gcccgcgcgg ttcgaggaag tacggcgccg 18840
ccagcgcgct actgcccgaa tatgccctac atccttccat tgcgcctacc cccggctatc 18900
gtggctacac ctaccgcccc agaagacgag caactacccg acgccgaacc accactggaa 18960
cccgccgccg ccgtcgccgt cgccagcccg tgctggcccc gatttccgtg cgcagggtgg 19020
ctcgcgaagg aggcaggacc ctggtgctgc caacagcgcg ctaccacccc agcatcgttt 19080
aaaagccggt ctttgtggtt cttgcagata tggccctcac ctgccgcctc cgtttcccgg 19140
tgccgggatt ccgaggaaga atgcaccgta ggaggggcat ggccggccac ggcctgacgg 19200
gcggcatgcg tcgtgcgcac caccggcggc ggcgcgcgtc gcaccgtcgc atgcgcggcg 19260
gtatcctgcc cctccttatt ccactgatcg ccgcggcgat tggcgccgtg cccggaattg 19320
catccgtggc cttgcaggcg cagagacact gattaaaaac aagttgcatg tggaaaaatc 19380
aaaataaaaa gtctggactc tcacgctcgc ttggtcctgt aactattttg tagaatggaa 19440
gacatcaact ttgcgtctct ggccccgcga cacggctcgc gcccgttcat gggaaactgg 19500
caagatatcg gcaccagcaa tatgagcggt ggcgccttca gctggggctc gctgtggagc 19560
ggcattaaaa atttcggttc caccgttaag aactatggca gcaaggcctg gaacagcagc 19620
acaggccaga tgctgaggga taagttgaaa gagcaaaatt tccaacaaaa ggtggtagat 19680
ggcctggcct ctggcattag cggggtggtg gacctggcca accaggcagt gcaaaataag 19740
attaacagta agcttgatcc ccgccctccc gtagaggagc ctccaccggc cgtggagaca 19800
gtgtctccag aggggcgtgg cgaaaagcgt ccgcgccccg acagggaaga aactctggtg 19860
acgcaaatag acgagcctcc ctcgtacgag gaggcactaa agcaaggcct gcccaccacc 19920
cgtcccatcg cgcccatggc taccggagtg ctgggccagc acacacccgt aacgctggac 19980
ctgcctcccc ccgccgacac ccagcagaaa cctgtgctgc caggcccgac cgccgttgtt 20040
gtaacccgtc ctagccgcgc gtccctgcgc cgcgccgcca gcggtccgcg atcgttgcgg 20100
cccgtagcca gtggcaactg gcaaagcaca ctgaacagca tcgtgggtct gggggtgcaa 20160
tccctgaagc gccgacgatg cttctgaata gctaacgtgt cgtatgtgtg tcatgtatgc 20220
gtccatgtcg ccgccagagg agctgctgag ccgccgcgcg cccgctttcc aagatggcta 20280
ccccttcgat gatgccgcag tggtcttaca tgcacatctc gggccaggac gcctcggagt 20340
acctgagccc cgggctggtg cagtttgccc gcgccaccga gacgtacttc agcctgaata 20400
acaagtttag aaaccccacg gtggcgccta cgcacgacgt gaccacagac cggtcccagc 20460
gtttgacgct gcggttcatc cctgtggacc gtgaggatac tgcgtactcg tacaaggcgc 20520
ggttcaccct agctgtgggt gataaccgtg tgctggacat ggcttccacg tactttgaca 20580
tccgcggcgt gctggacagg ggccctactt ttaagcccta ctctggcact gcctacaacg 20640
ccctggctcc caagggtgcc ccaaatcctt gcgaatggga tgaagctgct actgctcttg 20700
aaataaacct agaagaagag gacgatgaca acgaagacga agtagacgag caagctgagc 20760
agcaaaaaac tcacgtattt gggcaggcgc cttattctgg tataaatatt acaaaggagg 20820
gtattcaaat aggtgtcgaa ggtcaaacac ctaaatatgc cgataaaaca tttcaacctg 20880
aacctcaaat aggagaatct cagtggtacg aaactgaaat taatcatgca gctgggagag 20940
tccttaaaaa gactacccca atgaaaccat gttacggttc atatgcaaaa cccacaaatg 21000
aaaatggagg gcaaggcatt cttgtaaagc aacaaaatgg aaagctagaa agtcaagtgg 21060
aaatgcaatt tttctcaact actgaggcga ccgcaggcaa tggtgataac ttgactccta 21120
aagtggtatt gtacagtgaa gatgtagata tagaaacccc agacactcat atttcttaca 21180
tgcccactat taaggaaggt aactcacgag aactaatggg ccaacaatct atgcccaaca 21240
ggcctaatta cattgctttt agggacaatt ttattggtct aatgtattac aacagcacgg 21300
gtaatatggg tgttctggcg ggccaagcat cgcagttgaa tgctgttgta gatttgcaag 21360
acagaaacac agagctttca taccagcttt tgcttgattc cattggtgat agaaccaggt 21420
acttttctat gtggaatcag gctgttgaca gctatgatcc agatgttaga attattgaaa 21480
atcatggaac tgaagatgaa cttccaaatt actgctttcc actgggaggt gtgattaata 21540
cagagactct taccaaggta aaacctaaaa caggtcagga aaatggatgg gaaaaagatg 21600
ctacagaatt ttcagataaa aatgaaataa gagttggaaa taattttgcc atggaaatca 21660
atctaaatgc caacctgtgg agaaatttcc tgtactccaa catagcgctg tatttgcccg 21720
acaagctaaa gtacagtcct tccaacgtaa aaatttctga taacccaaac acctacgact 21780
acatgaacaa gcgagtggtg gctcccgggt tagtggactg ctacattaac cttggagcac 21840
gctggtccct tgactatatg gacaacgtca acccatttaa ccaccaccgc aatgctggcc 21900
tgcgctaccg ctcaatgttg ctgggcaatg gtcgctatgt gcccttccac atccaggtgc 21960
ctcagaagtt ctttgccatt aaaaacctcc ttctcctgcc gggctcatac acctacgagt 22020
ggaacttcag gaaggatgtt aacatggttc tgcagagctc cctaggaaat gacctaaggg 22080
ttgacggagc cagcattaag tttgatagca tttgccttta cgccaccttc ttccccatgg 22140
cccacaacac cgcctccacg cttgaggcca tgcttagaaa cgacaccaac gaccagtcct 22200
ttaacgacta tctctccgcc gccaacatgc tctaccctat acccgccaac gctaccaacg 22260
tgcccatatc catcccctcc cgcaactggg cggctttccg cggctgggcc ttcacgcgcc 22320
ttaagactaa ggaaacccca tcactgggct cgggctacga cccttattac acctactctg 22380
gctctatacc ctacctagat ggaacctttt acctcaacca cacctttaag aaggtggcca 22440
ttacctttga ctcttctgtc agctggcctg gcaatgaccg cctgcttacc cccaacgagt 22500
ttgaaattaa gcgctcagtt gacggggagg gttacaacgt tgcccagtgt aacatgacca 22560
aagactggtt cctggtacaa atgctagcta actacaacat tggctaccag ggcttctata 22620
tcccagagag ctacaaggac cgcatgtact ccttctttag aaacttccag cccatgagcc 22680
gtcaggtggt ggatgatact aaatacaagg actaccaaca ggtgggcatc ctacaccaac 22740
acaacaactc tggatttgtt ggctaccttg cccccaccat gcgcgaagga caggcctacc 22800
ctgctaactt cccctatccg cttataggca agaccgcagt tgacagcatt acccagaaaa 22860
agtttctttg cgatcgcacc ctttggcgca tcccattctc cagtaacttt atgtccatgg 22920
gcgcactcac agacctgggc caaaaccttc tctacgccaa ctccgcccac gcgctagaca 22980
tgacttttga ggtggatccc atggacgagc ccacccttct ttatgttttg tttgaagtct 23040
ttgacgtggt ccgtgtgcac cggccgcacc gcggcgtcat cgaaaccgtg tacctgcgca 23100
cgcccttctc ggccggcaac gccacaacat aaagaagcaa gcaacatcaa caacagctgc 23160
cgccatgggc tccagtgagc aggaactgaa agccattgtc aaagatcttg gttgtgggcc 23220
atattttttg ggcacctatg acaagcgctt tccaggcttt gtttctccac acaagctcgc 23280
ctgcgccata gtcaatacgg ccggtcgcga gactgggggc gtacactgga tggcctttgc 23340
ctggaacccg cactcaaaaa catgctacct ctttgagccc tttggctttt ctgaccagcg 23400
actcaagcag gtttaccagt ttgagtacga gtcactcctg cgccgtagcg ccattgcttc 23460
ttcccccgac cgctgtataa cgctggaaaa gtccacccaa agcgtacagg ggcccaactc 23520
ggccgcctgt ggactattct gctgcatgtt tctccacgcc tttgccaact ggccccaaac 23580
tcccatggat cacaacccca ccatgaacct tattaccggg gtacccaact ccatgctcaa 23640
cagtccccag gtacagccca ccctgcgtcg caaccaggaa cagctctaca gcttcctgga 23700
gcgccactcg ccctacttcc gcagccacag tgcgcagatt aggagcgcca cttctttttg 23760
tcacttgaaa aacatgtaaa aataatgtac tagagacact ttcaataaag gcaaatgctt 23820
ttatttgtac actctcgggt gattatttac ccccaccctt gccgtctgcg ccgtttaaaa 23880
atcaaagggg ttctgccgcg catcgctatg cgccactggc agggacacgt tgcgatactg 23940
gtgtttagtg ctccacttaa actcaggcac aaccatccgc ggcagctcgg tgaagttttc 24000
actccacagg ctgcgcacca tcaccaacgc gtttagcagg tcgggcgccg atatcttgaa 24060
gtcgcagttg gggcctccgc cctgcgcgcg cgagttgcga tacacagggt tgcagcactg 24120
gaacactatc agcgccgggt ggtgcacgct ggccagcacg ctcttgtcgg agatcagatc 24180
cgcgtccagg tcctccgcgt tgctcagggc gaacggagtc aactttggta gctgccttcc 24240
caaaaagggc gcgtgcccag gctttgagtt gcactcgcac cgtagtggca tcaaaaggtg 24300
accgtgcccg gtctgggcgt taggatacag cgcctgcata aaagccttga tctgcttaaa 24360
agccacctga gcctttgcgc cttcagagaa gaacatgccg caagacttgc cggaaaactg 24420
attggccgga caggccgcgt cgtgcacgca gcaccttgcg tcggtgttgg agatctgcac 24480
cacatttcgg ccccaccggt tcttcacgat cttggccttg ctagactgct ccttcagcgc 24540
gcgctgcccg ttttcgctcg tcacatccat ttcaatcacg tgctccttat ttatcataat 24600
gcttccgtgt agacacttaa gctcgccttc gatctcagcg cagcggtgca gccacaacgc 24660
gcagcccgtg ggctcgtgat gcttgtaggt cacctctgca aacgactgca ggtacgcctg 24720
caggaatcgc cccatcatcg tcacaaaggt cttgttgctg gtgaaggtca gctgcaaccc 24780
gcggtgctcc tcgttcagcc aggtcttgca tacggccgcc agagcttcca cttggtcagg 24840
cagtagtttg aagttcgcct ttagatcgtt atccacgtggtacttgtcca tcagcgcgcg 24900
cgcagcctcc atgcccttct cccacgcaga cacgatcggc acactcagcg ggttcatcac 24960
cgtaatttca ctttccgctt cgctgggctc ttcctcttcc tcttgcgtcc gcataccacg 25020
cgccactggg tcgtcttcat tcagccgccg cactgtgcgc ttacctcctt tgccatgctt 25080
gattagcacc ggtgggttgc tgaaacccac catttgtagc gccacatctt ctctttcttc 25140
ctcgctgtcc acgattacct ctggtgatgg cgggcgctcg ggcttgggag aagggcgctt 25200
ctttttcttc ttgggcgcaa tggccaaatc cgccgccgag gtcgatggcc gcgggctggg 25260
tgtgcgcggc accagcgcgt cttgtgatga gtcttcctcg tcctcggact cgatacgccg 25320
cctcatccgc ttttttgggg gcgcccgggg aggcggcggc gacggggacg gggacgacac 25380
gtcctccatg gttgggggac gtcgcgccgc accgcgtccg cgctcggggg tggtttcgcg 25440
ctgctcctct tcccgactgg ccatttcctt ctcctatagg cagaaaaaga tcatggagtc 25500
agtcgagaag aaggacagcc taaccgcccc ctctgagttc gccaccaccg cctccaccga 25560
tgccgccaac gcgcctacca ccttccccgt cgaggcaccc ccgcttgagg aggaggaagt 25620
gattatcgag caggacccag gttttgtaag cgaagacgac gaggaccgct cagtaccaac 25680
agaggataaa aagcaagacc aggacaacgc agaggcaaac gaggaacaag tcgggcgggg 25740
ggacgaaagg catggcgact acctagatgt gggagacgac gtgctgttga agcatctgca 25800
gcgccagtgc gccattatct gcgacgcgtt gcaagagcgc agcgatgtgc ccctcgccat 25860
agcggatgtc agccttgcct acgaacgcca cctattctca ccgcgcgtac cccccaaacg 25920
ccaagaaaac ggcacatgcg agcccaaccc gcgcctcaac ttctaccccg tatttgccgt 25980
gccagaggtg cttgccacct atcacatctt tttccaaaac tgcaagatac ccctatcctg 26040
ccgtgccaac cgcagccgag cggacaagca gctggccttg cggcagggcg ctgtcatacc 26100
tgatatcgcc tcgctcaacg aagtgccaaa aatctttgag ggtcttggac gcgacgagaa 26160
gcgcgcggca aacgctctgc aacaggaaaa cagcgaaaat gaaagtcact ctggagtgtt 26220
ggtggaactc gagggtgaca acgcgcgcct agccgtacta aaacgcagca tcgaggtcac 26280
ccactttgcc tacccggcac ttaacctacc ccccaaggtc atgagcacag tcatgagtga 26340
gctgatcgtg cgccgtgcgc agcccctgga gagggatgca aatttgcaag aacaaacaga 26400
ggagggccta cccgcagttg gcgacgagca gctagcgcgc tggcttcaaa cgcgcgagcc 26460
tgccgacttg gaggagcgac gcaaactaat gatggccgca gtgctcgtta ccgtggagct 26520
tgagtgcatg cagcggttct ttgctgaccc ggagatgcag cgcaagctag aggaaacatt 26580
gcactacacc tttcgacagg gctacgtacg ccaggcctgc aagatctcca acgtggagct 26640
ctgcaacctg gtctcctacc ttggaatttt gcacgaaaac cgccttgggc aaaacgtgct 26700
tcattccacg ctcaagggcg aggcgcgccg cgactacgtc cgcgactgcg tttacttatt 26760
tctatgctac acctggcaga cggccatggg cgtttggcag cagtgcttgg aggagtgcaa 26820
cctcaaggag ctgcagaaac tgctaaagca aaacttgaag gacctatgga cggccttcaa 26880
cgagcgctcc gtggccgcgc acctggcgga catcattttc cccgaacgcc tgcttaaaac 26940
cctgcaacag ggtctgccag acttcaccag tcaaagcatg ttgcagaact ttaggaactt 27000
tatcctagag cgctcaggaa tcttgcccgc cacctgctgt gcacttccta gcgactttgt 27060
gcccattaag taccgcgaat gccctccgcc gctttggggc cactgctacc ttctgcagct 27120
agccaactac cttgcctacc actctgacat aatggaagac gtgagcggtg acggtctact 27180
ggagtgtcac tgtcgctgca acctatgcac cccgcaccgc tccctggttt gcaattcgca 27240
gctgcttaac gaaagtcaaa ttatcggtac ctttgagctg cagggtccct cgcctgacga 27300
aaagtccgcg gctccggggt tgaaactcac tccggggctg tggacgtcgg cttaccttcg 27360
caaatttgta cctgaggact accacgccca cgagattagg ttctacgaag accaatcccg 27420
cccgccaaat gcggagctta ccgcctgcgt cattacccag ggccacattc ttggccaatt 27480
gcaagccatc aacaaagccc gccaagagtt tctgctacga aagggacggg gggtttactt 27540
ggacccccag tccggcgagg agctcaaccc aatccccccg ccgccgcagc cctatcagca 27600
gcagccgcgg gcccttgctt cccaggatgg cacccaaaaa gaagctgcag ctgccgccgc 27660
cacccacgga cgaggaggaa tactgggaca gtcaggcaga ggaggttttg gacgaggagg 27720
aggaggacat gatggaagac tgggagagcc tagacgagga agcttccgag gtcgaagagg 27780
tgtcagacga aacaccgtca ccctcggtcg cattcccctc gccggcgccc cagaaatcgg 27840
caaccggttc cagcatggct acaacctccg ctcctcaggc gccgccggca ctgcccgttc 27900
gccgacccaa ccgtagatgg gacaccactg gaaccagggc cggtaagtcc aagcagccgc 27960
cgccgttagc ccaagagcaa caacagcgcc aaggctaccg ctcatggcgc gggcacaaga 28020
acgccatagt tgcttgcttg caagactgtg ggggcaacat ctccttcgcc cgccgctttc 28080
ttctctacca tcacggcgtg gccttcccccgtaacatcct gcattactac cgtcatctct 28140
acagcccata ctgcaccggc ggcagcggca gcggcagcaa cagcagcggc cacacagaag 28200
caaaggcgac cggatagcaa gactctgaca aagcccaaga aatccacagc ggcggcagca 28260
gcaggaggag gagcgctgcg tctggcgccc aacgaacccg tatcgacccg cgagcttaga 28320
aacaggattt ttcccactct gtatgctata tttcaacaga gcaggggcca agaacaagag 28380
ctgaaaataa aaaacaggtc tctgcgatcc ctcacccgca gctgcctgta tcacaaaagc 28440
gaagatcagc ttcggcgcac gctggaagac gcggaggctc tcttcagtaa atactgcgcg 28500
ctgactctta aggactagtt tcgcgccctt tctcaaattt aagcgcgaaa actacgtcat 28560
ctccagcggc cacacccggc gccagcacct gtcgtcagcg ccattatgag caaggaaatt 28620
cccacgccct acatgtggag ttaccagcca caaatgggac ttgcggctgg agctgcccaa 28680
gactactcaa cccgaataaa ctacatgagc gcgggacccc acatgatatc ccgggtcaac 28740
ggaatccgcg cccaccgaaa ccgaattctc ttggaacagg cggctattac caccacacct 28800
cgtaataacc ttaatccccg tagttggccc gctgccctgg tgtaccagga aagtcccgct 28860
cccaccactg tggtacttcc cagagacgcc caggccgaag ttcagatgac taactcaggg 28920
gcgcagcttg cgggcggctt tcgtcacagg gtgcggtcgc ccgggcaggg tataactcac 28980
ctgacaatca gagggcgagg tattcagctc aacgacgagt cggtgagctc ctcgcttggt 29040
ctccgtccgg acgggacatt tcagatcggc ggcgccggcc gtccttcatt cacgcctcgt 29100
caggcaatcc taactctgca gacctcgtcc tctgagccgc gctctggagg cattggaact 29160
ctgcaattta ttgaggagtt tgtgccatcg gtctacttta accccttctc gggacctccc 29220
ggccactatc cggatcaatt tattcctaac tttgacgcgg taaaggactc ggcggacggc 29280
tacgactgaa tgttaagtgg agaggcagag caactgcgcc tgaaacacct ggtccactgt 29340
cgccgccaca agtgctttgc ccgcgactcc ggtgagtttt gctactttga attgcccgag 29400
gatcatatcg agggcccggc gcacggcgtc cggcttaccg cccagggaga gcttgcccgt 29460
agcctgattc gggagtttac ccagcgcccc ctgctagttg agcgggacag gggaccctgt 29520
gttctcactg tgatttgcaa ctgtcctaac cttggattac atcaagatcc tctagttata 29580
actagagtac ccggggatct tattcccttt aactaataaa aaaaaataat aaagcatcac 29640
ttacttaaaa tcagttagca aatttctgtc cagtttattc agcagcacct ccttgccctc 29700
ctcccagctc tggtattgca gcttcctcct ggctgcaaac tttctccaca atctaaatgg 29760
aatgtcagtt tcctcctgtt cctgtccatc cgcacccact atcttcatgt tgttgcagat 29820
gaagcgcgca agaccgtctg aagatacctt caaccccgtg tatccatatg acacggaaac 29880
cggtcctcca actgtgcctt ttcttactcc tccctttgta tcccccaatg ggtttcaaga 29940
gagtccccct ggggtactct ctttgcgcct atccgaacct ctagttacct ccaatggcat 30000
gcttgcgctc aaaatgggca acggcctctc tctggacgag gccggcaacc ttacctccca 30060
aaatgtaacc actgtgagcc cacctctcaa aaaaaccaag tcaaacataa acctggaaat 30120
atctgcaccc ctcacagtta cctcagaagc cctaactgtg gctgccgccg cacctctaat 30180
ggtcgcgggc aacacactca ccatgcaatc acaggccccg ctaaccgtgc acgactccaa 30240
acttagcatt gccacccaag gacccctcac agtgtcagaa ggaaagctag ccctgcaaac 30300
atcaggcccc ctcaccacca ccgatagcag tacccttact atcactgcct caccccctct 30360
aactactgcc actggtagct tgggcattga cttgaaagag cccatttata cacaaaatgg 30420
aaaactagga ctaaagtacg gggctccttt gcatgtaaca gacgacctaa acactttgac 30480
cgtagcaact ggtccaggtg tgactattaa taatacttcc ttgcaaacta aagttactgg 30540
agccttgggt tttgattcac aaggcaatat gcaacttaat gtagcaggag gactaaggat 30600
tgattctcaa aacagacgcc ttatacttga tgttagttat ccgtttgatg ctcaaaacca 30660
actaaatcta agactaggac agggccctct ttttataaac tcagcccaca acttggatat 30720
taactacaac aaaggccttt acttgtttac agcttcaaac aattccaaaa agcttgaggt 30780
taacctaagc actgccaagg ggttgatgtt tgacgctaca gccatagcca ttaatgcagg 30840
agatgggctt gaatttggtt cacctaatgc accaaacaca aatcccctca aaacaaaaat 30900
tggccatggc ctagaatttg attcaaacaa ggctatggtt cctaaactag gaactggcct 30960
tagttttgac agcacaggtg ccattacagt aggaaacaaa aataatgata agctaacttt 31020
gtggaccaca ccagctccat ctcctaactg tagactaaat gcagagaaag atgctaaact 31080
cactttggtc ttaacaaaat gtggcagtca aatacttgct acagtttcag ttttggctgt 31140
taaaggcagt ttggctccaa tatctggaac agttcaaagt gctcatctta ttataagatt 31200
tgacgaaaat ggagtgctac taaacaattc cttcctggac ccagaatatt ggaactttag 31260
aaatggagat cttactgaag gcacagccta tacaaacgct gttggattta tgcctaacct 31320
atcagcttat ccaaaatctc acggtaaaac tgccaaaagt aacattgtca gtcaagttta 31380
cttaaacgga gacaaaacta aacctgtaac actaaccatt acactaaacg gtacacagga 31440
aacaggagac acaactccaa gtgcatactc tatgtcattt tcatgggact ggtctggcca 31500
caactacatt aatgaaatat ttgccacatc ctcttacact ttttcataca ttgcccaaga 31560
ataaagaatc gtttgtgtta tgtttcaacg tgtttatttt tcaattgcag aaaatttcaa 31620
gtcatttttc attcagtagt atagccccac caccacatag cttatacaga tcaccgtacc 31680
ttaatcaaac tcacagaacc ctagtattca acctgccacc tccctcccaa cacacagagt 31740
acacagtcct ttctccccgg ctggccttaa aaagcatcat atcatgggta acagacatat 31800
tcttaggtgt tatattccac acggtttcct gtcgagccaa acgctcatca gtgatattaa 31860
taaactcccc gggcagctca cttaagttca tgtcgctgtc cagctgctga gccacaggct 31920
gctgtccaac ttgcggttgc ttaacgggcg gcgaaggaga agtccacgcc tacatggggg 31980
tagagtcata atcgtgcatc aggatagggc ggtggtgctg cagcagcgcg cgaataaact 32040
gctgccgccg ccgctccgtc ctgcaggaat acaacatggc agtggtctcc tcagcgatga 32100
ttcgcaccgc ccgcagcata aggcgccttg tcctccgggc acagcagcgc accctgatct 32160
cacttaaatc agcacagtaa ctgcagcaca gcaccacaat attgttcaaa atcccacagt 32220
gcaaggcgct gtatccaaag ctcatggcgg ggaccacaga acccacgtgg ccatcatacc 32280
acaagcgcag gtagattaag tggcgacccc tcataaacac gctggacata aacattacct 32340
cttttggcat gttgtaattc accacctccc ggtaccatat aaacctctga ttaaacatgg 32400
cgccatccac caccatccta aaccagctgg ccaaaacctg cccgccggct atacactgca 32460
gggaaccggg actggaacaa tgacagtgga gagcccagga ctcgtaacca tggatcatca 32520
tgctcgtcat gatatcaatg ttggcacaac acaggcacac gtgcatacac ttcctcagga 32580
ttacaagctc ctcccgcgtt agaaccatat cccagggaac aacccattcc tgaatcagcg 32640
taaatcccac actgcaggga agacctcgca cgtaactcac gttgtgcatt gtcaaagtgt 32700
tacattcggg cagcagcgga tgatcctcca gtatggtagc gcgggtttct gtctcaaaag 32760
gaggtagacg atccctactg tacggagtgc gccgagacaa ccgagatcgt gttggtcgta 32820
gtgtcatgcc aaatggaacg ccggacgtag tcatatttcc tgaagcaaaa ccaggtgcgg 32880
gcgtgacaaa cagatctgcg tctccggtct cgccgcttag atcgctctgt gtagtagttg 32940
tagtatatcc actctctcaa agcatccagg cgccccctgg cttcgggttc tatgtaaact 33000
ccttcatgcg ccgctgccct gataacatcc accaccgcag aataagccac acccagccaa 33060
cctacacatt cgttctgcga gtcacacacg ggaggagcgg gaagagctgg aagaaccatg 33120
tttttttttt tattccaaaa gattatccaa aacctcaaaa tgaagatcta ttaagtgaac 33180
gcgctcccct ccggtggcgt ggtcaaactc tacagccaaa gaacagataa tggcatttgt 33240
aagatgttgc acaatggctt ccaaaaggca aacggccctc acgtccaagt ggacgtaaag 33300
gctaaaccct tcagggtgaa tctcctctat aaacattcca gcaccttcaa ccatgcccaa 33360
ataattctca tctcgccacc ttctcaatat atctctaagc aaatcccgaa tattaagtcc 33420
ggccattgta aaaatctgct ccagagcgcc ctccaccttc agcctcaagc agcgaatcat 33480
gattgcaaaa attcaggttc ctcacagacc tgtataagat tcaaaagcgg aacattaaca 33540
aaaataccgc gatcccgtag gtcccttcgc agggccagct gaacataatc gtgcaggtct 33600
gcacggacca gcgcggccac ttccccgcca ggaaccttga caaaagaacc cacactgatt 33660
atgacacgca tactcggagc tatgctaacc agcgtagccc cgatgtaagc tttgttgcat 33720
gggcggcgat ataaaatgca aggtgctgct caaaaaatca ggcaaagcct cgcgcaaaaa 33780
agaaagcaca tcgtagtcat gctcatgcag ataaaggcag gtaagctccg gaaccaccac 33840
agaaaaagac accatttttc tctcaaacat gtctgcgggt ttctgcataa acacaaaata 33900
aaataacaaa aaaacattta aacattagaa gcctgtctta caacaggaaa aacaaccctt 33960
ataagcataa gacggactac ggccatgccg gcgtgaccgt aaaaaaactg gtcaccgtga 34020
ttaaaaagca ccaccgacag ctcctcggtc atgtccggag tcataatgta agactcggta 34080
aacacatcag gttgattcat cggtcagtgc taaaaagcga ccgaaatagc ccgggggaat 34140
acatacccgc aggcgtagag acaacattac agcccccata ggaggtataa caaaattaat 34200
aggagagaaa aacacataaa cacctgaaaa accctcctgc ctaggcaaaa tagcaccctc 34260
ccgctccaga acaacataca gcgcttcaca gcggcagcct aacagtcagc cttaccagta 34320
aaaaagaaaa cctattaaaa aaacaccact cgacacggca ccagctcaat cagtcacagt 34380
gtaaaaaagg gccaagtgca gagcgagtat atataggact aaaaaatgac gtaacggtta 34440
aagtccacaa aaaacaccca gaaaaccgca cgcgaaccta cgcccagaaa cgaaagccaa 34500
aaaacccaca acttcctcaa atcgtcactt ccgttttccc acgttacgta acttcccatt 34560
ttaagaaaac tacaattccc aacacataca agttactccg ccctaaaacc tacgtcaccc 34620
gccccgttcc cacgccccgc gccacgtcac aaactccacc ccctcattat catattggct 34680
tcaatccaaa ataaggtata ttattgatga tnnncgcgcc acgtcacaaa ctccaccccc 34740
tcattatcat attggcttca atccaaaata aggtatatta ttgatgatnn nttaattaag 34800
gatccnnncg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgct 34860
cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 34920
cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 34980
acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 35040
ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 35100
ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 35160
gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 35220
gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 35280
ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 35340
actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 35400
gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 35460
ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 35520
ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 35580
gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 35640
tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 35700
tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 35760
aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 35820
aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg 35880
tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 35940
gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 36000
agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 36060
aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgnn nnaaaaagga 36120
tcttcaccta gatccttttc acgtagaaag ccagtccgca gaaacggtgc tgaccccgga 36180
tgaatgtcag ctactgggct atctggacaa gggaaaacgc aagcgcaaag agaaagcagg 36240
tagcttgcag tgggcttaca tggcgatagc tagactgggc ggttttatgg acagcaagcg 36300
aaccggaatt gccagctggg gcgccctctg gtaaggttgg gaagccctgc aaagtaaact 36360
ggatggcttt ctcgccgcca aggatctgat ggcgcagggg atcaagctct gatcaagaga 36420
caggatgagg atcgtttcgc atgattgaac aagatggatt gcacgcaggt tctccggccg 36480
cttgggtgga gaggctattc ggctatgact gggcacaaca gacaatcggc tgctctgatg 36540
ccgccgtgtt ccggctgtca gcgcaggggc gcccggttct ttttgtcaag accgacctgt 36600
ccggtgccct gaatgaactg caagacgagg cagcgcggct atcgtggctg gccacgacgg 36660
gcgttccttg cgcagctgtg ctcgacgttg tcactgaagc gggaagggac tggctgctat 36720
tgggcgaagt gccggggcag gatctcctgt catctcacct tgctcctgcc gagaaagtat 36780
ccatcatggc tgatgcaatg cggcggctgc atacgcttga tccggctacc tgcccattcg 36840
accaccaagc gaaacatcgc atcgagcgag cacgtactcg gatggaagcc ggtcttgtcg 36900
atcaggatga tctggacgaa gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc 36960
tcaaggcgag catgcccgac ggcgaggatc tcgtcgtgac ccatggcgat gcctgcttgc 37020
cgaatatcat ggtggaaaat ggccgctttt ctggattcat cgactgtggc cggctgggtg 37080
tggcggaccg ctatcaggac atagcgttgg ctacccgtga tattgctgaa gagcttggcg 37140
gcgaatgggc tgaccgcttc ctcgtgcttt acggtatcgc cgctcccgat tcgcagcgca 37200
tcgccttcta tcgccttctt gacgagttct tctgaatttt gttaaaattt ttgttaaatc 37260
agctcatttt ttaaccaata ggccgaaatc ggcaacatcc cttataaatc aaaagaatag 37320
accgcgatag ggttgagtgt tgttccagtt tggaacaaga gtccactatt aaagaacgtg 37380
gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg atggcccact acgtgaacca 37440
tcacccaaat caagtttttt gcggtcgagg tgccgtaaag ctctaaatcg gaaccctaaa 37500
gggagccccc gatttagagc ttgacgggga aagccggcga acgtggcgag aaaggaaggg 37560
aagaaagcga aaggagcggg cgctagggcg ctggcaagtg tagcggtcac gctgcgcgta 37620
accaccacac ccgcgcgctt aatgcgccgn nnnnnnnnnn nnnnnnnnnn 37670
Claims (2)
1. A secretory porcine circovirus type 2 recombinant adenovirus is characterized in that: the recombinant adenovirus is obtained by packaging adenovirus by using recombinant adenovirus plasmid, wherein the recombinant adenovirus plasmid is formed by homologous recombination of a shuttle vector of secretory porcine circovirus type 2 recombinant adenovirus and an adenovirus skeleton vector; the recombinant adenovirus shuttle vector is an adenovirus shuttle plasmid inserted with a target gene segment, wherein the target gene segment comprises a secretory protein coding region and an expression enhancing element, the expression enhancing element comprises a first Intron Intron A of human cytomegalovirus and a post-transcriptional regulatory element WPRE of woodchuck hepatitis virus, the secretory protein coding region comprises a tumor necrosis factor-related activator protein CD40L sequence with a secretory signal peptide sp, a porcine circovirus type 2capsid protein Cap sequence with a secretory signal peptide sp and a granulocyte-cytomegalo colony stimulating factor GMCSF sequence with a secretory signal peptide sp, and the CD40L, the Cap and the GMCSF are co-expressed; the secretory protein coding region also includes a sequence of self-cleaving 2A peptide disposed between each of the CD40L, Cap, and GMCSF sequences; the sequence of the recombinant adenovirus plasmid is shown in SEQ ID No. 11.
2. The use of the secretory porcine circovirus type 2 recombinant adenovirus of claim 1 in the preparation of a porcine circovirus type 2 genetically engineered vaccine.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710607801.8A CN107446895B (en) | 2017-07-24 | 2017-07-24 | Secretory porcine circovirus type 2 recombinant adenovirus and construction method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710607801.8A CN107446895B (en) | 2017-07-24 | 2017-07-24 | Secretory porcine circovirus type 2 recombinant adenovirus and construction method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107446895A CN107446895A (en) | 2017-12-08 |
CN107446895B true CN107446895B (en) | 2020-05-12 |
Family
ID=60487983
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710607801.8A Active CN107446895B (en) | 2017-07-24 | 2017-07-24 | Secretory porcine circovirus type 2 recombinant adenovirus and construction method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107446895B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110257428B (en) * | 2019-07-01 | 2020-09-15 | 武汉科前生物股份有限公司 | Recombinant adenovirus expressing porcine circovirus type 3 ORF2 gene and preparation method and application thereof |
CN113913465A (en) * | 2021-09-17 | 2022-01-11 | 浙江洪晟生物科技股份有限公司 | Preparation method and application of swine mycoplasma pneumonia genetic engineering subunit vaccine carrying swine GMCSF molecular adjuvant |
CN114058646B (en) * | 2021-11-10 | 2023-11-03 | 武汉科前生物股份有限公司 | Vector and method for expressing PCV2d cap protein |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1769435A (en) * | 2005-04-07 | 2006-05-10 | 南京农业大学 | Porcine circus-virus 2 type recombinant adenovirus and vaccine |
CN101289658A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination virus particles for expressing 2-typed porcine circovirus nucleocapsid protein Cap gene |
CN103667348A (en) * | 2012-09-03 | 2014-03-26 | 天津耀宇生物技术有限公司 | Double-labelling recombinant silkworm baculovirus and preparation method and application thereof |
CN105838684A (en) * | 2016-03-22 | 2016-08-10 | 西北农林科技大学 | Construction, amplification and purification method of porcine CD40L/GMCSF/PCV2Cap recombinant adenovirus |
CN106399262A (en) * | 2016-05-12 | 2017-02-15 | 西北农林科技大学 | Optimized porcine circovivus type 2 recombinant adenovirus construction method |
-
2017
- 2017-07-24 CN CN201710607801.8A patent/CN107446895B/en active Active
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1769435A (en) * | 2005-04-07 | 2006-05-10 | 南京农业大学 | Porcine circus-virus 2 type recombinant adenovirus and vaccine |
CN101289658A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination virus particles for expressing 2-typed porcine circovirus nucleocapsid protein Cap gene |
CN103667348A (en) * | 2012-09-03 | 2014-03-26 | 天津耀宇生物技术有限公司 | Double-labelling recombinant silkworm baculovirus and preparation method and application thereof |
CN105838684A (en) * | 2016-03-22 | 2016-08-10 | 西北农林科技大学 | Construction, amplification and purification method of porcine CD40L/GMCSF/PCV2Cap recombinant adenovirus |
CN106399262A (en) * | 2016-05-12 | 2017-02-15 | 西北农林科技大学 | Optimized porcine circovivus type 2 recombinant adenovirus construction method |
Non-Patent Citations (1)
Title |
---|
新型肝细胞刺激因子Hepatopoietin Cn对酒精性肝损伤的保护作用及机制研究;刘杨;《中国博士学位论文全文数据库 医药卫生科技辑》;20120615(第6期);E064-5 * |
Also Published As
Publication number | Publication date |
---|---|
CN107446895A (en) | 2017-12-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN112760297B (en) | Coronavirus pseudovirus packaging system, packaging method thereof and application of coronavirus pseudovirus in evaluating disinfection efficacy | |
CN111372943B (en) | Adenovirus and use thereof | |
RU2650860C2 (en) | Vectors for expression of prostate-associated antigens | |
CN107446895B (en) | Secretory porcine circovirus type 2 recombinant adenovirus and construction method thereof | |
KR101273836B1 (en) | Chimeric adenoviral vectors | |
CN108203714B (en) | Cotton gene editing method | |
CN110283840B (en) | Accurate and efficient editing method of upland cotton genome | |
KR20200066349A (en) | Replicable adenovirus vector | |
CN113355296A (en) | Recombinant oncolytic newcastle disease virus expressing human CCL19 and application thereof | |
CN107574182A (en) | Transmembrane porcine circovirus 2 type recombined adhenovirus and its construction method | |
CN101775410B (en) | Fowlpox virus vector shuttle plasmid and application thereof | |
KR20080030956A (en) | Treatment of disease using an improved regulated expression system | |
US11384365B2 (en) | EHV with inactivated UL18 and/or UL8 | |
CN111635461A (en) | ACE2-Albumin recombinant protein and preparation method and application thereof | |
CN111518833B (en) | Construction method and application of oncolytic adenovirus carrying AIM2 gene | |
CN113073105A (en) | Polynucleotide sequence for expressing HPV56L1, expression vector, host cell and application thereof | |
CN111394385A (en) | Method for rapidly identifying bidirectional promoter of rice | |
CN113840928A (en) | Intrinsic system for transgene regulation of viral vectors | |
CN102233136B (en) | Recombinant plasmid vaccine for treating hepatitis B and composition thereof | |
CN111378684A (en) | Application of heat-induced gene editing system CRISPR-Cas12b in upland cotton | |
CN109750005A (en) | A kind of porcine pseudorabies recombinant virus and its construction method | |
CN104237508A (en) | Mycobacterium tuberculosis detecting kit and application thereof | |
CN107815435A (en) | The gluconacetobacter of cellulose production capacity with enhancing | |
CN112662672B (en) | Promoter and preparation method thereof | |
KR102335524B1 (en) | Oncolytic recombinant newcastle disease virus contain PTEN gene constructed by based on the Newcastle disease virus for glioblastoma treatment and its composition |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |