CN107418978B

CN107418978B - Method for preparing farnesene by using biodiesel by-product

Info

Publication number: CN107418978B
Application number: CN201710489401.1A
Authority: CN
Inventors: 齐崴; 尤生萍; 高岚; 苏荣欣; 陶志平
Original assignee: Tianjin University
Current assignee: Tianjin University
Priority date: 2017-06-24
Filing date: 2017-06-24
Publication date: 2020-10-23
Anticipated expiration: 2037-06-24
Also published as: CN107418978A

Abstract

The invention discloses a method for preparing farnesene by using a biodiesel byproduct. The method comprises the purification of the biodiesel by-product, and the purity of the purified glycerol reaches 63.8% (w/w); also disclosed is a method for producing farnesene by fermentation using purified glycerol as a raw material, which comprises constructing a recombinant host cell for producing farnesene from purified glycerol, wherein the recombinant host cell comprises genes related to the mevalonate pathway or the deoxyxylulose-5-phosphate pathway, an isopentenyl pyrophosphate isomerase gene, a farnesene pyrophosphate synthase gene and a farnesene synthase gene, and the method comprises producing farnesene by fermentation using purified glycerol as a raw material in the recombinant host cell, wherein the concentration of farnesene obtained is 0.025 g/L; the method also comprises the step of optimally constructing a recombinant host cell capable of improving the yield of farnesene by using purified glycerol as a raw material, wherein the concentration of the obtained farnesene reaches 2.9g/L and is increased by 115 times compared with the concentration of the farnesene before optimization.

Description

Method for preparing farnesene by using biodiesel by-product

Technical Field

The invention discloses a method for preparing farnesene by using a biodiesel byproduct, which comprises the purification of the biodiesel byproduct, the construction of a recombinant host cell for producing farnesene by using purified glycerol as a raw material, the fermentation preparation of farnesene in the recombinant host cell by using the purified glycerol as the raw material, and the construction of the recombinant host cell for improving the capability of producing farnesene by using the purified glycerol as a substrate and realizing high yield of farnesene.

Background

In recent years, with energy shortage and environmental deterioration, the large-scale development of biodiesel as a biological energy source with great development prospect is expanding. Meanwhile, the biodiesel by-products are increasing, and the market demand of recycling the traditional biodiesel by-products is far greater. Therefore, the effective utilization of cheap biodiesel by-products in the biodiesel production process becomes a serious problem. The method can reduce the preparation cost of the biodiesel, improve the market competitiveness of the biodiesel and reduce the environmental pollution by vigorously developing and utilizing the biodiesel byproduct. Wherein, the high value-added product can be produced by utilizing the biodiesel byproduct through microbial fermentation, the pollution of the biodiesel byproduct to the environment can be solved, and the method is one of the ways for improving the economic benefit of the biodiesel industry.

The first generation of biofuels, particularly ethanol and biodiesel (i.e., fatty acid methyl esters), suffered from numerous limitations, such as blending ratio limitations with gasoline, and poor performance at low temperatures. Farnesene can be hydrogenated into farnesane, is a renewable fuel which can be mixed with petroleum diesel and aerospace fuel for use, and overcomes the defects of the first generation of biofuel. Farnesane has the advantages of no sulfur and particulates, high cetane number, low temperature performance and low GHG emission, and is a renewable fuel with wide application and ideal effect. Currently, Amyris corporation uses its own proprietary strains to ferment sucrose (from sugar cane) to produce farnesene. However, sugarcane belongs to food-grade raw materials, is relatively expensive, and is not beneficial to continuous large-scale production. If the farnesene can be produced by fermenting by using the biodiesel byproduct as a raw material, the limitation of the raw material source can be solved, the problem of environmental pollution caused by the biodiesel byproduct can be solved, and the production cost can be greatly reduced. In view of the above, the present invention provides a recombinant host cell for producing farnesene from a biodiesel byproduct and a method for producing the same.

Disclosure of Invention

The invention aims to provide a method for preparing farnesene by utilizing a biodiesel byproduct (figure 1). The method comprises the purification of biodiesel by-products, the construction of recombinant host cells for producing farnesene by using purified glycerol as a raw material, the fermentation preparation of farnesene in the recombinant host cells by using the purified glycerol as the raw material, and the construction of the recombinant host cells for improving the capability of producing the farnesene by using the purified glycerol as a substrate and the high yield of the farnesene.

A method for preparing farnesene by utilizing a biodiesel byproduct comprises the following steps:

(1) purification of biodiesel by-product:

a. removing insoluble materials in the biodiesel by-product by centrifugation;

b. removing methanol in the biodiesel by-product by a distillation method;

c. adding phosphoric acid to neutralize the biodiesel byproduct from which the methanol is removed, and performing centrifugal separation to obtain purified glycerol for preparing farnesene;

(2) the construction of recombinant host cells for producing farnesene by using biodiesel byproducts as raw materials:

a. obtaining related genes for synthesizing farnesene by NCBI database query and genetic engineering technical means, wherein the related genes comprise genes in a Mevalonate (MVA) pathway or a deoxyxylulose-5-phosphate (MEP) pathway, an isopentenyl pyrophosphate isomerase gene (IDI), a farnesene pyrophosphate synthase gene (ispA) and a farnesene synthase gene (FG);

b. constructing a plurality of recombinant plasmids compatible in the same host cell, wherein the plurality of recombinant plasmids co-express the related protein for synthesizing farnesene in the host cell through promoter transcription and host cell translation;

c. transforming and introducing various recombinant plasmids into host cells to obtain the recombinant host cells for synthesizing farnesene.

(3) Inoculating the recombinant host cell into a culture medium containing the purified glycerol, and performing heterologous induction expression to prepare farnesene.

(4) Constructing a recombinant host cell capable of improving the yield of farnesene by using the purified glycerol as a substrate:

a. optimizing the types and the number of genes carried by corresponding promoters according to the transcription capability of the promoters of various recombinant plasmids, co-expressing related proteins for synthesizing farnesene by various optimized recombinant plasmids, and balancing the protein expression level of each gene in a metabolic pathway;

b. transforming and introducing various optimized recombinant plasmids into host cells to obtain recombinant host cells for improving the yield of farnesene;

c. inoculating the recombinant host cell into a culture medium containing the purified glycerol for heterologous induction expression of high-yield farnesene.

The main components of the biodiesel byproduct comprise 20-50% of glycerin, 10-35% of methanol, an alkaline catalyst and 5-30% of soap; the centrifugation conditions are that the centrifugation rotating speed is 3000-15000 rpm, and the centrifugation time is 5-60 min; the concentration of the phosphoric acid is 5-60%.

The MVA pathway includes acetoacetyl CoA thiolase (atoB), HMG-CoA Synthase (HMGs), HMG-CoA reductase (HMGR), mevalonate kinase (E12), phosphomevalonate kinase (E8), and mevalonate pyrophosphate decarboxylase (MVD 1); the MVA pathway comprises either MvaE enzyme and MVAs enzyme, wherein MvaE enzyme has acetoacetyl CoA thiolase enzyme activity and MVAs enzyme has dual enzyme activity of HMG-CoA synthase and HMG-CoA reductase; the MEP pathway includes 1-deoxy-D-xylulose 5-phosphate synthase (DXS), 1-deoxy-D-xylulose 5-phosphate reductoisomerase (IspC), cytidine 4-diphosphate-2C-methyl-D-erythritol synthase (IspD), cytidine 4-diphosphate-2C-methyl-D-erythritol synthase (IspE), 2C-methyl-D-erythrose 2, 4-cyclodiphosphate synthase (IspF), 1-hydroxy-2-methyl-2- (E) -butenyl 4-diphosphate synthase (IspG), and isopentenyl/dimethylallyl diphosphate synthase (ispH); the FG is selected from the cDNA sequence of plant farnesene synthetase such as artemisinin, apple peel, sweet orange, rose, ylang-ylang or orange peel and the like.

The host cell is a prokaryotic cell; the promoter has transcription capability in prokaryotic cells; the promoter is selected from an araC promoter (seq.1), a lac promoter (seq.2), a tac promoter (seq.3), a trc promoter (seq.4), a T3 promoter (seq.5), a T5 promoter (seq.6) and a T7 promoter (seq.7).

The culture medium contains 1-100 g of purified glycerol, 1-50 g of yeast powder, 1-50 g of peptone, 1-30 g of inorganic salt and 1-1000 mg of one or more antibiotics per liter of culture medium; the heterologous induced expression is carried out by adding 0.1-10% recombinant host cell seed liquid, and culturing at 30-45 deg.C and 50-350 rpm to OD₆₀₀Adding 1-10000 mg of one or more inducers and 50-1000 mL of extracting agent into each liter of fermentation liquor between 0.6-08 ℃, and performing reaction at 16-35 ℃ and 50-350 rCarrying out heterologous induced expression under the pm condition, wherein the heterologous induced expression time is 3-120 h; the antibiotic is selected from chloramphenicol, ampicillin, kanamycin, tetracycline or azithromycin; the inducer is selected from L-arabinose or IPTG; the extractant is selected from n-hexane, n-decane, dodecane or kerosene.

The multiple recombinant plasmids compatible in the same host cell are 33-pMevT, 4-pMBIS and 28 a-FG; the promoter of the recombinant plasmid 33-pMevT is an araC promoter; the recombinant plasmid 33-pMevT contains three genes, including atoB, HMGS and HMGR; the promoters of the recombinant plasmids 4-pMBIS and 28a-FG are T7 promoters; the recombinant plasmid 4-pMBIS contains five genes including E12, E8, MVD1, IDI and ispA; said recombinant plasmid 28a-FG contains FG;

the multiple recombinant plasmids compatible in the same host cell are 33-pMvaE-S, 4-pMBIS and 28 a-FG; the promoter of the recombinant plasmid 33-pMvaE-S is an araC promoter; the recombinant plasmid 33-pMvaE-S contains two genes, including MvaE enzyme gene and MvaS enzyme gene;

said plurality of recombinant plasmids compatible in the same host cell are 33-pDCDE, 4-pFGHI and 28 a-FG; the promoter of the recombinant plasmid 33-pDCDE is an araC promoter; the recombinant plasmid 33-pDCDE contains four genes including DXS, IspC, IspD and IspE; the promoter of the recombinant plasmid 4-pFGHII is T7 promoter; the recombinant plasmid 4-pFGHI contains five genes including IspF, IspG, IspH, IDI and ispA.

The transcription capacity of the promoters of the various recombinant plasmids is 0-4500 bp; the gene type is related to farnesene synthesis; the number of the genes is 1-9.

Preferably, the concentration of the phosphoric acid is 40%; preferably, the centrifugal speed is 7000rpm, and the centrifugal time is 20 min; preferably, the purified glycerol has a purity of 63.8% (w/w).

Preferably, the DNA sequences of atoB (seq.8), DXS (seq.9), IspC (seq.10), IspD (seq.11), IspE (seq.12), IspF (seq.13), IspG (seq.14), ispH (seq.15), IDI (seq.16) and ipsA (seq.17) are selected from E.coli; preferably, the DNA sequences of HMGS (seq.18), HMGR (seq.19), E12(seq.20), E8(seq.21) and MVD1(seq.22) are selected from Saccharomyces cerevisiae; preferably, the DNA sequences of MvaE (seq.23) and MvaS (seq.24) are selected from the group consisting of enterococcus faecalis; preferably, the FG is selected from the artemisinin cDNA sequence (seq. 25).

Preferably, the host cell is Escherichia coli BL21(DE 3); preferably, the plurality of recombinant plasmids are 33-pMvaE-S, 4-pMBIS and 28 a-FG; preferably, the recombinant host cell contains a plurality of recombinant plasmids 33-pMvaE-S, 4-pMBIS and 28 a-FG; preferably, the formula of each liter of culture medium is 23.5g of purified glycerol, 10g of yeast powder, 16g of peptone, 5g of NaCl, 34mg of chloramphenicol, 50mg of kanamycin and 100mg of ampicillin; preferably, the heterologous induction of expression is performed by adding 1% of recombinant host cell F1 seed solution, and culturing at 37 deg.C and 220rpm to OD₆₀₀Adding 24mg of IPTG, 3g L-arabinose and 200mL of n-decane into each liter of fermentation liquor between 0.6 and 0.8, and performing heterologous induced expression at the temperature of 30 ℃ and the speed of 220 rpm; the preferred heterologous induction expression time is 96h and the concentration of farnesene is 0.025 g/L.

Preferably, the transcription capacity range of the araC promoter and the T7 promoter is 3000-4000 bp; preferably, the plurality of optimized recombinant plasmids are 33-pMvaE-S, 4-pEEM and 28 a-FII; the recombinant plasmid 33-pMvaE-S contains two genes MvaE and MvaS, and the number of exogenous gene bases carried by an araC promoter is 3568 bp; the recombinant plasmid 4-pEEM contains three genes E12, E8 and MVD1, and the number of the exogenous gene bases carried by a T7 promoter is 3897 bp; the recombinant plasmid 28a-FII contains three genes FG, ispA and IDI, and the number of exogenous gene bases carried by a T7 promoter is 3174 bp; preferably, the optimized recombinant host cell contains a plurality of optimized recombinant plasmids 33-pMvaE-S, 4-pEEM and 28 a-FII.

Preferably, the formula of each liter of culture medium is 23.5g of purified glycerol, 10g of yeast powder, 16g of peptone, 5g of NaCl, 34mg of chloramphenicol, 50mg of kanamycin and 100mg of ampicillin; the heterologous induction of expression is carried out byAfter adding 1% of the recombinant host cell F3 seed solution, the cells were cultured at 37 ℃ and 220rpm to OD₆₀₀Adding 24mg of IPTG, 3g L-arabinose and 200mL of n-decane into each liter of fermentation liquor between 0.6 and 0.8, and performing heterologous induced expression at the temperature of 30 ℃ and the speed of 220 rpm; preferably, the optimized recombinant host cell produces farnesene, and fermentation is carried out for 96h, and the farnesene reaches 2.9g/L which is 115 times higher than that of the non-optimized recombinant host cell.

Compared with the prior art, the method for preparing farnesene by using the biodiesel byproduct has the following advantages that:

(1) the farnesene is prepared by taking the biodiesel byproduct as a raw material, so that the raw material selection for producing the farnesene is expanded, and the sustainable large-scale production is facilitated;

(2) the utilization of the biodiesel byproduct can solve the problem of environmental pollution caused by the biodiesel byproduct;

(3) the biodiesel byproduct has rich sources and low price, and can greatly reduce the production cost;

(4) compared with the traditional genetic engineering means, the method for improving the farnesene production capacity can quickly, simply and conveniently regulate the transcription level of each gene in a metabolic pathway, thereby regulating the expression flux of the metabolic pathway and improving the secretory synthesis capacity of farnesene.

Drawings

FIG. 1 is a metabolic pathway diagram for farnesene production using biodiesel by-product;

fig. 2 construction of recombinant host cell F1 carrying the MVA metabolic pathway;

FIG. 3 shows the cell density (■) and farnesene (●) kinetics curves for fermentation of farnesene from purified glycerol using recombinant host cell F1;

FIG. 4 construction of a recombinant host cell F2 carrying the MEP metabolic pathway;

FIG. 5 cell density (■) and farnesene (●) kinetic profiles for the fermentative production of farnesene starting from purified glycerol using recombinant host cell F2;

FIG. 6 constructs a recombinant host cell F3(MVA pathway) with improved ability to produce farnesene;

FIG. 7 shows the cell density (■) and farnesene (●) kinetics curves for fermentation of farnesene from purified glycerol using recombinant host cell F3.

Detailed Description

The technical solution of the present invention is further described with reference to the following examples, but the scope of the present invention is not limited thereto. The equivalent replacement of the present disclosure, or the corresponding improvement, still falls into the protection scope of the present invention.

Example 1

Biodiesel by-product purification

Centrifuging the initial biodiesel byproduct at 3000rpm for 5min to remove insoluble materials; distilling (temperature controlled at 65 deg.C) to remove part of methanol, adding 5% phosphoric acid for neutralization, centrifuging to obtain purified glycerol with glycerol concentration of 33.4% (w/w), and preparing farnesene.

Construction of recombinant host cell F1

The corresponding DNA sequences of all enzymes of the MVA pathway (except farnesene synthase) were obtained by PCR amplification using E.coli and s.cerevisiae genomic DNA as template according to the primers in Table 1. The farnesene synthetase cDNA sequence is selected from artemisinin synthetase cDNA sequence, and the gene DNA sequence is obtained by means of gene synthesis. Three recombinant plasmids as shown in FIG. 2 were constructed by pEASY-UniSeamless Cloning and Assembly Ki technique based on the DNA sequence obtained above. Escherichia coli DH5a was selected as host cells, and passed through CaCl according to FIG. 2₂Transformation recombinant plasmids 33-pMevT, 4-pMBIS and 28a-FG were transformed to obtain recombinant host cell F1, wherein the recombinant plasmid 33-pMevT contains araC promoter (seq.1), atoB (seq.8), HMGS (seq.18) and HMGR (seq.19), the recombinant plasmid 4-pMBIS contains T5 promoter (seq.6), E12(seq.20), E8(seq.21), MVD1(seq.22), IDI (seq.16) and ipsA (seq.17), and the recombinant plasmid 28a-FG contains lac promoter (seq.2) and FG (seq.25).

Fermentation preparation of farnesene by recombinant host cell F1 using purified glycerol as substrate

The recombinant host cell F1 was inoculated in LB medium (containing 10g peptone, 5g yeast extract and 10g NaCl per liter fermentation broth) and cultured at 30 ℃ and 50rpm for 24 hours to serve as a seed solution. 300mL of the formulation containing 1g peptone, 1g yeast extract and 1g NaCl per liter broth was prepared and divided equally into three 500mL Erlenmeyer flasks (three replicates). The purified glycerol was sterilized at 121 ℃ for 20 min. Under aseptic conditions, 0.1g of sterilized glycerol-purified product, 0.1mL of seed solution, 3ul of a 34g/L chloramphenicol solution, 2ul of a 50g/L kanamycin solution, and 1ul of a 100g/L ampicillin solution were added to each of the three 500mL Erlenmeyer flasks, respectively. Culturing at 30 deg.C and 50rpm to OD₆₀₀Adding 5uL of IPTG solution with the concentration of 24g/L, 10uL of L-arabinose solution with the concentration of 500g/L and 5mL of normal hexane into the fermentation liquor at the temperature of between 0.6 and 08 ℃, and carrying out induction expression under the conditions of 16 ℃ and 50 rpm. And taking 1mL of fermentation liquor and 100ul of n-hexane every 3h to respectively detect the cell density and the concentration of farnesene. The results of the experiment are shown in FIG. 3. The results of the 24h fermentation experiment are as follows: cell density OD₆₀₀It was 3.83, and the concentration of farnesene was 2.46 mg/L.

TABLE 1 primers required for obtaining genes in the MVA metabolic pathway by PCR

Example 2

Biodiesel by-product purification

Centrifuging the initial biodiesel byproduct at 15000rpm for 60min to remove insoluble material; distilling (temperature controlled at 65 deg.C) to remove part of methanol, adding 60% phosphoric acid for neutralization, centrifuging to obtain purified glycerol with glycerol concentration of 65.7% (w/w), and preparing farnesene.

Construction of recombinant host cell F2

Primers according to Table 2, with large intestineThe corresponding DNA sequences of all enzymes of the MVA pathway (except farnesene synthase) were obtained by PCR amplification using Bacillus DNA as template. The farnesene synthetase cDNA sequence is selected from artemisinin synthetase cDNA sequence, and the gene DNA sequence is obtained by means of gene synthesis. Three recombinant plasmids as shown in FIG. 4 were constructed by pEASY-Uni Seamlesscloning and Assembly Ki technique based on the DNA sequence obtained above. Escherichia coli BL21 was selected as the host cell, and passed through CaCl according to FIG. 4₂Transformation recombinant plasmids 33-pDCDE, 4-pFGHI and 28a-FG were transformed to obtain a recombinant host cell F2, wherein the recombinant plasmid 33-pDCDE contained the araC promoter, DXS (seq.9), IspC (seq.10), IspD (seq.11) and IspE (seq.12), the recombinant plasmid 4-pFGHI contained the tac promoter (seq.3), IspF (seq.13), IspG (seq.14), ispH (seq.15), IDI (seq.16) and ipsA (seq.17), and the recombinant plasmid 28a-FG contained the T3 promoter (seq.5) and FG (seq.25).

Fermentation preparation of farnesene by recombinant host cell F2 using purified glycerol as substrate

The recombinant host cell F2 was inoculated in LB medium (containing 10g of peptone, 5g of yeast extract and 10g of NaCl per liter of fermentation broth) as a seed solution after overnight culture at 37 ℃ and 220 rpm. 240mL of the formulation containing 50g peptone, 50g yeast extract and 30g NaCl per liter broth were prepared and divided equally into three 500mL Erlenmeyer flasks (three replicates). The purified glycerol was sterilized at 121 ℃ for 20 min. 10g of sterilized glycerol-purified product, 10mL of seed solution, 300ul of a 34g/L chloramphenicol solution, 200ul of a 50g/L kanamycin solution, and 100ul of a 100g/L ampicillin solution were added to each of the three 500mL Erlenmeyer flasks, respectively, under aseptic conditions. Culturing at 45 deg.C and 350rpm to OD₆₀₀Adding 50ul of IPTG solution with the concentration of 24g/L, 1mL of L-arabinose solution with the concentration of 500g/L and 100mL of dodecane into the fermentation liquor between 0.6 and 08, and performing induced expression under the conditions of 35 ℃ and 350 rpm. And taking 1mL of fermentation liquor and 100ul of dodecane every 24h for respectively detecting the cell density and the concentration of farnesene. The results of the experiment are shown in FIG. 5. The results of the 96h fermentation are as follows: cell density OD₆₀₀It was 8.83, and the concentration of farnesene was 0.025 g/L.

TABLE 2 primers required for obtaining genes in the MEP metabolic pathway by PCR

Example 3

Biodiesel by-product purification

Centrifuging the initial biodiesel byproduct at 7000rpm for 20min to remove insoluble materials; distilling (temperature controlled at 65 deg.C) to remove part of methanol, adding 40% phosphoric acid for neutralization, centrifuging to obtain purified glycerol with glycerol concentration of 63.8% (w/w), and preparing farnesene.

Construction of recombinant host cell F3

The corresponding DNA sequences of all enzymes of the MVA pathway (except farnesene synthase) were obtained by PCR amplification using E.coli and E.faecalis group DNA as templates according to the primers in Table 1. The farnesene synthetase cDNA sequence is selected from artemisinin synthetase cDNA sequence, and the gene DNA sequence is obtained by means of gene synthesis. Three recombinant plasmids as shown in FIG. 6 were constructed by pEASY-UniSeamless Cloning and Assembly Ki technique based on the DNA sequence obtained above. Coli DH5a was selected as host cells and passed through CaCl as shown in FIG. 6₂Transformation recombinant plasmids 33-pMvaE-S, 4-pEEM and 28a-FII were transformed to obtain a recombinant host cell F3, wherein the recombinant plasmid 33-pMvaE-S contains araC promoter (seq.1), MvaE (seq.23) and MvaS (seq.24), the recombinant plasmid 4-pMBIS contains T7 promoter (seq.6), E12(seq.20), E8(seq.21) and MVD1(seq.22), and the recombinant plasmid 28a-FG contains T7 promoter (seq.2), FG (seq.25), IDI (seq.16) and ipsA (seq.17).

Fermentation preparation of farnesene by recombinant host cell F3 using purified glycerol as substrate

The recombinant host cell F3 was inoculated in LB medium (containing 10g peptone, 5g yeast extract and 10g NaCl per liter fermentation broth) and cultured at 30 ℃ and 50rpm for 24 hours to serve as a seed solution.300mL of the formulation containing 16g of peptone, 10g of yeast extract and 5g of NaCl per liter of broth was prepared and divided equally into three 500mL Erlenmeyer flasks (three replicates). The purified glycerol was sterilized at 121 ℃ for 20 min. Under aseptic conditions, 3.75g of sterilized glycerol-purified product, 1mL of seed solution, 100ul of a 34g/L chloramphenicol solution, 100ul of a 50g/L kanamycin solution, and 100ul of a 100g/L ampicillin solution were added to each of the three 500mL Erlenmeyer flasks, respectively. Culturing at 37 deg.C and 220rpm to OD₆₀₀100ul of IPTG solution with the concentration of 24g/L, 0.6mL of L-arabinose solution with the concentration of 500g/L and 20mL of n-decane are added into the fermentation liquor between 0.6 and 08, and the induction expression is carried out under the conditions of 30 ℃ and 220 rpm. And taking 1mL of fermentation liquor and 100ul of n-decane every 24h for respectively detecting the cell density and the concentration of farnesene. The results of the experiment are shown in FIG. 7. The results of the 96h fermentation are as follows: cell density OD₆₀₀It was 16.48, and the concentration of farnesene was 2.92 g/L.

Sequence Listing

Seq. 1

TGACGCTTTTTATCGCAACTCTCTACTG

Seq. 2

ACATACGAGCCGGAAGCATAAAGTGTAAA

Seq. 3

GACAATTAATCATCGGCTCGTATAATGT

Seq. 4

TGACAATTAATCATCCGGCTCGT

Seq. 5

CCTTTAGTGAGGGTTAATT

Seq. 6

GAGAAATCATAAAAAATTTATTTGCTTTGT

Seq. 7

TAATACGACTCACTATA

Seq. 8

ATGAAAAATTGTGTCATCGTCAGTGCGGTACGTACTGCTATCGGTAGTTTTAACGGTTCACTCGCTTCCACCAGCGCCATCGACCTGGGGGCGACAGTAATTAAAGCCGCCATTGAACGTGCAAAAATCGATTCACAACACGTTGATGAAGTGATTATGGGTAACGTGTTACAAGCCGGGCTGGGGCAAAATCCGGCGCGTCAGGCACTGTTAAAAAGCGGGCTGGCAGAAACGGTGTGCGGATTCACGGTCAATAAAGTATGTGGTTCGGGTCTTAAAAGTGTGGCGCTTGCCGCCCAGGCCATTCAGGCAGGTCAGGCGCAGAGCATTGTGGCGGGGGGTATGGAAAATATGAGTTTAGCCCCCTACTTACTCGATGCAAAAGCACGCTCTGGTTATCGTCTTGGAGACGGACAGGTTTATGACGTAATCCTGCGCGATGGCCTGATGTGCGCCACCCATGGTTATCATATGGGGATTACCGCCGAAAACGTGGCTAAAGAGTACGGAATTACCCGTGAAATGCAGGATGAACTGGCGCTACATTCACAGCGTAAAGCGGCAGCCGCAATTGAGTCCGGTGCTTTTACAGCCGAAATCGTCCCGGTAAATGTTGTCACTCGAAAGAAAACCTTCGTCTTCAGTCAAGACGAATTCCCGAAAGCGAATTCAACGGCTGAAGCGTTAGGTGCATTGCGCCCGGCCTTCGATAAAGCAGGAACAGTCACCGCTGGGAACGCGTCTGGTATTAACGACGGTGCTGCCGCTCTGGTGATTATGGAAGAATCTGCGGCGCTGGCAGCAGGCCTTACCCCCCTGGCTCGCATTAAAAGTTATGCCAGCGGTGGCGTGCCCCCCGCATTGATGGGTATGGGGCCAGTACCTGCCACGCAAAAAGCGTTACAACTGGCGGGGCTGCAACTGGCGGATATTGATCTCATTGAGGCTAATGAAGCATTTGCTGCACAGTTCCTTGCCGTTGGGAAAAACCTGGGCTTTGATTCTGAGAAAGTGAATGTCAACGGCGGGGCCATCGCGCTCGGGCATCCTATCGGTGCCAGTGGTGCTCGTATTCTGGTCACACTATTACATGCCATGCAGGCACGCGATAAAACGCTGGGGCTGGCAACACTGTGCATTGGCGGCGGTCAGGGAATTGCGATGGTGATTGAACGGTTGAATTAA

Seq. 9

ATGAGTTTTGATATTGCCAAATACCCGACCCTGGCACTGGTCGACTCCACCCAGGAGTTACGACTGTTGCCGAAAGAGAGTTTACCGAAACTCTGCGACGAACTGCGCCGCTATTTACTCGACAGCGTGAGCCGTTCCAGCGGGCACTTCGCCTCCGGGCTGGGCACGGTCGAACTGACCGTGGCGCTGCACTATGTCTACAACACCCCGTTTGACCAATTGATTTGGGATGTGGGGCATCAGGCTTATCCGCATAAAATTTTGACCGGACGCCGCGACAAAATCGGCACCATCCGTCAGAAAGGCGGTCTGCACCCGTTCCCGTGGCGCGGCGAAAGCGAATATGACGTATTAAGCGTCGGGCATTCATCAACCTCCATCAGTGCCGGAATTGGTATTGCGGTTGCTGCCGAAAAAGAAGGCAAAAATCGCCGCACCGTCTGTGTCATTGGCGATGGCGCGATTACCGCAGGCATGGCGTTTGAAGCGATGAATCACGCGGGCGATATCCGTCCTGATATGCTGGTGATTCTCAACGACAATGAAATGTCGATTTCCGAAAATGTCGGCGCGCTCAACAACCATCTGGCACAGCTGCTTTCCGGTAAGCTTTACTCTTCACTGCGCGAAGGCGGGAAAAAAGTTTTCTCTGGCGTGCCGCCAATTAAAGAGCTGCTCAAACGCACCGAAGAACATATTAAAGGCATGGTAGTGCCTGGCACGTTGTTTGAAGAGCTGGGCTTTAACTACATCGGCCCGGTGGACGGTCACGATGTGCTGGGGCTTATCACCACGCTAAAGAACATGCGCGACCTGAAAGGCCCGCAGTTCCTGCATATCATGACCAAAAAAGGTCGTGGTTATGAACCGGCAGAAAAAGACCCGATCACTTTCCACGCCGTGCCTAAATTTGATCCCTCCAGCGGTTGTTTGCCGAAAAGTAGCGGCGGTTTGCCGAGCTATTCAAAAATCTTTGGCGACTGGTTGTGCGAAACGGCAGCGAAAGACAACAAGCTGATGGCGATTACTCCGGCGATGCGTGAAGGTTCCGGCATGGTCGAGTTTTCACGTAAATTCCCGGATCGCTACTTCGACGTGGCAATTGCCGAGCAACACGCGGTGACCTTTGCTGCGGGTCTGGCGATTGGTGGGTACAAACCCATTGTCGCGATTTACTCCACTTTCCTGCAACGCGCCTATGATCAGGTGCTGCATGACGTGGCGATTCAAAAGCTTCCGGTCCTGTTCGCCATCGACCGCGCGGGCATTGTTGGTGCTGACGGTCAAACCCATCAGGGTGCTTTTGATCTCTCTTACCTGCGCTGCATACCGGAAATGGTCATTATGACCCCGAGCGATGAAAACGAATGTCGCCAGATGCTCTATACCGGCTATCACTATAACGATGGCCCGTCAGCGGTGCGCTACCCGCGTGGCAACGCGGTCGGCGTGGAACTGACGCCGCTGGAAAAACTACCAATTGGCAAAGGCATTGTGAAGCGTCGTGGCGAGAAACTGGCGATCCTTAACTTTGGTACGCTGATGCCAGAAGCGGCGAAAGTCGCCGAATCGCTGAACGCCACGCTGGTCGATATGCGTTTTGTGAAACCGCTTGATGAAGCGTTAATTCTGGAAATGGCCGCCAGCCATGAAGCGCTGGTCACCGTAGAAGAAAACGCCATTATGGGCGGCGCAGGCAGCGGCGTGAACGAAGTGCTGATGGCCCATCGTAAACCAGTACCCGTGCTGAACATTGGCCTGCCGGACTTCTTTATTCCGCAAGGAACTCAGGAAGAAATGCGCGCCGAACTCGGCCTCGATGCCGCTGGTATGGAAGCCAAAATCAAGGCCTGGCTGGCATAA

Seq. 10

ATGAAGCAACTCACCATTCTGGGCTCGACCGGCTCGATTGGTTGCAGCACGCTGGACGTGGTGCGCCATAATCCCGAACACTTCCGCGTAGTTGCGCTGGTGGCAGGCAAAAATGTCACTCGCATGGTAGAACAGTGCCTGGAATTCTCTCCCCGCTATGCCGTAATGGACGATGAAGCGAGTGCGAAACTTCTTAAAACGATGCTACAGCAACAGGGTAGCCGCACCGAAGTCTTAAGTGGGCAACAAGCCGCTTGCGATATGGCAGCGCTTGAGGATGTTGATCAGGTGATGGCAGCCATTGTTGGCGCTGCTGGGCTGTTACCTACGCTTGCTGCGATCCGCGCGGGTAAAACCATTTTGCTGGCCAATAAAGAATCACTGGTTACCTGCGGACGTCTGTTTATGGACGCCGTAAAGCAGAGCAAAGCGCAATTGTTACCGGTCGATAGCGAACATAACGCCATTTTTCAGAGTTTACCGCAACCTATCCAGCATAATCTGGGATACGCTGACCTTGAGCAAAATGGCGTGGTGTCCATTTTACTTACCGGGTCTGGTGGCCCTTTCCGTGAGACGCCATTGCGCGATTTGGCAACAATGACGCCGGATCAAGCCTGCCGTCATCCGAACTGGTCGATGGGGCGTAAAATTTCTGTCGATTCGGCTACCATGATGAACAAAGGTCTGGAATACATTGAAGCGCGTTGGCTGTTTAACGCCAGCGCCAGCCAGATGGAAGTGCTGATTCACCCGCAGTCAGTGATTCACTCAATGGTGCGCTATCAGGACGGCAGTGTTCTGGCGCAGCTGGGGGAACCGGATATGCGTACGCCAATTGCCCACACCATGGCATGGCCGAATCGCGTGAACTCTGGCGTGAAGCCGCTCGATTTTTGCAAACTAAGTGCGTTGACATTTGCCGCACCGGATTATGATCGTTATCCATGCCTGAAACTGGCGATGGAGGCGTTCGAACAAGGCCAGGCAGCGACGACAGCATTGAATGCCGCAAACGAAATCACCGTTGCTGCTTTTCTTGCGCAACAAATCCGCTTTACGGATATCGCTGCGTTGAATTTATCCGTACTGGAAAAAATGGATATGCGCGAACCACAATGTGTGGACGATGTGTTATCTGTTGATGCGAACGCGCGTGAAGTCGCCAGAAAAGAGGTGATGCGTCTCGCAAGCTGA

Seq. 11

ATGGCAACCACTCATTTGGATGTTTGCGCCGTGGTTCCGGCGGCCGGATTTGGCCGTCGAATGCAAACGGAATGTCCTAAGCAATATCTCTCAATCGGTAATCAAACCATTCTTGAACACTCGGTGCATGCGCTGCTGGCGCATCCCCGGGTGAAACGTGTCGTCATTGCCATAAGTCCTGGCGATAGCCGTTTTGCACAACTTCCTCTGGCGAATCATCCGCAAATCACCGTTGTAGATGGCGGTGATGAGCGTGCCGATTCCGTGCTGGCAGGTCTGAAAGCCGCTGGCGACGCGCAGTGGGTATTGGTGCATGACGCCGCTCGTCCTTGTTTGCATCAGGATGACCTCGCGCGATTGTTGGCGTTGAGCGAAACCAGCCGCACGGGGGGGATCCTCGCCGCACCAGTGCGCGATACTATGAAACGTGCCGAACCGGGCAAAAATGCCATTGCTCATACCGTTGATCGCAACGGCTTATGGCACGCGCTGACGCCGCAATTTTTCCCTCGTGAGCTGTTACATGACTGTCTGACGCGCGCTCTAAATGAAGGCGCGACTATTACCGACGAAGCCTCGGCGCTGGAATATTGCGGATTCCATCCTCAGTTGGTCGAAGGCCGTGCGGATAACATTAAAGTCACGCGCCCGGAAGATTTGGCACTGGCCGAGTTTTACCTCACCCGAACCATCCATCAGGAGAATACATAA

Seq. 12

ATGCGGACACAGTGGCCCTCTCCGGCAAAACTTAATCTGTTTTTATACATTACCGGTCAGCGTGCGGATGGTTACCACACGCTGCAAACGCTGTTTCAGTTTCTTGATTACGGCGACACCATCAGCATTGAGCTTCGTGACGATGGGGATATTCGTCTGTTAACGCCCGTTGAAGGCGTGGAACATGAAGATAACCTGATCGTTCGCGCAGCGCGATTGTTGATGAAAACTGCGGCAGACAGCGGGCGTCTTCCGACGGGAAGCGGTGCGAATATCAGCATTGACAAGCGTTTGCCGATGGGCGGCGGTCTCGGCGGTGGTTCATCCAATGCCGCGACGGTCCTGGTGGCATTAAATCATCTCTGGCAATGCGGGCTAAGCATGGATGAGCTGGCGGAAATGGGGCTGACGCTGGGCGCAGATGTTCCTGTCTTTGTTCGGGGGCATGCCGCGTTTGCCGAAGGCGTTGGTGAAATACTAACGCCGGTGGATCCGCCAGAGAAGTGGTATCTGGTGGCGCACCCTGGTGTAAGTATTCCGACTCCGGTGATTTTTAAAGATCCTGAACTCCCGCGCAATACGCCAAAAAGGTCAATAGAAACGTTGCTAAAATGTGAATTCAGCAATGATTGCGAGGTTATCGCAAGAAAACGTTTTCGCGAGGTTGATGCGGTGCTTTCCTGGCTGTTAGAATACGCCCCGTCGCGCCTGACTGGGACAGGGGCCTGTGTCTTTGCTGAATTTGATACAGAGTCTGAAGCCCGCCAGGTGCTAGAGCAAGCCCCGGAATGGCTCAATGGCTTTGTGGCGAAAGGCGCTAATCTTTCCCCATTGCACAGAGCCATGCTTTAA

Seq. 13

ATGCGAATTGGACACGGTTTTGACGTACATGCCTTTGGCGGTGAAGGCCCAATTATCATTGGTGGCGTACGCATTCCTTACGAAAAAGGATTGCTGGCGCATTCTGATGGCGACGTGGCGCTCCATGCGTTGACCGATGCATTGCTTGGCGCGGCGGCGCTGGGGGATATCGGCAAGCTGTTCCCGGATACCGATCCGGCATTTAAAGGTGCCGATAGCCGCGAGCTGCTACGCGAAGCCTGGCGTCGTATTCAGGCGAAGGGTTATACCCTTGGCAACGTCGATGTCACTATCATCGCTCAGGCACCGAAGATGTTGCCGCACATTCCACAAATGCGCGTGTTTATTGCCGAAGATCTCGGCTGCCATATGGATGATGTTAACGTGAAAGCCACTACTACGGAAAAACTGGGATTTACCGGACGTGGGGAAGGGATTGCCTGTGAAGCGGTGGCGCTACTCATTAAGGCAACAAAATGA

Seq. 14

ATGCATAACCAGGCTCCAATTCAACGTAGAAAATCAACACGTATTTACGTTGGGAATGTGCCGATTGGCGATGGTGCTCCCATCGCCGTACAGTCCATGACCAATACGCGTACGACAGACGTCGAAGCAACGGTCAATCAAATCAAGGCGCTGGAACGCGTTGGCGCTGATATCGTCCGTGTATCCGTACCGACGATGGACGCGGCAGAAGCGTTCAAACTCATCAAACAGCAGGTTAACGTGCCGCTGGTGGCTGACATCCACTTCGACTATCGCATTGCGCTGAAAGTAGCGGAATACGGCGTCGATTGTCTGCGTATTAACCCTGGCAATATCGGTAATGAAGAGCGTATTCGCATGGTGGTTGACTGTGCGCGCGATAAAAACATTCCGATCCGTATTGGCGTTAACGCCGGATCGCTGGAAAAAGATCTGCAAGAAAAGTATGGCGAACCGACGCCGCAGGCGTTGCTGGAATCTGCCATGCGTCATGTTGATCATCTCGATCGCCTGAACTTCGATCAGTTCAAAGTCAGCGTGAAAGCGTCTGACGTCTTCCTCGCTGTTGAGTCTTATCGTTTGCTGGCAAAACAGATCGATCAGCCGTTGCATCTGGGGATCACCGAAGCCGGTGGTGCGCGCAGCGGGGCAGTAAAATCCGCCATTGGTTTAGGTCTGCTGCTGTCTGAAGGCATCGGCGACACGCTGCGCGTATCGCTGGCGGCCGATCCGGTCGAAGAGATCAAAGTCGGTTTCGATATTTTGAAATCGCTGCGTATCCGTTCGCGAGGGATCAACTTCATCGCCTGCCCGACCTGTTCGCGTCAGGAATTTGATGTTATCGGTACGGTTAACGCGCTGGAGCAACGCCTGGAAGATATCATCACTCCGATGGACGTTTCGATTATCGGCTGCGTGGTGAATGGCCCAGGTGAGGCGCTGGTTTCTACACTCGGCGTCACCGGCGGCAACAAGAAAAGCGGCCTCTATGAAGATGGCGTGCGCAAAGACCGTCTGGACAACAACGATATGATCGACCAGCTGGAAGCACGCATTCGTGCGAAAGCCAGTCAGCTGGACGAAGCGCGTCGAATTGACGTTCAGCAGGTTGAAAAATAA

Seq. 15

ATGCAGATCCTGTTGGCCAACCCGCGTGGTTTTTGTGCCGGGGTAGACCGCGCTATCAGCATTGTTGAAAACGCGCTGGCCATTTACGGCGCACCGATATATGTCCGTCACGAAGTGGTACATAACCGCTATGTGGTCGATAGCTTGCGTGAGCGTGGGGCTATCTTTATTGAGCAGATTAGCGAAGTACCGGACGGCGCGATCCTGATTTTCTCCGCACACGGTGTTTCTCAGGCGGTACGTAACGAAGCAAAAAGTCGCGATTTGACGGTGTTTGATGCCACCTGTCCGCTGGTGACCAAAGTGCATATGGAAGTCGCCCGCGCCAGTCGCCGTGGCGAAGAATCTATTCTCATCGGTCACGCCGGGCACCCGGAAGTGGAAGGGACAATGGGCCAGTACAGTAACCCGGAAGGGGGAATGTATCTGGTCGAATCGCCGGACGATGTGTGGAAACTGACGGTCAAAAACGAAGAGAAGCTCTCCTTTATGACCCAGACCACGCTGTCGGTGGATGACACGTCTGATGTGATCGACGCGCTGCGTAAACGCTTCCCGAAAATTGTCGGTCCGCGCAAAGATGACATCTGCTACGCCACGACTAACCGTCAGGAAGCGGTACGCGCCCTGGCAGAACAGGCGGAAGTTGTGTTGGTGGTCGGTTCGAAAAACTCCTCCAACTCCAACCGTCTGGCGGAGCTGGCCCAGCGTATGGGCAAACGCGCGTTTTTGATTGACGATGCGAAAGACATCCAGGAAGAGTGGGTGAAAGAGGTTAAATGCGTCGGCGTGACTGCGGGCGCATCGGCTCCGGATATTCTGGTGCAGAATGTGGTGGCACGTTTGCAGCAGCTGGGCGGTGGTGAAGCCATTCCGCTGGAAGGCCGTGAAGAAAACATTGTTTTCGAAGTGCCGAAAGAGCTGCGTGTCGATATTCGTGAAGTCGATTAA

Seq. 16

ATGCAAACGGAACACGTCATTTTATTGAATGCACAGGGAGTTCCCACGGGTACGCTGGAAAAGTATGCCGCACACACGGCAGACACCCGCTTACATCTCGCGTTCTCCAGTTGGCTGTTTAATGCCAAAGGACAATTATTAGTTACCCGCCGCGCACTGAGCAAAAAAGCATGGCCTGGCGTGTGGACTAACTCGGTTTGTGGGCACCCACAACTGGGAGAAAGCAACGAAGACGCAGTGATCCGCCGTTGCCGTTATGAGCTTGGCGTGGAAATTACGCCTCCTGAATCTATCTATCCTGACTTTCGCTACCGCGCCACCGATCCGAGTGGCATTGTGGAAAATGAAGTGTGTCCGGTATTTGCCGCACGCACCACTAGTGCGTTACAGATCAATGATGATGAAGTGATGGATTATCAATGGTGTGATTTAGCAGATGTATTACACGGTATTGATGCCACGCCGTGGGCGTTCAGTCCGTGGATGGTGATGCAGGCGACAAATCGCGAAGCCAGAAAACGATTATCTGCATTTACCCAGCTTAAATAA

Seq. 17

ATGGACTTTCCGCAGCAACTCGAAGCCTGCGTTAAGCAGGCCAACCAGGCGCTGAGCCGTTTTATCGCCCCACTGCCCTTTCAGAACACTCCCGTGGTCGAAACCATGCAGTATGGCGCATTATTAGGTGGTAAGCGCCTGCGACCTTTCCTGGTTTATGCCACCGGTCATATGTTCGGCGTTAGCACAAACACGCTGGACGCACCCGCTGCCGCCGTTGAGTGTATCCACGCTTACTCATTAATTCATGATGATTTACCGGCAATGGATGATGACGATCTGCGTCGCGGTTTGCCAACCTGCCATGTGAAGTTTGGCGAAGCAAACGCGATTCTCGCTGGCGACGCTTTACAAACGCTGGCGTTCTCGATTTTAAGCGATGCCGATATGCCGGAAGTGTCGGACCGCGACAGAATTTCGATGATTTCTGAACTGGCGAGCGCCAGTGGTATTGCCGGAATGTGCGGTGGTCAGGCATTAGATTTAGACGCGGAAGGCAAACACGTACCTCTGGACGCGCTTGAGCGTATTCATCGTCATAAAACCGGCGCATTGATTCGCGCCGCCGTTCGCCTTGGTGCATTAAGCGCCGGAGATAAAGGACGTCGTGCTCTGCCGGTACTCGACAAGTATGCAGAGAGCATCGGCCTTGCCTTCCAGGTTCAGGATGACATCCTGGATGTGGTGGGAGATACTGCAACGTTGGGAAAACGCCAGGGTGCCGACCAGCAACTTGGTAAAAGTACCTACCCTGCACTTCTGGGTCTTGAGCAAGCCCGGAAGAAAGCCCGGGATCTGATCGACGATGCCCGTCAGTCGCTGAAACAACTGGCTGAACAGTCACTCGATACCTCGGCACTGGAAGCGCTAGCGGACTACATCATCCAGCGTAATAAATAA

Seq. 18

ATGAAACTCTCAACTAAACTTTGTTGGTGTGGTATTAAAGGAAGACTTAGGCCGCAAAAGCAACAACAATTACACAATACAAACTTGCAAATGACTGAACTAAAAAAACAAAAGACCGCTGAACAAAAAACCAGACCTCAAAATGTCGGTATTAAAGGTATCCAAATTTACATCCCAACTCAATGTGTCAACCAATCTGAGCTAGAGAAATTTGATGGCGTTTCTCAAGGTAAATACACAATTGGTCTGGGCCAAACCAACATGTCTTTTGTCAATGACAGAGAAGATATCTACTCGATGTCCCTAACTGTTTTGTCTAAGTTGATCAAGAGTTACAACATCGACACCAACAAAATTGGTAGATTAGAAGTCGGTACTGAAACTCTGATTGACAAGTCCAAGTCTGTCAAGTCTGTCTTGATGCAATTGTTTGGTGAAAACACTGACGTCGAAGGTATTGACACGCTTAATGCCTGTTACGGTGGTACCAACGCGTTGTTCAACTCTTTGAACTGGATTGAATCTAACGCATGGGATGGTAGAGACGCCATTGTAGTTTGCGGTGATATTGCCATCTACGATAAGGGTGCCGCAAGACCAACCGGTGGTGCCGGTACTGTTGCTATGTGGATCGGTCCTGATGCTCCAATTGTATTTGACTCTGTAAGAGCTTCTTACATGGAACACGCCTACGATTTTTACAAGCCAGATTTCACCAGCGAATATCCTTACGTCGATGGTCATTTTTCATTAACTTGTTACGTCAAGGCTCTTGATCAAGTTTACAAGAGTTATTCCAAGAAGGCTATTTCTAAAGGGTTGGTTAGCGATCCCGCTGGTTCGGATGCTTTGAACGTTTTGAAATATTTCGACTACAACGTTTTCCATGTTCCAACCTGTAAATTGGTCACAAAATCATACGGTAGATTACTATATAACGATTTCAGAGCCAATCCTCAATTGTTCCCAGAAGTTGACGCCGAATTAGCTACTCGCGATTATGACGAATCTTTAACCGATAAGAACATTGAAAAAACTTTTGTTAATGTTGCTAAGCCATTCCACAAAGAGAGAGTTGCCCAATCTTTGATTGTTCCAACAAACACAGGTAACATGTACACCGCATCTGTTTATGCCGCCTTTGCATCTCTATTAAACTATGTTGGATCTGACGACTTACAAGGCAAGCGTGTTGGTTTATTTTCTTACGGTTCCGGTTTAGCTGCATCTCTATATTCTTGCAAAATTGTTGGTGACGTCCAACATATTATCAAGGAATTAGATATTACTAACAAATTAGCCAAGAGAATCACCGAAACTCCAAAGGATTACGAAGCTGCCATCGAATTGAGAGAAAATGCCCATTTGAAGAAGAACTTCAAACCTCAAGGTTCCATTGAGCATTTGCAAAGTGGTGTTTACTACTTGACCAACATCGATGACAAATTTAGAAGATCTTACGATGTTAAAAAATAA

Seq. 19 ATGTCACTTCCCTTAAAAACGATAGTACATTTGGTAAAGCCCTTTGCTTGCACTGCTAGGTTTAGTGCGAGATACCCAATCCACGTCATTGTTGTTGCTGTTTTATTGAGTGCCGCTGCTTATCTATCCGTGACACAATCTTACCTTAACGAATGGAAGCTGGACTCTAATCAGTATTCTACATACTTAAGCATAAAGCCGGATGAGTTGTTTGAAAAATGCACACACTACTATAGGTCTCCTGTGTCTGATACATGGAAGTTACTCAGCTCTAAAGAAGCCGCCGATATTTATACCCCTTTTCATTATTATTTGTCTACCATAAGTTTTCAAAGTAAGGACAATTCAACGACTTTGCCTTCCCTTGATGACGTTATTTACAGTGTTGACCATACCAGGTACTTATTAAGTGAAGAGCCAAAGATACCAACTGAACTAGTGTCTGAAAACGGAACGAAATGGAGATTGAGAAACAACAGCAATTTTATTTTGGACCTGCATAATATTTACCGAAATATGGTGAAGCAATTTTCTAACAAAACGAGCGAATTTGATCAGTTCGATTTGTTTATCATCCTAGCTGCTTACCTTACTCTTTTTTATACTCTCTGTTGCCTGTTTAATGACATGAGGAAAATCGGATCAAAGTTTTGGTTAAGCTTTTCTGCTCTTTCAAACTCTGCATGCGCATTATATTTATCGCTGTACACAACTCACAGTTTATTGAAGAAACCGGCTTCCTTATTAAGTTTGGTCATTGGACTACCATTTATCGTAGTAATTATTGGCTTTAAGCATAAAGTTCGACTTGCGGCATTCTCGCTACAAAAATTCCACAGAATTAGTATTGACAAGAAAATAACGGTAAGCAACATTATTTATGAGGCTATGTTTCAAGAAGGTGCCTACTTAATCCGCGACTACTTATTTTATATTAGCTCCTTCATTGGATGTGCTATTTATGCTAGACATCTTCCCGGATTGGTCAATTTCTGTATTTTGTCTACATTTATGCTAGTTTTCGACTTGCTTTTGTCTGCTACTTTTTATTCTGCCATTTTATCAATGAAGCTGGAAATTAACATCATTCACAGATCAACCGTCATCAGACAGACTTTGGAAGAGGACGGAGTTGTCCCAACTACAGCAGATATTATATATAAGGATGAAACTGCCTCAGAACCACATTTTTTGAGATCTAACGTGGCTATCATTCTGGGAAAAGCATCAGTTATTGGTCTTTTGCTTCTGATCAACCTTTATGTTTTCACAGATAAGTTAAATGCTACAATACTAAACACGGTATATTTTGACTCTACAATTTACTCGTTACCAAATTTTATCAATTATAAAGATATTGGCAATCTCAGCAATCAAGTGATCATTTCCGTGTTGCCAAAGCAATATTATACTCCGCTGAAAAAATACCATCAGATCGAAGATTCTGTTCTACTTATCATTGATTCCGTTAGCAATGCTATTCGGGACCAATTTATCAGCAAGTTACTTTTTTTTGCATTTGCAGTTAGTATTTCCATCAATGTCTACTTACTGAATGCTGCAAAAATTCACACAGGATACATGAACTTCCAACCACAATCAAATAAGATCGATGATCTTGTTGTTCAGCAAAAATCGGCAACGATTGAGTTTTCAGAAACTCGAAGTATGCCTGCTTCTTCTGGCCTAGAAACTCCAGTGACCGCGAAAGATATAATTATCTCTGAAGAAATCCAGAATAACGAATGCGTCTATGCTTTGAGTTCCCAGGACGAGCCTATCCGTCCTTTATCGAATTTAGTGGAACTTATGGAGAAAGAACAATTAAAGAACATGAATAATACTGAGGTTTCGAATCTTGTCGTCAACGGTAAACTGCCATTATATTCCTTAGAGAAAAAATTAGAGGACACAACTCGTGCGGTTTTAGTTAGGAGAAAGGCACTTTCAACTTTGGCTGAATCGCCAATTTTAGTTTCCGAAAAATTGCCCTTCAGAAATTATGATTATGATCGCGTTTTTGGAGCTTGCTGTGAAAATGTCATCGGCTATATGCCAATACCAGTTGGTGTAATTGGTCCATTAATTATTGATGGAACATCTTATCACATACCAATGGCAACCACGGAAGGTTGTTTAGTGGCTTCAGCTATGCGTGGTTGCAAAGCCATCAATGCTGGTGGTGGTGCAACAACTGTTTTAACCAAAGATGGTATGACTAGAGGCCCAGTCGTTCGTTTCCCTACTTTAATAAGATCTGGTGCCTGCAAGATATGGTTAGACTCGGAAGAGGGACAAAATTCAATTAAAAAAGCTTTTAATTCTACATCAAGGTTTGCACGTTTGCAACATATTCAAACCTGTCTAGCAGGCGATTTGCTTTTTATGAGATTTCGGACAACTACCGGTGACGCAATGGGTATGAACATGATATCGAAAGGTGTCGAATACTCTTTGAAACAAATGGTAGAAGAATATGGTTGGGAAGATATGGAAGTTGTCTCCGTATCTGGTAACTATTGTACTGATAAGAAACCTGCCGCAATCAATTGGATTGAAGGTCGTGGTAAAAGTGTCGTAGCTGAAGCTACTATTCCTGGTGATGTCGTAAAAAGTGTTTTAAAGAGCGATGTTTCCGCTTTAGTTGAATTAAATATATCCAAGAACTTGGTTGGATCCGCAATGGCTGGATCTGTTGGTGGTTTCAACGCGCACGCAGCTAATTTGGTCACTGCACTTTTCTTGGCATTAGGCCAAGATCCTGCGCAGAACGTCGAAAGTTCCAACTGTATAACTTTGATGAAGGAAGTTGATGGTGATTTAAGGATCTCTGTTTCCATGCCATCTATTGAAGTTGGTACGATTGGCGGGGGTACTGTTCTGGAGCCTCAGGGCGCCATGCTTGATCTTCTCGGCGTTCGTGGTCCTCACCCCACTGAACCTGGAGCAAATGCTAGGCAATTAGCTAGAATAATCGCGTGTGCTGTCTTGGCTGGTGAACTGTCTCTGTGCTCCGCACTTGCTGCCGGTCACCTGGTACAAAGCCATATGACTCACAACCGTAAAACAAACAAAGCCAATGAACTGCCACAACCAAGTAACAAAGGGCCCCCCTGTAAAACCTCAGCATTATTATAA

Seq. 20

ATGTCATTACCGTTCTTAACTTCTGCACCGGGAAAGGTTATTATTTTTGGTGAACACTCTGCTGTGTACAACAAGCCTGCCGTCGCTGCTAGTGTGTCTGCGTTGAGAACCTACCTGCTAATAAGCGAGTCATCTGCACCAGATACTATTGAATTGGACTTCCCGGACATTAGCTTTAATCATAAGTGGTCCATCAATGATTTCAATGCCATCACCGAGGATCAAGTAAACTCCCAAAAATTGGCCAAGGCTCAACAAGCCACCGATGGCTTGTCTCAGGAACTCGTTAGTCTTTTGGATCCGTTGTTAGCTCAACTATCCGAATCCTTCCACTACCATGCAGCGTTTTGTTTCCTGTATATGTTTGTTTGCCTATGCCCCCATGCCAAGAATATTAAGTTTTCTTTAAAGTCTACTTTACCCATCGGTGCTGGGTTGGGCTCAAGCGCCTCTATTTCTGTATCACTGGCCTTAGCTATGGCCTACTTGGGGGGGTTAATAGGATCTAATGACTTGGAAAAGCTGTCAGAAAACGATAAGCATATAGTGAATCAATGGGCCTTCATAGGTGAAAAGTGTATTCACGGTACCCCTTCAGGAATAGATAACGCTGTGGCCACTTATGGTAATGCCCTGCTATTTGAAAAAGACTCACATAATGGAACAATAAACACAAACAATTTTAAGTTCTTAGATGATTTCCCAGCCATTCCAATGATCCTAACCTATACTAGAATTCCAAGGTCTACAAAAGATCTTGTTGCTCGCGTTCGTGTGTTGGTCACCGAGAAATTTCCTGAAGTTATGAAGCCAATTCTAGATGCCATGGGTGAATGTGCCCTACAAGGCTTAGAGATCATGACTAAGTTAAGTAAATGTAAAGGCACCGATGACGAGGCTGTAGAAACTAATAATGAACTGTATGAACAACTATTGGAATTGATAAGAATAAATCATGGACTGCTTGTCTCAATCGGTGTTTCTCATCCTGGATTAGAACTTATTAAAAATCTGAGCGATGATTTGAGAATTGGCTCCACAAAACTTACCGGTGCTGGTGGCGGCGGTTGCTCTTTGACTTTGTTACGAAGAGACATTACTCAAGAGCAAATTGACAGCTTCAAAAAGAAATTGCAAGATGATTTTAGTTACGAGACATTTGAAACAGACTTGGGTGGGACTGGCTGCTGTTTGTTAAGCGCAAAAAATTTGAATAAAGATCTTAAAATCAAATCCCTAGTATTCCAATTATTTGAAAATAAAACTACCACAAAGCAACAAATTGACGATCTATTATTGCCAGGAAACACGAATTTACCATGGACTTCATAA

Seq. 21

ATGTCAGAGTTGAGAGCCTTCAGTGCCCCAGGGAAAGCGTTACTAGCTGGTGGATATTTAGTTTTAGATACAAAATATGAAGCATTTGTAGTCGGATTATCGGCAAGAATGCATGCTGTAGCCCATCCTTACGGTTCATTGCAAGGGTCTGATAAGTTTGAAGTGCGTGTGAAAAGTAAACAATTTAAAGATGGGGAGTGGCTGTACCATATAAGTCCTAAAAGTGGCTTCATTCCTGTTTCGATAGGCGGATCTAAGAACCCTTTCATTGAAAAAGTTATCGCTAACGTATTTAGCTACTTTAAACCTAACATGGACGACTACTGCAATAGAAACTTGTTCGTTATTGATATTTTCTCTGATGATGCCTACCATTCTCAGGAGGATAGCGTTACCGAACATCGTGGCAACAGAAGATTGAGTTTTCATTCGCACAGAATTGAAGAAGTTCCCAAAACAGGGCTGGGCTCCTCGGCAGGTTTAGTCACAGTTTTAACTACAGCTTTGGCCTCCTTTTTTGTATCGGACCTGGAAAATAATGTAGACAAATATAGAGAAGTTATTCATAATTTAGCACAAGTTGCTCATTGTCAAGCTCAGGGTAAAATTGGAAGCGGGTTTGATGTAGCGGCGGCAGCATATGGATCTATCAGATATAGAAGATTCCCACCCGCATTAATCTCTAATTTGCCAGATATTGGAAGTGCTACTTACGGCAGTAAACTGGCGCATTTGGTTGATGAAGAAGACTGGAATATTACGATTAAAAGTAACCATTTACCTTCGGGATTAACTTTATGGATGGGCGATATTAAGAATGGTTCAGAAACAGTAAAACTGGTCCAGAAGGTAAAAAATTGGTATGATTCGCATATGCCAGAAAGCTTGAAAATATATACAGAACTCGATCATGCAAATTCTAGATTTATGGATGGACTATCTAAACTAGATCGCTTACACGAGACTCATGACGATTACAGCGATCAGATATTTGAGTCTCTTGAGAGGAATGACTGTACCTGTCAAAAGTATCCTGAAATCACAGAAGTTAGAGATGCAGTTGCCACAATTAGACGTTCCTTTAGAAAAATAACTAAAGAATCTGGTGCCGATATCGAACCTCCCGTACAAACTAGCTTATTGGATGATTGCCAGACCTTAAAAGGAGTTCTTACTTGCTTAATACCTGGTGCTGGTGGTTATGACGCCATTGCAGTGATTACTAAGCAAGATGTTGATCTTAGGGCTCAAACCGCTAATGACAAAAGATTTTCTAAGGTTCAATGGCTGGATGTAACTCAGGCTGACTGGGGTGTTAGGAAAGAAAAAGATCCGGAAACTTATCTTGATAAATAA

Seq. 22

ATGACCGTTTACACAGCATCCGTTACCGCACCCGTCAACATCGCAACCCTTAAGTATTGGGGGAAAAGGGACACGAAGTTGAATCTGCCCACCAATTCGTCCATATCAGTGACTTTATCGCAAGATGACCTCAGAACGTTGACCTCTGCGGCTACTGCACCTGAGTTTGAACGCGACACTTTGTGGTTAAATGGAGAACCACACAGCATCGACAATGAAAGAACTCAAAATTGTCTGCGCGACCTACGCCAATTAAGAAAGGAAATGGAATCGAAGGACGCCTCATTGCCCACATTATCTCAATGGAAACTCCACATTGTCTCCGAAAATAACTTTCCTACAGCAGCTGGTTTAGCTTCCTCCGCTGCTGGCTTTGCTGCATTGGTCTCTGCAATTGCTAAGTTATACCAATTACCACAGTCAACTTCAGAAATATCTAGAATAGCAAGAAAGGGGTCTGGTTCAGCTTGTAGATCGTTGTTTGGCGGATACGTGGCCTGGGAAATGGGAAAAGCTGAAGATGGTCATGATTCCATGGCAGTACAAATCGCAGACAGCTCTGACTGGCCTCAGATGAAAGCTTGTGTCCTAGTTGTCAGCGATATTAAAAAGGATGTGAGTTCCACTCAGGGTATGCAATTGACCGTGGCAACCTCCGAACTATTTAAAGAAAGAATTGAACATGTCGTACCAAAGAGATTTGAAGTCATGCGTAAAGCCATTGTTGAAAAAGATTTCGCCACCTTTGCAAAGGAAACAATGATGGATTCCAACTCTTTCCATGCCACATGTTTGGACTCTTTCCCTCCAATATTCTACATGAATGACACTTCCAAGCGTATCATCAGTTGGTGCCACACCATTAATCAGTTTTACGGAGAAACAATCGTTGCATACACGTTTGATGCAGGTCCAAATGCTGTGTTGTACTACTTAGCTGAAAATGAGTCGAAACTCTTTGCATTTATCTATAAATTGTTTGGCTCTGTTCCTGGATGGGACAAGAAATTTACTACTGAGCAGCTTGAGGCTTTCAACCATCAATTTGAATCATCTAACTTTACTGCACGTGAATTGGATCTTGAGTTGCAAAAGGATGTTGCCAGAGTGATTTTAACTCAAGTCGGTTCAGGCCCACAAGAAACAAACGAATCTTTGATTGACGCAAAGACTGGTCTACCAAAGGAATAA

Seq. 23

ATGAAAACAGTAGTTATTATTGATGCATTACGAACACCAATTGGAAAATATAAAGGCAGCTTAAGTCAAGTAAGTGCCGTAGACTTAGGAACACATGTTACAACACAACTTTTAAAAAGACATTCCACTATTTCTGAAGAAATTGATCAAGTAATCTTTGGAAATGTTTTACAAGCTGGAAATGGCCAAAATCCCGCACGACAAATAGCAATAAACAGCGGTTTATCTCATGAAATTCCCGCAATGACAGTTAATGAGGTCTGCGGATCAGGAATGAAGGCCGTTATTTTGGCGAAACAATTGATTCAATTAGGAGAAGCGGAAGTTTTAATTGCTGGCGGGATTGAGAATATGTCCCAAGCACCTAAATTACAACGATTTAATTACGAAACAGAAAGCTATGATGCGCCTTTTTCTAGTATGATGTACGATGGGTTAACGGATGCCTTTAGTGGTCAAGCAATGGGCTTAACTGCTGAAAATGTGGCCGAAAAGTATCATGTAACTAGAGAAGAGCAAGATCAATTTTCTGTACATTCACAATTAAAAGCAGCTCAAGCACAAGCAGAAGGGATATTCGCTGACGAAATAGCCCCATTAGAAGTATCAGGAACGCTTGTGGAGAAAGATGAAGGGATTCGCCCTAATTCGAGCGTTGAGAAGCTAGGAACGCTTAAAACAGTTTTTAAAGAAGACGGTACTGTAACAGCAGGGAATGCATCAACCATTAATGATGGGGCTTCTGCTTTGATTATTGCTTCACAAGAATATGCCGAAGCACACGGTCTTCCTTATTTAGCTATTATTCGAGACAGTGTGGAAGTCGGTATTGATCCAGCCTATATGGGAATTTCGCCGATTAAAGCCATTCAAAAACTGTTAGCGCGCAATCAACTTACTACGGAAGAAATTGATCTGTATGAAATCAACGAAGCATTTGCAGCAACTTCAATCGTGGTCCAAAGAGAACTGGCTTTACCAGAGGAAAAGGTCAACATTTATGGTGGCGGTATTTCATTAGGTCATGCGATTGGTGCCACAGGTGCTCGTTTATTAACGAGTTTAAGTTATCAATTAAATCAAAAAGAAAAGAAATATGGAGTGGCTTCTTTATGTATCGGCGGTGGCTTAGGACTCGCTATGCTACTAGAGAGACCTCAGCAAAAAAAAAACAGCCGATTTTATCAAATGAGTCCTGAGGAACGCCTGGCTTCTCTTCTTAATGAAGGCCAGATTTCTGCTGATACAAAAAAAGAATTTGAAAATACGGCTTTATCTTCGCAGATTGCCAATCATATGATTGAAAATCAAATCAGTGAAACAGAAGTGCCGATGGGCGTTGGCTTACATTTAACAGTGGACGAAACTGATTATTTGGTACCAATGGCGACAGAAGAGCCCTCAGTGATTGCGGCTTTGAGTAATGGTGCAAAAATAGCACAAGGATTTAAAACAGTGAATCAACAACGTTTAATGCGTGGACAAATCGTTTTTTACGATGTTGCAGACGCCGAGTCATTGATTGATGAACTACAAGTAAGAGAAACGGAAATTTTTCAACAAGCAGAGTTAAGTTATCCATCTATCGTTAAACGCGGCGGCGGCTTAAGAGATTTGCAATATCGTGCTTTTGATGAATCATTTGTATCTGTCGACTTTTTAGTAGATGTTAAGGATGCAATGGGGGCAAATATCGTTAACGCTATGTTGGAAGGTGTGGCCGAGTTGTTCCGTGAATGGTTTGCGGAGCAAAAGATTTTATTCAGTATTTTAAGTAATTATGCCACGGAGTCGGTTGTTACGATGAAAACGGCTATTCCAGTTTCACGTTTAAGTAAGGGGAGCAATGGCCGGGAAATTGCTGAAAAAATTGTTTTAGCTTCACGCTATGCTTCATTAGATCCTTATCGGGCAGTCACGCATAACAAAGGGATCATGAATGGCATTGAAGCTGTCGTTTTAGCTACAGGAAATGATACACGCGCTGTTAGCGCTTCTTGTCATGCTTTTGCGGTGAAGGAAGGTCGCTACCAAGGTTTGACTAGTTGGACGCTGGATGGCGAACAACTAATTGGTGAAATTTCAGTTCCGCTTGCGTTAGCCACGGTTGGCGGTGCCACAAAAGTCTTACCTAAATCTCAAGCAGCTGCTGATTTGTTAGCAGTGACGGATGCAAAAGAACTAAGTCGAGTAGTAGCGGCTGTTGGTTTGGCACAAAATTTAGCGGCGTTACGGGCCTTAGTCTCTGAAGGAATTCAAAAAGGACACATGGCTCTACAAGCACGTTCTTTAGCGATGACGGTCGGAGCTACTGGTAAAGAAGTTGAGGCAGTCGCTCAACAATTAAAACGTCAAAAAACGATGAACCAAGACCGAGCCTTGGCTATTTTAAATGATTTAAGAAAACAATAA

Seq. 24

ATGACAATTGGGATTGATAAAATTAGTTTTTTTGTGCCCCCTTATTATATTGATATGACGGCACTGGCTGAAGCCAGAAATGTAGACCCTGGAAAATTTCATATTGGTATTGGGCAAGACCAAATGGCGGTGAACCCAATCAGCCAAGATATTGTGACATTTGCAGCCAATGCCGCAGAAGCGATCTTGACCAAAGAAGATAAAGAGGCCATTGATATGGTGATTGTCGGGACTGAGTCCAGTATCGATGAGTCAAAAGCGGCCGCAGTTGTCTTACATCGTTTAATGGGGATTCAACCTTTCGCTCGCTCTTTCGAAATCAAGGAAGCTTGTTACGGAGCAACAGCAGGCTTACAGTTAGCTAAGAATCACGTAGCCTTACATCCAGATAAAAAAGTCTTGGTTGTAGCAGCAGATATTGCAAAATATGGATTAAATTCTGGCGGTGAGCCTACACAAGGAGCTGGGGCGGTTGCAATGTTAGTTGCTAGTGAACCGCGCATCTTGGCTTTAAAAGAGGATAATGTGATGCTGACGCAAGATATCTATGACTTTTGGCGTCCAACAGGCCATCCGTATCCTATGGTCGATGGTCCTTTGTCAAACGAAACCTACATCCAATCTTTTGCCCAAGTCTGGGATGAACATAAAAAAAGAACCGGTCTTGATTTTGCAGATTATGATGCTTTAGCGTTCCATATTCCTTACACAAAAATGGGCAAAAAAGCCTTATTAGCAAAAATCTCCGACCAAACTGAAGCAGAACAGGAACGAATTTTAGCCCGTTATGAAGAAAGCATCATCTATAGTCGTCGCGTAGGAAACTTGTATACGGGTTCACTTTATCTGGGACTCATTTCCCTTTTAGAAAATGCAACGACTTTAACCGCAGGCAATCAAATTGGGTTATTCAGTTATGGTTCTGGTGCTGTCGCTGAATTTTTCACTGGTGAATTAGTAGCTGGTTATCAAAATCATTTACAAAAAGAAACTCATTTAGCACTGCTAGATAATCGGACAGAACTTTCTATCGCTGAATATGAAGCCATGTTTGCAGAAACTTTAGACACAGATATTGATCAAACGTTAGAAGATGAATTAAAATATAGTATTTCTGCTATTAATAATACCGTTCGCTCTTATCGAAACTAA

Seq. 25

ATGAGTACACTGCCGATCAGTAGTGTGAGCTTCAGTAGCAGCACCAGCCCGCTGGTGGTGGACGATAAAGTGAGTACCAAGCAGGACGTTATTCGCCATACCATGAACTTTAACGCAAGCATCTGGGGCGACCAGTTCCTGACCTACGATGAACCGGAGGATCTGGTGATGAAGAAGCAGCTGGTGGAAGAATTAAAAGAAGAAGTTAAAAAAGAACTGATTACCATTAAAGGCAGCAATGAGCCGATGCAGCACGTGAAGCTGCTGGAGCTGATTGATGCAGTTCAGCGCCTGGGCATCGCCTATCATTTTGAAGAAGAAATCGAGGAAGCACTGCAGCACATCCATGTTACCTACGGTGAACAGTGGGTGGACAAAGAGAACCTGCAAAGCATCAGCCTGTGGTTCCGCTTACTGCGCCAGCAAGGTTTCAACGTGAGCAGCGGCGTGTTCAAAGATTTCATGGATGAGAAAGGTAAATTTAAGGAGAGTCTGTGCAATGATGCACAGGGCATCTTAGCCCTGTACGAGGCCGCCTTTATGCGCGTGGAGGACGAAACCATCCTGGACAACGCACTGGAATTCACCAAAGTGCATCTGGATATCATTGCCAAGGACCCGAGTTGCGACAGCAGCCTGCGTACACAGATTCATCAAGCACTGAAACAACCTTTACGTCGCCGCCTGGCACGCATTGAAGCCCTGCACTATATGCCGATCTATCAGCAGGAGACCAGCCACAACGAAGTTCTGTTAAAGCTGGCCAAGCTGGACTTCAGCGTGCTGCAGAGCATGCACAAGAAAGAACTGAGCCATATTTGTAAATGGTGGAAGGACTTAGATCTGCAGAACAAACTGCCGTATGTGCGTGATCGCGTTGTTGAGGGTTATTTTTGGATTCTGAGTATCTATTACGAGCCGCAGCATGCCCGTACCCGCATGTTCCTGATGAAGACATGCATGTGGCTGGTGGTGCTGGACGACACCTTTGATAACTACGGCACCTACGAGGAGCTGGAAATTTTCACCCAGGCCGTGGAACGCTGGAGCATTAGCTGTCTGGATATGCTGCCGGAGTACATGAAATTAATTTACCAGGAACTGGTGAACCTGCATGTTGAGATGGAGGAGAGTCTGGAAAAAGAAGGTAAGACATACCAGATCCATTACGTTAAAGAGATGGCCAAGGAGCTGGTGCGTAATTACCTGGTGGAGGCCCGTTGGCTGAAAGAGGGCTATATGCCGACCCTGGAAGAGTACATGAGCGTTAGTATGGTGACCGGTACCTATGGCCTGATGATTGCCCGCAGCTATGTTGGTCGCGGTGATATCGTGACAGAGGATACCTTTAAGTGGGTGAGCAGTTACCCGCCGATCATTAAGGCCAGCTGTGTGATCGTGCGCCTGATGGACGATATCGTGAGCCATAAAGAAGAACAGGAGCGTGGCCATGTTGCCAGCAGTATCGAGTGCTACAGCAAAGAGAGTGGCGCCAGTGAAGAAGAGGCATGTGAGTACATCAGCGGCAAAGTTGAGGACGCCTGGAAAGTGATTAACCGCGAAAGCCTGCGTCCGACAGCAGTTCCGTTCCCGCTGCTGATGCCGGCCATTAATCTGGCCCGTATGTGTGAGGTTCTGTACAGCGTGAACGATGGCTTTACCCATGCCGAGGGCGACATGAAAAGCTATATGAAAAGCTTTTTTGTGCACCCGATGGTGGTTTAA

Claims

1. A method for preparing farnesene by utilizing a biodiesel byproduct is characterized by comprising the following steps:

(1) construction of recombinant host cells for synthesis of farnesene:

constructing three recombinant plasmids which are compatible in the same host cell, including 33-pMvaE-S, 4-pEEM and 28 a-FII; the recombinant plasmid 33-pMvaE-S contains two genes, including MvaE enzyme gene and MvaS enzyme gene, wherein the base number of an exogenous gene carried by an araC promoter is 3564 bp; the MvaE enzyme gene and the MvaS enzyme gene are selected from enterococcus faecalis; the DNA sequence of the MvaE enzyme gene is seq.23; the DNA sequence of the MvaS enzyme gene is seq.24; the sequence of the araC promoter is seq.1; the recombinant plasmid 4-pEEM contains three genes, including mevalonate kinase gene, phosphomevalonate kinase gene and mevalonate pyrophosphate decarboxylase gene, wherein the number of exogenous gene bases carried by a T7 promoter is 3879 bp; the mevalonate kinase gene, the phosphomevalonate kinase gene and the mevalonate pyrophosphate decarboxylase gene are selected from saccharomyces cerevisiae; the DNA sequence of the mevalonate kinase gene is seq.20; the DNA sequence of the phosphomevalonate kinase gene is seq.21; the DNA sequence of the mevalonate pyrophosphate decarboxylase gene is seq.22; the T7 promoter sequence is seq.7; the recombinant plasmid 28a-FII contains three genes, including farnesene synthase gene, farnesene pyrophosphate synthase gene and isopentenyl pyrophosphate isomerase gene, wherein the number of exogenous gene bases carried by a T7 promoter is 3174 bp; the farnesene synthetase gene is selected from an artemisinin cDNA sequence; the isopentenyl pyrophosphate isomerase gene, the farnesene pyrophosphate synthase gene are selected from escherichia coli; the DNA sequence of the farnesene synthetase gene is seq.25; the DNA sequence of the isopentenyl pyrophosphate isomerase gene is seq.16; the DNA sequence of the isopentenyl pyrophosphate isomerase gene is seq.17; the number of bases of the three recombinant plasmids carrying the exogenous genes is within the range of 3000-4000bp, and is within the range of the transcription capability of promoters araC and T7; the three recombinant plasmids are transformed and introduced into host cells to obtain recombinant host cells F3 for synthesizing farnesene;

(2) inoculating the recombinant host cell F3 into a culture medium containing purified biodiesel by-products to perform heterologous induction expression of farnesene.

2. The method of claim 1, wherein said host cell is Escherichia coli; the Escherichia coli is Escherichia coli DH5 a.

3. The method of claim 1, wherein the recombinant plasmid 33-pMvaE-S is a commonly used empty plasmid pBAD-33 constructed from MvaE and MvaS genes by pEASY-Uni Seamless Cloning and Assembly Ki technology; the recombinant plasmid 4-pEEM is obtained by constructing a mevalonate kinase gene, a phosphomevalonate kinase gene and a mevalonate pyrophosphate decarboxylase gene to a commonly used unloaded plasmid pBBR1MCS-4 by a pEASY-Uni Seamless Cloning and Assembly Ki technical means; the recombinant plasmid 28a-FII is obtained by constructing farnesene synthetase gene, farnesene pyrophosphate synthetase gene and isopentenyl pyrophosphate isomerase gene to a commonly used unloaded plasmid pET-28a by pEASY-UniSeamless Cloning and Assembly Ki technical means.

4. The method according to claim 1, characterized in that the purification method is as follows:

a. removing insoluble materials in the biodiesel by-product by centrifugation;

b. removing methanol in the biodiesel by-product by a distillation method;

c. adding phosphoric acid to neutralize the biodiesel byproduct with methanol removed, and centrifuging to obtain the purified biodiesel byproduct for preparing farnesene.

5. The method according to claim 4, wherein the main components of the biodiesel by-product comprise 20-50% of glycerin, 10-35% of methanol, an alkaline catalyst and 5-30% of soap; the centrifugation conditions are that the centrifugation rotating speed is 3000-15000 rpm, and the centrifugation time is 5-60 min; the concentration of the phosphoric acid is 5-60%.

6. The method according to claim 1, wherein the culture medium contains 1-100 g purified biodiesel byproduct, 1-50 g yeast powder, 1-50 g peptone, 1-30 g inorganic salt, 1-1000 mg chloramphenicol, 1-1000 mg ampicillin, and 1-1000 mg kanamycin per liter of culture medium; the heterologous induced expression is carried out by adding 0.1-10% recombinant host cell seed liquid, and culturing at 30-45 deg.C and 50-350 rpm to OD₆₀₀Adding 1-10000 mg of L-arabinose inducer, 1-10000 mg of isopropyl-beta-D-thiogalactoside inducer and 50-1000 mL of extractant into each liter of fermentation liquor between 0.6-08, and performing heterologous induction expression under the conditions of 16-35 ℃ and 50-350 rpm; the extractant is selected from n-hexane, n-decane, dodecane or kerosene.

7. The method of claim 6, wherein the recombinant host cell seed fluid is prepared by: inoculating the recombinant host cell F3 in an LB culture medium, and culturing for 12h at 30 ℃ and 200rpm to obtain a recombinant host cell seed solution; the LB medium contains 10g of peptone, 5g of yeast extract and 10g of NaCl.