CN107400701A - The amplification of circular RNA molecule and sequence measurement - Google Patents
The amplification of circular RNA molecule and sequence measurement Download PDFInfo
- Publication number
- CN107400701A CN107400701A CN201610333965.1A CN201610333965A CN107400701A CN 107400701 A CN107400701 A CN 107400701A CN 201610333965 A CN201610333965 A CN 201610333965A CN 107400701 A CN107400701 A CN 107400701A
- Authority
- CN
- China
- Prior art keywords
- amplification
- circular rna
- rna molecule
- rolling circle
- temperature
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to biology field, discloses a kind of amplification method of circular RNA molecule, and step includes：(1) cell total rna is taken to be mixed with random primer, heat up after annealing；(2) add with constant-temperature amplification enzyme and dNTP the progress reverse transcription and amplification for reversing recording function and rolling circle amplification function.This method is not required to acquisition circular rna to be separated, synchronous to carry out reverse transcription and rolling circle amplification directly using total serum IgE as template, streamline operation, improves detection efficiency；High sensitivity, required sample size greatly reduce, and accuracy rate improves.
Description
Technical field
The present invention relates to biology field, the specially amplification of circular rna and sequence measurement, Yi Jixiang
The reactant mixture answered.
Background technology
Circular rna (circular RNA, circRNA) is a kind of special non-coding RNA molecule,
It is the newest focus of RNA research fields.Different from conventional linear RNA, circular rna does not contain 5 ' and 3 '
End, there is annular enclosed structure, do not influenceed by RNA excision enzymes, expression is more stable, it is not easy to is dropped
Solution.Most of circular rna is made up of exon sequence, has conservative in different plant species, and
Tissue and the expression specificity of different developmental phases be present.Contain 5 ' and 3 ' ends different from conventional linear RNA,
CircRNA has annular enclosed structure, is not influenceed by RNA excision enzymes, and expression is more stable, it is not easy to quilt
Degraded.
Increasing research shows that circRNA and the pathology aspect of a variety of diseases play a role, including coronal
Arterial disease, Parkinson's, mental illness, cancer etc..Due to having between circRNA and the generation of disease
Association, and because the characteristics of in its structure, make it possible to diagnose some diseases as biomarker.
In recent years it is relevant with disease generation that research discloses circRNA.It may be played in terms of disease pathology
Effect.For example, ring-type ANRIL (cANRIL) is long-chain non-coding RNA ANRIL ring-type splicing
Form, its in human cell expression with the site it is several may influence ANRIL splice SNP it is relevant,
INK4/ARF level can be adjusted and increase the risk of atherosclerosis.
In addition, more evidences are shown, circular rna plays extremely important in the horizontal fine settings of miRNA
Effect, by competition binding miRNA come the expression of controlling gene.And with disease association miRNA phase
Interaction then illustrates that circular rna can participate in disease regulation.For example, circular rna ciRS-7 is in human brain group
Expression is enriched in knitting, is interacted with brain specificity microRNA miR-7；And ciRS-7 contains multiple series connection
MiR-7 binding sites, therefore endogenic miRNA sponges can be used as, suppress miR-7 activity.Examine
Consider the important regulatory factor that miR-7 is various various cancers related pathways, while also because can directly adjust a-
Synapse nucleoprotein and ubiquitin protein ligase A (UBE2A) expression and may be with Parkinson and alzheimer
The generation of disease is related, so ciRS-7 is likely to the weight as neurological diseases and cancer generation
Want regulatory factor.
At present, method circular rna being sequenced is：
(1) total serum IgE (total RNA) is obtained from cell sample, and removes rRNA (rRNA)；
(2) linear rna is removed with RNase (RNase) enzymolysis, remaining is circular rna；(3) it is random
Interrupt circular rna；(4) reverse transcriptase is used for template with the circular rna (being now linear) after interrupting
Reacted, reverse transcription produces RNA-cDNA heterochain, and obtains double-strand cDNA, to build library；(5)
Library is sequenced and data analysis.
It is even lower due to weight ratio about 0.1% of the circular rna in cell total rna, therefore,
The purified cyclic RNA for being enough to be used in that library is established after reverse transcription is obtained, required total serum IgE weight must reach
20~100 μ g.To reach preferable Detection results, total serum IgE sample should generally reach more than 50 μ g, carefully
Born of the same parents' sample size is generally no less than 5 × 107It is individual.
According to existing method, total serum IgE sample is handled, and builds library, it is necessary to several days time.
And in existing method, each circular RNA molecule can only obtain a doublestranded cDNA molecule, that is, use
It is single copy in establish library.And during reverse transcription, it may occur however that be mutated and produce the mistake in sequence
By mistake, while sequencing is in itself there is also certain erroneous judgement of mispronouncing, therefore be difficult in existing method to same source
Circular rna sequence is verified.
Therefore, it is necessary to be improved for existing method, to obtain a kind of quick, efficient, sensitive amplification
With the method for detection circular rna.
The content of the invention
A kind of the present invention is intended to provide circular rna rapid amplifying method.
Present invention also offers the sequence measurement of circular RNA molecule, this method can verify to sequence.
Present invention also offers the reactant mixture for expanding circular RNA molecule.
The technical scheme is that using total serum IgE as template,
Technical scheme is：The amplification method of circular RNA molecule, its step include：
(1) cell total rna is taken to be mixed with random primer, heat up after annealing；
(2) constant-temperature amplification enzyme and dNTP with reverse recording function and rolling circle amplification function is added to be reversed
Record and amplification.
Preferably, the circular RNA molecule is eukaryotic circular rna, especially people's cell circular rna,
Base number is 100~1500.
Preferably, in step (1), 60~80 DEG C are warming up to after cell total rna is mixed with random primer
1.5~3 minutes are incubated afterwards, and is cooled to 0~5 DEG C rapidly.
Preferably, in step (2), described has the constant-temperature amplification for reversing recording function and rolling circle amplification function
Enzyme is CAE constant-temperature amplification enzymes.This enzyme is purchased from Shanghai DoGene Inc. (DoGene Inc),
Model N1001 (DoGene CAE Isothermal Amplification Enzyme) is a kind of constant temperature of restructuring
Amplification enzyme, there is rolling circle amplification RCA functions；Found in using and studying, this enzyme also has inverse simultaneously
Transcribe RT functions；The amplification of circular RNA molecule is can be applied to, available for using cell total rna as template,
Expand circular rna.
Preferably, in step (2), the pH value of reaction system is 7~9.5, more preferably 7.8~9, instead
It is 60~80 DEG C to answer temperature.
Preferably, the reaction time of step (2) is 45min~2hr.
The sequence measurement of circular RNA molecule, its step are the circular rna for obtaining above-mentioned amplification method
The amplified production of molecule, for establishing library, and it is sequenced and is analyzed.The amplified production of above-mentioned amplification method
It is applicable to currently used NGS microarray datasets.
Further, sequencing result is carried out into blast with genome to compare, determines ring-shaped sequence therein, institute
The circular rna sequence measured can further study its function.
A kind of rolling circle amplification reactant mixture for circular RNA molecule, it is characterised in that described mixing
Thing includes：
(a) circular RNA molecule or cell total rna molecule；
(b) there is the constant-temperature amplification enzyme for reversing recording function and rolling circle amplification function；
(c) end reaction system pH is maintained to 7~9.5 buffer solution；Preferably, for by finally
PH value of reaction system is maintained at 7.8~9 buffer solution；
(d) random primer；
(e)dNTP。
Technical scheme, the reverse transcription and rolling circle amplification of circular RNA molecule can be realized simultaneously, simplify
Sample treatment program.Rolling circle amplification is a kind of exponential amplification method, and tens are carried on its double-strand cDNA
The copy of individual or even hundreds and thousands of individual circular RNA molecule sequences, the fast efficiency high of speed can be in a short time
Obtain the sequence for establishing library and sequencing.The total serum IgE demand of detection is small, and in sequencing procedure
In, because the copy number of the cDNA upper annular RNA sequences of its acquisition is more, sequence check is convenient for, is excluded
Mistake wherein caused by reverse transcription is mutated.
The advantage of the invention is that：
(1) by this method, circular rna can be specifically expanded, without first removing the core in sample
The impurity such as sugared body RNA, linear rna, by circRNA purifies and separates, save reagent, substantially reduce reality
Test cost.
(2) operating process is simplified, the required time is greatly shortened.Conventional method needs step by step, successively
RRNA, linear rna etc. are removed, pure circular rna is obtained and is interrupted, then as
Template carries out reverse transcription and amplification, takes several days.Using the method for the present invention, it is not necessary to which separation obtains ring-type
RNA, it is synchronous to carry out reverse transcription and rolling circle amplification (constant-temperature amplification) directly using total serum IgE as template, as long as
Sample after processing can be used within one or two hour establish library and sequencing analysis, simplify operating process, carry
High detection efficiency.
(3) high sensitivity, required sample size greatly reduce.Circular rna is in initial total serum IgE
Content in sample is extremely low, no more than 0.1%, and after this method is handled, when library is established in amplification,
It is dominant as the double-strand cDNA that template amplification obtains using circular rna；In existing method, reverse transcription and expansion
After increasing, for establishing in the reactant in library, double-strand cDNA is not dominant, also containing substantial amounts of
RNA-cDNA heterozygosis chains.
And in the method for the present invention, the total serum IgE of sample only needs 500ng, only prior art requirement amount
1/20~1/100；50ng even can be down to.Therefore, this method can reduce total serum IgE preparation amount, spirit
Sensitivity greatly improves, and reduces cost.
(4) accuracy rate improves, and can be verified, reduce the probability to be made a mistake during sequencing.Conventional method
Process of reverse-transcription in, annealing repeatedly and PCR amplifications can cause more to be mutated mistake；Meanwhile
Random error in sequencing procedure be present.In addition, if circular rna, then reverse transcription are first interrupted using traditional
With the method for amplification, the double stranded cDNA fragment obtained and circular rna are isometric.Thus, in traditional side
In method, it is difficult to verify for the circular rna sequence of same source, poor accuracy.The present invention passes through rolling
Circle amplification, the degree of accuracy of duplication are high；With tens even up to a hundred on the double stranded cDNA fragment obtained
The copy of circular rna sequence, even if being easy to find random error by analysis there occurs mistake during sequencing,
Enable to verify for the circular rna sequence of same source.
Therefore, the present invention can quickly, it is accurate, expeditiously detect circular RNA molecule sequence, operation side
Just, cost can be substantially reduced, there is extraordinary application prospect.
Brief description of the drawings
Fig. 1 is, wherein 1-circular rna, 2-linear rna, 3-random oligonucleotide primer, 4-cDNA
Fig. 2 is the gel electrophoresis figure of the circular rna amplified reaction product of embodiment 1
Fig. 3 is the gel electrophoresis figure of embodiment 2Hela cell cyclic RNA amplification reaction products
Fig. 4 is the Blast comparison results of the sequence A Part I of embodiment 4
Fig. 5 is the Blast comparison results of the sequence A Part II of embodiment 4
Fig. 6 is the Blast comparison results of the sequence B Part I of embodiment 4
Fig. 7 is the Blast comparison results of the sequence B Part II of embodiment 4
Embodiment
Embodiment 1
(1) total serum IgE sample pretreatment
A small amount of genome and mitochondrial DNA may be contained in total serum IgE sample can cause to pollute, therefore cell is total
RNA sample needs to be pre-processed, and can be used at MseI enzymes and matched reagent box (NEB companies) digestion
Reason.
Take 43 μ L total serum IgEs samples, 2 μ L MseI enzymes (10U/ μ L), 5 10 × buffer solutions of μ L, 0.5 μ L BSA
(100 ×) mix, incubated 1 hour at 37 DEG C；20 minutes are incubated at 80 DEG C.
(2) RNA anneals
RNA sample and random oligonucleotide primer (RamdomOligo, purchased from TAKARA) and water are mixed
Close, reaction system, reaction cumulative volume 2.5 μ L are prepared by table 1：
Table 1
A1 and A2 is that the circular rna sample after isolating and purifying (is respectively T-47D and A549 ring-type
RNA), T-47D total serum IgEs are added in A3, add A549 total serum IgEs in A4 compares as Quality Control, A5
For blank control, RNA templates are added without.
It is warming up to 72 DEG C and is kept for 2 minutes, is subsequently placed on ice, is cooled to 0 DEG C.
(3) reverse transcription-rolling circle amplification (RT-RCA)
Water, enzyme and buffer solution are added into the reaction product of step (2), as shown in table 2, reaction system is total
Volume is 25 μ L, pH 8.8.
Wherein, CAE constant-temperature amplifications enzyme (CAE Isothermal Amplification Enzyme) is purchased from Shanghai moral
Poly- Bioisystech Co., Ltd (Cat.No N1001, recombinant C AE constant-temperature amplification enzymes, DoGene CAE
Isothermal Amplification Enzyme), this constant-temperature amplification enzyme is simultaneously with reverse recording function and rolling
Circle amplification function.In reaction system, the dosage of enzyme is 0.8U/ μ L.
2 times of buffer solutions (2 × buffer) are contained：20mM Tris-HCl, 10mM (NH4)2SO4, 50mM
KCl, 2mM MgSO4, 0.1%20,0.8mM dNTP.
The principle of rolling circle amplification is as shown in figure 1, contain linear rna 2 and circular rna 1 in total serum IgE sample
(step 1).Add with the constant-temperature amplification enzyme and random oligonucleotide for reversing recording function and rolling circle amplification function
Primer 3, random oligonucleotide primer are combined with linear rna and circular rna and reverse transcription generation occur
CDNA (step 2).In reaction system, circular rna continues that rolling-circle replication occurs, and the cDNA of generation is not
It is disconnected to extend, the copy of multiple circular rna complementary series, while random oligonucleotide primer and generation can be carried
CDNA chain combinations, continue the new complementary cDNA of amplification generation；It is only raw and linear rna is not amplified
Into RNA-cDNA hybridization chains (step 3).
Table 2:RT-RCA reaction systems
Add buffer,water and Enzyme mix to each sample.
Reacted 1 hour at 72 DEG C, be then cooled to 4 DEG C.10 μ L, 1% agarose gel electrophoresis is taken, as a result
Such as Fig. 2.In Fig. 2, the from left to right respectively electrophoretic band of A1~A5 reaction products and DNA marker
(DL 2000, clip size is followed successively by 2000,1000,750,500,250,100bp).
Because the DNA band lengths that rolling circle amplification is obtained have tens kb, A1~A4 is with circular rna
Loading mouth is concentrated on by the DNA bands obtained after template amplification, and A5 is blank control, electrophoresis result
Do not show band.In A3 and A4 bottoms, brightness is slightly above the relevant position of blank control, shows disperse
Band (for reverse transcription product, other impurities RNA), but under the obvious brightness of DNA bands of loading mouth is higher than
The smear in portion, illustrate to react in final product, the cDNA obtained after circular rna amplification is dominant.
Because A1 and A2 starting template is the circular rna sample after being isolated and purified in product, therefore after gel electrophoresis,
Gel bottom does not almost have smear.
Embodiment 2
It is that sample is detected with Hela cell total rnas.
(1) total serum IgE sample pretreatment
Take 43 μ L (μ g of total content 2.5) Hela cell total rnas, 2 μ L MseI enzymes (10U/ μ L), 5 μ L 10 ×
Buffer solution, 0.5 μ L BSA (100 ×) are mixed, and are incubated 1 hour at 37 DEG C；20 minutes are incubated at 80 DEG C.
(2) RNA anneals
Hela total cellular RNA samples after processing prepare reaction system by table 3, are made annealing treatment.
I5 is blank control, and Hela cell total rnas are added in I7.
Table 3
It is warming up to 72 DEG C and is kept for 2 minutes, is subsequently placed on ice, is cooled to 0 DEG C.
(3) reverse transcription-rolling circle amplification (RT-RCA)
Water, enzyme and buffer solution are added into the reaction product of step (2), as shown in table 4, reaction system is total
Volume is 50 μ L, pH 8.8.
Table 4
| I5 | I7 | |
| Step (2) product | 3μL | 3μL |
| Water | 21.5μL | 21.5μL |
| 2 × buffer solution | 25μL | 25ul |
| Enzyme | 0.5μL | 0.5μL |
Reaction condition such as embodiment 1.10 μ L reaction products are taken, with 1% agarose gel electrophoresis, are as a result such as schemed
3, from left to right respectively I5 (blank control), DNA marker (DL 2000) and I7 reaction products
Electrophoretic band.From Figure 2 it can be seen that blank control I5 does not show electrophoretic band, I7 loading mouths have obvious band,
Illustrate that the DNA base length that is obtained using Hela cell total rnas by template amplification is big, concentrates on loading mouth.
The brightness of I7 loading mouths bottom is slightly above the relevant position of blank control, shows smear.Loading mouth
The brightness of DNA bands be higher than bottom smear, be also demonstrated that reaction final product in, using circular rna as
Template, the cDNA after amplification are dominant.
Embodiment 3
The product of the Hela cell total rnas amplification of embodiment 2 is handled according to the following steps：
(1) purify
Reagent and kit：Beckman AMPure XP Nucleic acid purification kits, AMPure XP magnetic beads；
Operated according to kit specification：
A. the μ L of amplified production 50 are taken, add the μ L of AMPure XP reagents 50, piping and druming up and down mixes；
B. room temperature is placed 15 minutes；
C. it is placed on magnetic frame and stands 5 minutes；
D. supernatant is abandoned, is sure not to touch magnetic bead；
E. plus the ethanol of 200 μ L 80%, turn upside down mixing for several times, be incubated at room temperature 1 minute；
F. it is placed on magnetic frame 5 minutes, after solution clarification, carefully removes supernatant, is sure not to touch magnetic bead；
G. plus the ethanol of 200 μ L 80%, turn upside down mixing for several times, be incubated at room temperature 1 minute；
H. it is placed on magnetic frame 5 minutes, after solution clarification, carefully removes supernatant, exhausts as far as possible remaining
Ethanol, it is sure not to touch magnetic bead；
I. drying at room temperature 3~5 minutes (at least 3 minutes)；
J. remove magnetic frame, add 55 μ L 10mM Tris-HCl (pH8.0), 56 degree 5 minutes；
K. 5min on magnetic frame is placed in, after solution clarification, supernatant is exhausted to clean centrifuge tube, is purified
Product.
(2) ultrasound fracture, obtains average length 200bp fragment.Comprise the following steps that：
A. the product that the processing of 50 μ L steps (1) obtains is placed in miniature tube (MicroTube, model MicroTube-
50AFA Fiber, Part Number：520166；Lot No.：002683) in；
B. open in ultrasonic generator (M220Focused-ultrasonicator, SN 003313), journey is set
Sequence is as follows：
| Maximum target fragment length Target BP (Peak) | 300bp |
| Maximum incident power Peak Incident Power (W) | 75 |
| Service factor Duty Factor | 15% |
| Fracture period Cycles per Burst every time | 200 |
| Flowing time TreamTime (s) | 60s |
| Temperature Temperature (DEG C) | 20 |
| Sample volume Sample volume (uL) | 50 |
In the sink plus MiliQ water is to predetermined water level, and miniature tube is placed into the sample slot of ultrasonic generator,
Instrument safety door is closed, runs instrument；
C. after program end of run, miniature tube is taken out, sample therein is moved in 1.5mL centrifuge tubes；
(3) library construction
Using Thermo Fisher Scientific Ion Plus Fragment Library Kit (Cat.no.
And Ion Xpress 4471252)TMBarcode Adapters Kits (Cat.No.4471250), according to short amplification
Sublibrary builds standard operation guiding book, builds library.
(4) template prepares
Using Ion PGMTM Hi QTMOT2 Kit, according to operation manual MAN0010902 Rev.A.0 note
Carry operation.
(5) it is sequenced
From Ion 318TMChip, it is sequenced in Ion PGM platforms.
(6) sequencing result Torrent suite, coverage analysis and assembler plug-in units analysis number
According to progress base identification and variation identification.The fragment for being sequenced and being obtained after analyzing shares 11465, length point
Cloth is 100~9000bp.Wherein, length is 100~500bp sequence quantity more than 11000.
We are blast to each sequence and compare human genome.Human genome is compared by blast, I
Find wherein with the presence of 5531 connected head-to-tail joints of sequence, the presence of the joint sequence confirms initial
RNA molecule is ring-type.The method that the amplification efficiency of this method is much larger than prior art.
Blast is linked：
http://blast.ncbi.nlm.nih.gov/Blast.cgiPAGE_TYPE=BlastSearch＆BLAST_SPEC=O
GP__9606__9558＆LINK_LOC=blasthome
Embodiment 4
It is as a result as follows exemplified by selecting two sequences in the sequence detected from embodiment 3：
(1) sequence A (testing result numbering NODE_191_length_413_cov_1.69427_ID_381)
Sequence A length 413bp (SEQ ID No.1), nucleotides sequence is classified as：
CACCACAAGAGCCAAAGAGAAACAACTGTGAGAGAAATTTCATACTT
GCCAGCAGCAACCAATTAGTCCCAACTATTAAATTTATCTGTCTGGCAGCTA
ATGTTTAGAGCAAAGATCACCACAATATGTCAGTGCTGACTAGATGAATTAC
TAGCTAATCATGGAATCAATGTCACTTCAGGGAAATTTATTTTAAGTAGCAA
ATACAGTAAACATATTTTATATGATTCACACTGTTTACTTCTTTTTTTTTTCCA
ATGATGGAGTCTTGTCTCTTGTTGCCCAGGGTGGAGTGCAGTGGCACGATC
TCGGCTCACCACAAGAGCCAAAGAGAAACAACTGTGAGAGAAATTTCATA
CTTGCCAGCAGCAACCAATTAGTCCCAACTATTAAATTTATCTGTCTGGCAG
CTA
The sequence is contrasted with human genome by blast, as a result such as Fig. 4 and Fig. 5.From this ratio
To result it will be seen that the sequence is than upper Homo sapiens chromosome 12, alternate
assembly CHM1_1.1Sequence ID:ref|NC_018923.2|Length:133671515。
12278995-12279306 in sequence A 1-314 positions (Part I, range 1) comparison,
(Alignment statistics for match) result such as Fig. 4, uniformity are counted with alignment thereof
(Identities) it is 311/318, i.e., 98%, difference (gap) 2% (7/318), score (score)；
12278995-12279093 in 315-413 positions (Part II, range 2) comparison, matching alignment thereof system
Count (Alignment statistics for match) result such as Fig. 5, its consistency 100% (99/99).
Wherein 1 to 315 all than the upper (Homo of human genome position 12278995 of same initial
sapiens chromosome 12,alternate assembly CHM1_1.1Sequence ID:ref
|NC_018923.2|Length:133671515), the genomic locations are：LDL receptor phase
Close the precursor of albumen 6 (low-density lipoprotein receptor-related protein 6precursor).Pass through
Sequence analysis can learn that latter linked 314 (human genome positions 12279303) is human gene
Group position 12278995, the result that sequence A is compared are as follows：12278995——12279303*12278995
---, * location determinations are the tie point of end to end convergence.
(2) sequence B (testing result numbering NODE_226_length_401_cov_1.68212_ID_451)
Sequence B length 401bp (SEQ ID No.2), nucleotides sequence is classified as：
ATGTGAAAGGTTGTGTAATCCCACAACTGCAGCCCTCCTTGCCTGCTT
TGCACATGCCTGCCTCGCAGGGGGCCCAGGGAAAGGCCGCCCTGCACGTC
ATGGATGAGTCTGCGGCTGCCCCTTCTGAGCCGTGTCCCTGTATGGTAAAG
TGTGGTCATGCAGCGCCTTATCATGGATGGCTGGGGGACTGAATGAGCTAG
TCCATGCAGAGTTCAGCATGGTGCCAGGTGCTCTGTGAACGCTCAATAATT
TATGCTATTTGGTGTGATATGATGATGAAAGGAATTTTTATAACGGAAGGGA
TGTGAAAGGTTGTGTAATCCCACAACTGCAGCCCTCCTTGCCTGCTTTGCA
CATGCCTGCCTCGCAGGGGGCCCAGGGAAAGGCCGCCCTGCACGTCA
The sequence is contrasted with human genome by blast, as a result such as Fig. 6 and Fig. 7.Can from result
See, sequence B compares upper Homo sapiens chromosome 7, alternate assembly CHM1_1.1
Sequence ID:ref|NC_018918.2|Length:159147065.Serial B 100-401 positions (
A part, range 1) 158891676 to 158891983 are compared, alignment thereof statistics (Alignment
Statistics for match) as shown in fig. 6, its consistency is 99% (304/308)；The 1-99 of sequence B
Position (Part II, range 2) compares with 158891884 to 158891983, alignment thereof statistics
(Alignment statistics for match) result such as Fig. 7, its consistency (Identities) are 98%
(98/100)。
By sequence analysis, behind the 99th (human genome position 158891983) of sequence B
Connection is human genome position 158891676.Sequence B is compared and is illustrated as follows：
158891884 --- 158891983*158891676 --- 158891983, * location determination is end to end convergence
Tie point.
Claims (10)
1. the amplification method of circular RNA molecule, it is characterised in that step includes：
(1) cell total rna is taken to be mixed with random primer, heat up after annealing；
(2) add with the constant-temperature amplification enzyme and dNTP for reversing recording function and rolling circle amplification function carry out reverse transcription and
Amplification.
2. the amplification method of circular RNA molecule described in claim 1, it is characterised in that the circular rna
The base number of molecule is 100~1500.
3. the amplification method of circular RNA molecule described in claim 1, it is characterised in that described having reverses
Recording function and the constant-temperature amplification enzyme of rolling circle amplification function are CAE constant-temperature amplifications enzyme or recombinant C AE constant-temperature amplifications
Enzyme.
4. the amplification method of circular RNA molecule described in claim 1, it is characterised in that, will in step (1)
Cell total rna is incubated 1.5~3 minutes after 60~80 DEG C are warming up to after being mixed with random primer, and drops rapidly
Temperature is to 0~5 DEG C.
5. the amplification method of circular RNA molecule described in claim 1, it is characterised in that in step (2),
The pH value of reaction system is 7~9.5, and reaction temperature is 60~80 DEG C.
6. the amplification method of circular RNA molecule described in claim 1, it is characterised in that in step (2), instead
The pH value for answering system is 7.5~9.
7. the amplification method of circular RNA molecule described in claim 1, it is characterised in that the reaction of step (2)
Time is 45min~2hr.
8. the sequence measurement of circular RNA molecule, it is characterised in that step is：It is any with claim 1~6
The product of the item amplification method establishes library and sequencing.
A kind of 9. rolling circle amplification reactant mixture for circular RNA molecule, it is characterised in that described mixing
Thing includes：
(a) circular RNA molecule or cell total rna molecule；
(b) there is the constant-temperature amplification enzyme for reversing recording function and rolling circle amplification function；
(c) end reaction system pH is maintained to 7~9.5 buffer solution；
(d) random primer；
(e)dNTP。
10. it is used for the rolling circle amplification reactant mixture of circular RNA molecule described in claim 9, it is characterised in that
End reaction system pH is maintained at 7.5~9 by described buffer solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610333965.1A CN107400701A (en) | 2016-05-18 | 2016-05-18 | The amplification of circular RNA molecule and sequence measurement |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610333965.1A CN107400701A (en) | 2016-05-18 | 2016-05-18 | The amplification of circular RNA molecule and sequence measurement |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107400701A true CN107400701A (en) | 2017-11-28 |
Family
ID=60394330
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610333965.1A Pending CN107400701A (en) | 2016-05-18 | 2016-05-18 | The amplification of circular RNA molecule and sequence measurement |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107400701A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040224330A1 (en) * | 2003-01-15 | 2004-11-11 | Liyan He | Nucleic acid indexing |
| US20130157269A1 (en) * | 2011-12-15 | 2013-06-20 | Samsung Electronics Co., Ltd. | Method of determining a ratio of rna species in a sample |
| CN104388548A (en) * | 2014-10-31 | 2015-03-04 | 江汉大学 | Method for sequencing high-flux circular RNA (ribonucleic acid) |
| CN104583413A (en) * | 2012-06-29 | 2015-04-29 | 通用电气公司 | Kit for isothermal DNA amplification starting from an RNA template |
| CN105121664A (en) * | 2013-02-20 | 2015-12-02 | 埃默里大学 | Methods of sequencing nucleic acids in mixtures and compositions related thereto |
| WO2015196120A1 (en) * | 2014-06-19 | 2015-12-23 | Somagenics, Inc. | Methods and compositions for detecting polynucleotides and fragments thereof |
-
2016
- 2016-05-18 CN CN201610333965.1A patent/CN107400701A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040224330A1 (en) * | 2003-01-15 | 2004-11-11 | Liyan He | Nucleic acid indexing |
| US20130157269A1 (en) * | 2011-12-15 | 2013-06-20 | Samsung Electronics Co., Ltd. | Method of determining a ratio of rna species in a sample |
| CN104583413A (en) * | 2012-06-29 | 2015-04-29 | 通用电气公司 | Kit for isothermal DNA amplification starting from an RNA template |
| CN105121664A (en) * | 2013-02-20 | 2015-12-02 | 埃默里大学 | Methods of sequencing nucleic acids in mixtures and compositions related thereto |
| WO2015196120A1 (en) * | 2014-06-19 | 2015-12-23 | Somagenics, Inc. | Methods and compositions for detecting polynucleotides and fragments thereof |
| CN104388548A (en) * | 2014-10-31 | 2015-03-04 | 江汉大学 | Method for sequencing high-flux circular RNA (ribonucleic acid) |
Non-Patent Citations (3)
| Title |
|---|
| ASHLEY ACEVEDO等: "Library preparation for highly accurate population sequencing of RNA viruses", 《NAT PROTOC.》 * |
| ASHLEY ACEVEDO等: "Mutational and fitness landscapes of an RNA virus revealed through population sequencing", 《NATURE》 * |
| 孔铖将等: "超分支滚环扩增法检测传染性脾肾坏死病毒", 《水产科学》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2019114146A1 (en) | Method for enriching gene target regions and library construction kit | |
| JP7232643B2 (en) | Deep sequencing profiling of tumors | |
| CN105442054B (en) | The method that storehouse is built in the amplification of multiple target site is carried out to plasma DNA | |
| CN110129415B (en) | NGS library-building molecular joint and preparation method and application thereof | |
| WO2019144582A1 (en) | Probe and method for high-throughput sequencing targeted capture target region used for detecting gene mutations as well as known and unknown gene fusion types | |
| CN110114472A (en) | The method that linear sequencing library is converted into cyclic annular sequencing library | |
| WO2018184495A1 (en) | Method for constructing amplicon library through one-step process | |
| CN108866174B (en) | Method for detecting low-frequency mutation of circulating tumor DNA | |
| CN108998508B (en) | Construction method of amplicon sequencing library, primer group and kit | |
| CN108517567B (en) | Adaptor, primer group, kit and library construction method for cfDNA library construction | |
| WO2016049878A1 (en) | Snp profiling-based parentage testing method and application | |
| CN108138365A (en) | A kind of unicellular transcript profile banking process of high throughput | |
| CN111690748B (en) | Probe set for detecting microsatellite instability by using high-throughput sequencing, kit and microsatellite instability detection method | |
| EP3643789A1 (en) | Pcr primer pair and application thereof | |
| CN108531475A (en) | A kind of high throughput transcript profile library constructing method | |
| CN106834286B (en) | Primer combination for one-step method rapid construction of amplicon library | |
| CN110592200B (en) | Multiplex PCR method for improving amplification specificity and uniformity | |
| CN112592981B (en) | Primer group, kit and method for DNA archive construction | |
| CN112259165A (en) | Method and system for detecting microsatellite instability state | |
| CN102559856B (en) | Method for deleting vector segments in sequencing library | |
| CN110651050A (en) | Targeted enrichment method and kit for detecting low-frequency mutation | |
| CN113186291B (en) | Primer group and kit based on multiplex PCR | |
| CN107400701A (en) | The amplification of circular RNA molecule and sequence measurement | |
| WO2019200580A1 (en) | Parallel liquid-phase hybrid capture method for simultaneously capturing positive-sense and antisense strands of genomic target region | |
| CN107904297B (en) | Primer group, joint group and sequencing method for microbial diversity research |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171128 |