CN107384889B - Wheat farnesyl pyrophosphate synthase TaFPS gene mutant and creation method thereof - Google Patents

Abstract

The invention provides a wheat farnesyl pyrophosphate synthase TaFPS gene mutant and a preparation method thereof. The invention improves or reduces the catalytic activity of the coding enzyme of the gene TaFPS by changing the specific amino acid codon in the gene TaFPS. From the cloned wild type farnesyl pyrophosphate synthase gene of wheat variety Jimai 22, 8 gene mutants of the wheat farnesyl pyrophosphate synthase gene TaFPS are created, enzyme kinetic parameters of related enzymes on substrates of dimethylallyl pyrophosphate (DMAPP), isopentenyl pyrophosphate (IPP) and geranyl pyrophosphate (GPP) are obtained, and the catalytic activity of the enzymes can be remarkably improved or reduced through changing the specific amino acid codon of the wheat farnesyl pyrophosphate synthase gene.

Description

Wheat farnesyl pyrophosphate synthase TaFPS gene mutant and creation method thereof

Technical Field

The invention belongs to the field of plant molecular biology, and particularly relates to a wheat farnesyl pyrophosphate synthase TaFPS gene mutant and a preparation method thereof.

Background

Site-directed mutagenesis refers to a technique in which a specific base pair is introduced at a specific site in a desired DNA fragment to thereby alter the amino acid sequence encoded by the DNA fragment. It is a powerful tool for studying the complex relationship between protein structure and function, and is also a common gene modification means in laboratories. Site-directed modification, deletion or insertion of specific bases of a known gene can change the corresponding amino acid sequence and the structural and functional characteristics of the protein, and is helpful for understanding the relationship between the structure and the function of the protein.

Isoprenoid substances are important substances necessary for maintaining plant growth and development, photosynthesis, electron transfer, coping with environmental stress, and the like. The substance can be used as photosynthetic pigment (such as chlorophyll and carotenoid), growth substance and plant hormone (such as cytokinin, abscisic acid, gibberellin and brassinolide), part of membrane structure such as sitosterol, electron transfer receptor such as plastoquinone, glucose receptor in glycosylation reaction such as dolichol, and can regulate cell growth (such as isopentenyl protein and cytokinin). In addition, many plant isoprenoids are also of commercial importance such as rubber, food flavors, beverages, vitamin A, D, E, and natural insecticides such as pyrethrin.

The biosynthesis of isoprenoid substances is synthesized enzymatically, mainly by a series of enzymes in the mevalonate pathway, farnesyl pyrophosphate synthase (FPS; EC2.5.1.1/EC2.5.1.10) being a key enzyme in the branching point of this metabolic pathway, which catalyzes isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) by means of 1' -4 sequential condensation of isoprenoids, first forming geranyl pyrophosphate (GPP) and then condensing with another molecule of isopentenyl pyrophosphate to form a multi-branching point, a particularly important intermediate farnesyl pyrophosphate (FPP), one of the rate-limiting enzymes controlling the entire metabolic pathway. Has been prepared from Arabidopsis thaliana (A) and (B), respectivelyArabidopsis thaliana) And rice (1)Oryzasativa) Corn (c)Zea mays) Sorghum (sorghum)Sorghum bicolor) Rubber (a)Hevea brasiliensis) Wheat (A), (B), (C)T. aestivum) Farnesyl pyrophosphate synthase gene was isolated and cloned from more than 40 plants, and prior to the present application, there was no disclosure or publication of the cloning of farnesyl pyrophosphate synthase gene from the wheat variety Jimai 22TaFPSAnd creates its gene mutant, prokaryotic gene expression of mutant protease and purificationAnd the kinetic parameter of the mutant enzyme.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a wheat farnesyl pyrophosphate synthase TaFPS gene mutant and a preparation method thereof.

The invention aims to provide a wheat farnesyl pyrophosphate synthase TaFPS gene mutant and a preparation method thereof, which can efficiently obtain the wheat farnesyl pyrophosphate synthase TaFPS gene mutant, are convenient for improving the agronomic characters of crops such as wheat and the like, improve the yield and can carry out basic research of molecular biology.

The technical scheme of the invention is as follows:

the invention provides a method for creating a wheat farnesyl pyrophosphate synthase TaFPS gene mutant, which is formed by site-directed mutagenesis according to the following method: site-directed mutagenesis of DNA sequences corresponding to amino acid sequences different from those of other plants in the conserved region and the non-conserved region of the wheat farnesyl pyrophosphate synthase gene TaFPS.

Preferably, the amino acids at positions 60C, 100Y, 174L and 250F in the conserved region and 278L and 295E in the non-conserved region of the TaFPS gene of the wheat farnesyl pyrophosphate synthase gene are mutated to 60S, 60F, 60L, 100F, 174M, 250Y, 278H and 295D, respectively.

More preferably, the upstream and downstream primers of the wheat farnesyl pyrophosphate synthase TaFPS mutant are respectively:

TaFPS/C60Sf is SEQ ID NO.9,TaFPS/C60Sr is SEQ ID NO.10, and the codon is mutated from TGC to AGC;

TaFPS/C60Ff is SEQ ID NO.11,TaFPS/C60Fr is SEQ ID NO.12, and the codon is mutated from TGC to TTC;

TaFPS/C60Lf is SEQ ID NO.13,TaFPS/C60Lr sequence is SEQ ID NO. 14), the codon consists of mutantTaFPS/C60FIs mutated to CTC;

TaFPS/Y100Ff is SEQ ID NO.15,TaFPS/Y100Fr is SEQ ID NO.16, and the codon is mutated from TAT to TTT;

TaFPS/L174Mf sequence is SEQ ID NO. 17),TaFPS/L174Mr is SEQ ID NO. 18), and the codon is mutated from TTG to ATG;

TaFPS/F250Yf is SEQ ID NO.19,TaFPS/F250Yr is SEQ ID NO. 20), and the codon is mutated from TTT to TAT;

TaFPS/L278Hf is SEQ ID NO.21,TaFPS/L278Hr is SEQ ID NO. 22), and the codon is mutated from CTT to CAT;

TaFPS/E295Df is SEQ ID NO.23,TaFPS/E295Dr is SEQ ID NO. 24), and the codon is mutated from GAG to GAT.

The invention provides a wheat farnesyl pyrophosphate synthase TaFPS gene mutant created according to a method for creating a wheat farnesyl pyrophosphate synthase TaFPS gene mutant, a wheat farnesyl pyrophosphate synthase TaFPS gene mutant TaFPS/C60S, TaFPS/C60F, TaFPS/C60L, TaFPS/Y100F, TaFPS/L174M, TaFPS/F250Y, TaFPS/L278H and TaFPS/E295D, wherein amino acids at positions 60C, 100Y, 174L and 250F in a conserved region and 278L and 295E in a non-conserved region of the wheat farnesyl pyrophosphate synthase gene TaFPS are respectively mutated into 60S, 60F, 60L, 100F, 174M, 250Y, 278H and 295D.

Preferably, the gene mutants TaFPS/C60S, TaFPS/C60F, TaFPS/C60L, TaFPS/Y100F, TaFPS/L174M, TaFPS/F250Y, TaFPS/L278H and TaFPS/E295D of the wheat farnesyl pyrophosphate synthase TaFPS gene, and the upstream and downstream primers are respectively:

TaFPS/C60Sf is SEQ ID NO.9,TaFPS/C60Sr is SEQ ID NO.10, and the codon is mutated from TGC to AGC;

TaFPS/C60Ff is SEQ ID NO.11,TaFPS/C60Fr is SEQ ID NO.12, and the codon is mutated from TGC to TTC;

TaFPS/C60Lf is SEQ ID NO.13,TaFPS/C60Lr sequence is SEQ ID NO. 14), the codon consists of mutantTaFPS/C60FIs mutated to CTC;

TaFPS/Y100Ff is SEQ ID NO.15,TaFPS/Y100Fr is SEQ ID NO.16, and the codon is mutated from TAT to TTT;

TaFPS/L174Mf sequence is SEQ ID NO. 17),TaFPS/L174Mr is SEQ ID NO. 18), and the codon is mutated from TTG to ATG;

TaFPS/F250Yf is SEQ ID NO.19,TaFPS/F250Yr is SEQ ID NO. 20), and the codon is mutated from TTT to TAT;

TaFPS/L278Hf is SEQ ID NO.21,TaFPS/L278Hr is SEQ ID NO. 22), and the codon is mutated from CTT to CAT;

TaFPS/E295Df is SEQ ID NO.23,TaFPS/E295Dr is SEQ ID NO. 24), and the codon is mutated from GAG to GAT.

The invention provides an application of a wheat farnesyl pyrophosphate synthase TaFPS gene mutant, which is an application of the wheat farnesyl pyrophosphate synthase TaFPS gene mutant in changing the expression of farnesyl pyrophosphate synthase genes in crops such as wheat and other plants, changing the yield of secondary metabolites, improving the grain size and grain weight agronomic characters; and the application of researching the structures of the intron, the exon and the promoter of the wheat farnesyl pyrophosphate synthase gene, researching the function of the promoter and developing related molecular markers.

The method has the advantages that:

the present invention creates a wheat farnesyl pyrophosphate synthase gene from a cloned wild-type farnesyl pyrophosphate synthase gene of the wheat variety "Jimai 22TaFPSThe 8 gene mutants are TaFPS/C60S, TaFPS/C60F, TaFPS/C60L, TaFPS/Y100F, TaFPS/L174M, TaFPS/F250Y, TaFPS/L278H and TaFPS/E295D respectively, enzyme kinetic parameters of related enzymes on substrates of dimethyl propylene pyrophosphate (DMAPP), isopentenyl pyrophosphate (IPP) and geranyl pyrophosphate (GPP) are obtained, and the fact that the catalytic activity of the enzymes can be remarkably improved or reduced through changing specific amino acid codons of a wheat farnesyl pyrophosphate synthase gene is proved.

The invention changes the gene of wheat farnesyl pyrophosphate synthaseTaFPSWherein the specific amino acid codon increases or decreasesThe catalytic activity of the coding enzyme provides important technical reserves for further carrying out modification and modification of key enzyme genes of metabolic pathways, constructing eukaryotic gene expression vectors of farnesyl pyrophosphate synthase genes, converting corresponding crops, particularly plants which obtain important commercial values by secondary metabolism, discussing the relationship of overexpression of farnesyl pyrophosphate synthase gene mutants in receptor plants and important agronomic traits such as secondary metabolites, crop grain size, grain weight and the like, further improving the crop yield, carrying out research on intron, exon and promoter structures of the farnesyl pyrophosphate synthase genes, researching promoter functions, developing related molecular markers and the like.

Drawings

FIG. 1 shows the amino acid sequence (354 aa) of wheat variety Jimai 22 TaFPS and the conserved region.

FIG. 2 shows the codons of the wheat variety Jimai 22 TaFPS gene and the amino acid residues encoded thereby (first part).

FIG. 3 shows the codons of the wheat variety Jimai 22 TaFPS gene and the amino acid residues encoded thereby (second part).

FIG. 4 shows the codons of the wheat variety Jimai 22 TaFPS gene and the amino acid residues encoded thereby (third part).

FIG. 5 shows the codons of the wheat variety Jimai 22 TaFPS gene and the amino acid residues encoded thereby (fourth part).

FIG. 6 is a SDS-PAGE electrophoresis of wild-type and mutant enzyme proteins of farnesyl pyrophosphate synthase of wheat,

wherein 1, TaFPS/L278H, 2, TaFPS/E295D, 3, TaFPS/C60S, 4, TaFPS/C60F, 5, TaFPS/C60L, 6, TaFPS/Y100F, 7, TaFPS/L174M, 8, TaFPS/F250Y M, protein molecular weight standard; 9. TaFPS wild type.

Detailed Description

The above-mentioned aspects of the present invention are explained in further detail by the following specific examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the technical scope of the present invention.

Example 1 wheat farnesyl pyrophosphate synthase TaFPS Gene mutant and method for creating the same

First, experiment method

Step 1 wheat variety Jimai 22 farnesyl pyrophosphate synthase GeneTaFPSObtaining the full-Length cDNA sequence

Step 1.1TaFPSFirst Strand cDNA Synthesis of (1)

The procedure was followed as described in the Takara reverse transcription kit.

(1) The following mixed solution was prepared in a microtube

Oligo dT primer (50μm) 1ul

dNTP Mixture (10mM each) 1ul

Total RNA <5μg

RNase free dH2O up to 10μl

(2) Performing denaturation and annealing reactions under the following conditions on a PCR instrument: 5min at 65 degrees-quench on ice.

(3) The following reverse transcription reaction solution was prepared in the Microtube described above.

Mu.l of the above denatured and annealed reaction solution

5XPrimerscript ^TM BF 4 μl

RNase inhibitor (40U/ul) 0.5 μl

Primescript ^TM RTase (200U/ul) 1 μl

RNase FreedH2O 4.5 μl

(4) The reverse transcription reaction was performed on a PCR instrument under the following conditions: 60 min at 42 ℃; 15min at 70 ℃; cooling at 4 ℃.

Step 1.2TaFPSAmplification of intermediate sequences

(1) Intermediate sequence primer design

Primers were designed based on highly conserved regions of the amino acid sequence of FPS in plants using Primer5.0 primer design software and DNMAN software.

The upstream primer DFFPS (SEQ ID NO. 1): 5'TGGTGTATTGAATGGCTTCAAGC3'

The downstream primer DRFPS (SEQ ID NO. 2): 5'TCATCCTGAACTTGAAAGTATGCTCCCAT 3'.

The PCR system is as follows: cDNA 2ul, buffer 1.5 u L, Taq enzyme 0.3 u L, dNTP 0.7 u L, DFFPS 0.6 u L, DRFFPS 0.6 u L, ddH2O 9.8.8 uL.

The PCR procedure was: 94 ℃ for 3 min, 94 ℃ for 45 s, 55 ℃ for 45 s, 72 ℃ for 1 min, 72 ℃ for 6 min, and 32 cycles.

(2) PCR detection of intermediate sequence and recovery of target DNA fragment

And (3) uniformly mixing 8 mu L of PCR amplification product with 1 mu L of bromophenol blue, dropping the mixture into 1.5% agarose gel, performing electrophoresis for 45min at the voltage of 120V, and observing and taking pictures by an ultraviolet gel imaging system. Obtaining a 461bp DNA fragment by PCR, and cutting a target DNA band under an ultraviolet lamp with the wavelength of 302 nm. The specific band was recovered with a DNA Gel recovery Kit (TaKaRa Agarose Gel DNA Purification Kit Ver2.0, Dalianbao bio-product).

(3) Ligation of PCR products

The ratio between the product and pGEM-T Easy Vector was determined according to the concentration of the recovered fragment. The connection steps are as follows: adding 3.75 mu L of DNA and 0.25 mu L of T carrier, and gently mixing; water bath at 45 deg.C for 5min, immediately transferring to ice for 5 min; then 0.5. mu.L of T4 DNA ligase and 0.5. mu.L of 2X Rapid Ligation buffer are added and mixed evenly, and the mixture is connected for more than 16h at the temperature of 16 ℃ on a PCR instrument.

(4) Transformation of

Adding 5 μ L of the connecting solution into a centrifuge tube containing 50 μ L of competent cells, uniformly mixing by blowing and sucking, and standing on ice for 30 min; performing water bath heat shock at 42 ℃ for 90 s, and immediately performing ice bath for 2 min; adding 950 μ L LB liquid culture medium, placing in a shaker at 37 deg.C, shaking at 230 rpm, and culturing for 1 h to recover cells and express resistance; centrifuge for 3 min at 3000 rmp. Removing 900 μ L of supernatant in a superclean bench, and reserving 100 μ L; 70 μ L of the bacterial suspension was uniformly applied to LB solid medium, and the remaining 30 μ L was applied to another LB solid medium. The cells were cultured in an inverted state at 37 ℃ for 12-16 hours until colonies appeared.

(5) Plasmid DNA extraction

Adding 1500 mu L of bacterial liquid into an Eppendorf tube, centrifuging at 12000 rpm for 1 min, removing supernatant, and draining residual liquid; adding 250 mu L of solution I, placing on a vortex oscillator for oscillation, and fully suspending thalli; adding 250 μ L of solution II, slightly reversing and mixing for 4-6 times, and standing at room temperature for 1 min; adding 350 μ L solution III, mixing, and standing at room temperature for 5 min; 12000 rmp, centrifuging for 10 min; the supernatant was removed and transferred to a column. Centrifuging at 8000 rmp for 2 min; removing waste liquid, adding 500 μ L washing solutions, 10000 rmp, 1 min, and repeating for 1 time; removing waste liquid, centrifuging the column at 10000 rmp for 2 min; standing the column at room temperature for 10 min; the column was fitted to a new Eppendorf tube and 50. mu.L of Elution Buffer was added; standing at room temperature for 2 min, centrifuging at 10000 rmp for 2 min.

(6) Plasmid DNA sequencing and sequence analysis

15 plasmids were sent to Shanghai Biotechnology Ltd for DNA sequencing. Through DNAMAN and NCBI comparison analysis, the wheat farnesyl pyrophosphate synthase gene is obtainedTaFPSA partial sequence of (a).

Step 1.3 wheatTaFPSObtaining of terminal sequence of Gene cDNA

Based on the obtained 461bp intermediate sequence, primers were designed as follows:

5' RACE primer (SEQ ID NO. 3): 5'TCATCCTGAACTTGAAAGTATGCTCCCAT 3';

3' RACE primer (SEQ ID NO. 4): 5'ACGGCTTCAGGGCAGTTGTTGGA 3'.

(1) First Strand cDNA Synthesis

(ii) for 5' -RACE-Ready cDNA

RNA 2 μL

5'-CDS primer A 1 μL

SMARTⅡA oligo 1 μL

DEPC water 1 μL

② for 3' -RACE-Ready cDNA

RNA 2 μL

3'-CDS primer A 1 μL

DEPC water 2 μL

Carrying out microcentrifugation; performing the reaction at 70 ℃ for 2 min on a PCR instrument; standing on ice for 2 min, and centrifuging.

Adding into the upper tube:

5x First-Strand Buffer 2 μL

DTT（20mM） 1 μL

dNTP（10mM） 1 μL

MMLV Reverse Transcriptase 1 μL

10 μL

vortexing and centrifuging; performing the reaction at 42 ℃ for 1.5h on a PCR instrument; adding 100 mu L of Tricine-EDTA Buffer respectively; 7 min at 72 ℃; the cDNA was stored at-20 ℃ for 3 months.

(2) Rapid amplification of terminal sequences

Prepare Master Mix:

PCR-Grade water 34.5 μL

10x Advantage 2 PCR Buffer 5 μL

dNTP (10mM) 1 μL

50x Advantage 2 Polymerase mix 1μL

vortex, microcentrifuge.

For 5' -RACE:

5'-RACE-Ready cDNA 2.5μL

UPM 5 μL

5' -RACE primer 1. mu.L

Master Mix 34.5 μL

For 3' -RACE

3'-RACE-Ready cDNA 2.5μL

UPM 5 μL

3' -RACE primer 1. mu.L

Master Mix 34.5 μL

Mixing, and centrifuging; PCR procedure: 5' end PCR program: 94 ℃ for 1 min, 94 ℃ for 35 s, 60 ℃ for 35 s, 72 ℃ for 2 min, 35 cycles, 72 ℃ for 8 min. Amplifying a DNA fragment of about 700 bp; 3' end PCR program: 3 min at 94 ℃, 30s at 66 ℃, 3 min at 72 ℃, 30 cycles, 6 min at 72 ℃. A DNA fragment of about 800bp was amplified.

(3) PCR product purification, ligation, transformation methods were as in 1.2

(4) Screening of recombinants

PCR was performed on the white spot colonies using 5'-RACE primer and 3' -RACE primer or T7 and SP6 primer. The procedure is as follows: 3 min at 94 ℃, 45 s at 64 ℃, 2 min at 72 ℃, 35 cycles and 10 min at 72 ℃.

(5) full-Length sequence splicing of intermediate sequences and RACE

Performed using contig express9.1 software and the resulting contig sequences were manually proofed.

Step 1.4 wheat farnesyl Pyrophosphate synthase GeneTaFPSAmplification of full-Length sequences

Upstream primer P1 (SEQ ID NO. 5): 5'GCTCCTTCTCGTCCCTTCT3'

Downstream primer P2 (SEQ ID NO. 6): 5'TAGCACCGTAGTTTATTGTTG3'

(1) PCR amplification of full-Length Gene sequences

full-Length amplification Using first Strand cDNA as templateTaFPSThe gene and PCR system is as follows: water 9.3 u L, 10 x PCR buffer 1.5 u L, dNTP 0.7.7 u L, P10.6.6 u L, P20.6.6 u L, LATag 0.3.3 u L, DMSO 2L.

The PCR procedure was: 5min at 94 ℃, 45 s at 63 ℃, 2 min at 72 ℃, 10 min at 72 ℃ and 35 cycles.

(2) Gel recovery, ligation, transformation, recombinant detection, plasmid extraction and sequencing of the PCR products were as above.

Step 1.5 wheat farnesyl Pyrophosphate synthase GeneTaFPSConstruction of prokaryotic expression vector

The upstream primer P1 (SEQ ID NO. 7) is:

5'CGCGCGTCGAC AGGAGGAATTTAAAATGAGAGGATCGCATCATCACCACCATCACGCGGCGGCGGCGGTGGCGTTGTC3'；

the downstream primer P2 (SEQ ID NO. 8) is:

5'CTGCAGAAGCTTCTATTTCTGCCTCTTGTAGATCTTC3'。

(1) PCR amplification of prokaryotic expression sequence of wheat farnesyl pyrophosphate synthase gene

Full-length gene of farnesyl pyrophosphate synthase of wheatTaFPSCarrying out PCR amplification by taking the plasmid as a template, wherein the PCR system is as follows: water 9.3. mu.L, 10 XGC-PCR 1.5. mu.lL、dNTP 0.7 μL、P1 0.6 μL、 P2 0.6 μL、LA-Tag 0.3 μL。

The PCR procedure was: 5min at 94 ℃, 45 s at 64 ℃, 2 min at 72 ℃, 10 min at 72 ℃ and 35 cycles.

(2) Digestion of PCR amplification products

The purified PCR product and vector pLM I were digested with restriction enzymes Sal I and Hind III, respectively. And (5) recovering the enzyme digestion product by glue. The method comprises the following steps:

to a 0.5 mL centrifuge tube were added in sequence:

purified PCR product/pLM I plasmid 8. mu.L

10x tango buffer 2 μL

SaIⅠ 1 μL

Hind III 1 μL

Deionized water 8 μ L

20 μL

Inactivating the enzyme at 37 ℃ for 3h and then at 80 ℃ for 30 min; and (5) carrying out gel recovery on the fragments which are correctly digested.

(3) Ligation and transformation of the cleavage products

Determining the connection ratio between the target fragment and the pLM I enzyme cutting fragment, mixing the target fragment and the pLM I enzyme cutting fragment uniformly, and adding a proper amount of T4 DNA Ligase and 2 x Ligation Buffer. Vortex, mix well, and centrifuge. Ligation was carried out at 16 ℃ for more than 16 h. Transformation ofE.coil Dh5 alpha strain, coated on a substrate containingamp The antibiotic is cultured on LB solid medium in an inverted mode for 16 h.

(4) Positive cloning recombinant PCR, enzyme digestion identification and plasmid extraction

Colonies on the medium were picked and cultured overnight with LB liquid medium. And (4) carrying out PCR identification on a bacteria liquid, and sequencing positive plasmids.

Step 2 wheat farnesyl pyrophosphate synthase GeneTaFPSSite-directed mutagenesis of codons of mutants

Step 2.1 design of codon mutation primers

The amino acid sequence alignment shows that the wheat farnesyl pyrophosphate synthase geneTaFPS60 th C, 1 st in the conserved regionThe amino acids at 6 positions of 00Y, 174L and 250F and 278L and 295E in the non-conserved region are different from those of other plants, and in order to study the influence of the amino acid residues on the catalytic activity of the enzyme, the amino acid residues are mutated into 8 gene mutants of 60S, 60F, 60L, 100F, 174M, 250Y, 278H and 295D.

The upstream and downstream primers of the mutant were:

TaFPS/C60S:F（SEQ ID NO.9）:GTCCTAGGAGGAAAGAGCAACCGTGGGC;

TaFPS/C60S:R（SEQ ID NO.10）:GCCCACGGTTGCTCTTTCCTCCTAGGAC；

the codon was mutated from TGC to AGC.

TaFPS/C60F:F（SEQ ID NO.11）:GTCCTAGGAGGAAAGTTCAACCGTGGGC;

TaFPS/C60F:R（SEQ ID NO.12）:GCCCACGGTTGAACTTTCCTCCTAGGAC；

The codon was mutated from TGC to TTC.

TaFPS/C60L:F（SEQ ID NO.13）:GTCCTAGGAGGAAAGCTCAACCGTGGGC;

TaFPS/C60L:R（SEQ ID NO.14）:GCCCACGGTTGAGCTTTCCTCCTAGGAC；

Codon mutantTaFPS/C60FIs mutated to CTC.

TaFPS/Y100F:F（SEQ ID NO.15）:GCTTCAAGCATTTTTTCTTGTGCTTG;

TaFPS/Y100F:R（SEQ ID NO.16）:CAAGCACAAGAAAAAATGCTTGAAGC；

The codon is mutated from TAT to TTT.

TaFPS/L174M:F（SEQ ID NO.17）:GCTTCAGGGCAGATGTTGGATCTTATC;

TaFPS/L174M:R（SEQ ID NO.18）:GATAAGATCCAACATCTGCCCTGAAGC；

The codon was mutated from TTG to ATG.

TaFPS/F250Y:F（SEQ ID NO.19）:CTAGATTGTTATGGAGATCCTGAATC;

TaFPS/F250Y:R（SEQ ID NO.20）:GATTCAGGATCTCCATAACAATCTAG；

The codon was mutated from TTT to TAT.

TaFPS/L278H:F（SEQ ID NO.21）:

GTGCAAGCTCTTGAGCATGCAGATGAGAGCC;

TaFPS/L278H:R（SEQ ID NO.22）:GGCTCTCATCTGCATGCTCAAGAGCTTGCAC；

The codon was mutated from CTT to CAT.

TaFPS/E295D:F（SEQ ID NO.23）:

GGGAAGTCAGATCCAGAGTCTGTTGC;

TaFPS/E295D:R（SEQ ID NO.24）:GCAACAGACTCTGGATCTGACTTCCC；

The codon was mutated from GAG to GAT.

Step 2.2 PCR amplification of mutants

Constructed wheat farnesyl pyrophosphate synthase geneTaFPSWild type expression vector plasmid is used as DNA template, PCR amplification is carried out, and the amplification system is 50 mul.

pLM1-TaFPS 2μl

Upstream mutation primer5. mu.l

Downstream mutation primer5. mu.l

5×FastPfu Buffer 5μl

2.5 mM dNTP 5μl

FastPfu DNA Polymerase 1μl

H₂O 27μl

The PCR procedure was: pre-denaturation at 95 ℃ for 3 min, denaturation at 95 ℃ for 45 sec, annealing at 60 ℃ for 30 sec, extension at 72 ℃ for 12 min, 15 cycles in total, extension at 72 ℃ for 10 min, and heat preservation at 16 ℃.

Step 2.3 mutant sequence purification, transformation, Positive cloning identification

[1] The PCR product was transferred to another new EP tube, and 5. mu.l of 10 XFastduest Green Buffer and 1. mu.l of DpnI were added and mixed well, followed by incubation for 3h at 37 ℃.

[2] To the DNA mixture digested with Dpn I, equal volume of chloroform (55. mu.l) was added, vortexed, mixed, and centrifuged at 12000 rpm for 5 min.

[3]The layered supernatant was transferred to a new 1.5mL centrifuge tube and 1/3 volumes of NH were added₄Cl and 8/3 volumes of absolute ethanol were mixed well with shaking. Centrifuge at 12000 rpm for 10 min.

[4] The supernatant was decanted, rinsed with 70% ethanol, and centrifuged at 12000 rpm for 5 min. The supernatant was decanted off, air dried at room temperature, and 10. mu.l of water was added to dissolve the bottom precipitate.

Step 2.4 transformation of the mutant PCR amplification product, positive clone identification, DNA sequencing and the like.

Step 3 protein expression of wheat farnesyl pyrophosphate synthase wild type and mutant

(1) Bacterial transformation and culture

Transforming the positive recombinant plasmid into competent escherichia coli BL21(DE 3); selecting a single clone to be cultured in 10mL LB culture medium (Amp concentration is 100 mg/L) overnight; 5mL of overnight-cultured bacterial suspension was added to 500mL of LB medium (Amp concentration: 100 mg/L). Shaking at 37 ℃ for about 2.5h until OD600=0.8, IPTG (final concentration of 0.5 mM) was added. Shaking and culturing at room temperature for 130rmp overnight. Centrifuging at 5000r/min for 10-15min to collect thallus. The cells were rinsed with an equal volume of deionized, sterile water. Centrifuging at 5000r/min for 10-15min to collect thallus.

(2) Purification and dialysis of enzyme proteins

The cells were resuspended in 40mL of start Buffer (20mM potassium phosphate, pH7.4, 0.5M NaCl). 5mg of lysozyme (lytic enzyme) was added thereto, and the mixture was heated at 37 ℃ for 1 hour. Standing at-80 deg.C for more than 1 hr. Thawing in water bath at 30 deg.C. Cells were sonicated for 10s at intervals of 30 s. (130 watts). 7000r centrifugation for 15min, supernatant for protein purification. The Hi-Trap column was connected to a 0.45 μ M filter and syringe, 3mL of 0.1M nickel sulfate was injected into the column, and unbound nickel ions were washed off with 5mL of deionized water and then equilibrated with 5mL of start Buffer. 10-20mL of the supernatant was injected into the column, and the column was washed with 5mL of start Buffer. 5mL wash Buffer (20mM potassium phosphate, pH7.4, 0.5M NaCl, 50mM imidazole) wash the column. The protein was solubilized with 5mL of elution Buffer (20mM potassium phosphate, pH7.4, 0.5M NaCl, 500mM imidazole), and collected in 1.5mL centrifuge tubes, 1mL per tube. The purified protein was transferred to a dialysis bag and dialyzed in a magnetic stirrer containing 5% glycerol, 5 mM. beta. -mercaptoethanol, 20mM Tris-HCl buffer (pH 7.5) at 4 ℃ for 20 hours with 3 changes of the dialysate in between. The purified protein was stored in a-86 ℃ ultra low temperature freezer for future use.

Step 4, determining the activity of wild type and mutant enzymes of wheat farnesyl pyrophosphate synthase and researching enzyme kinetic parameters

(1) Detection of enzymatic Activity

Pyrophosphatase is used to convert the pyrophosphoric acid produced by the enzymatic reaction to monophosphate and react with molybdate to form a colorless Keggin-type phosphomolybdate complex (Pmo)^VI ₁₂O₄₀ ^3-) Reduced by beta-mercaptoethanol to form a blue complex (PMo) having an absorption peak at 830nm^V ₄Mo^VI ₈O₄₀ ^7-) And detecting by using a spectrophotometer.

The specific experimental procedure is as follows.

The following reagents were sequentially added to each well of a 96-well plate microplate reader so that the total volume of the reaction system was 100. mu.L.

77.5 μl H2O,

50 mM Tris，5 μL（1M）

2 mM MgCl2, 5 μL（40mM）

5 mg/ml BSA, 5 μL（100 mg/ml）

1 mM DTT, 5 μL（20mM）

0.5 μL IPP（200 mg/200 mL）

0.5. mu.L DMAPP (200 mg/200 mL) or GPP

0.1. mu.g FPPS (adjustable according to enzyme activity)

Mixing, and placing in an enzyme labeling instrument for reaction at 37 ℃ for 5 min. 0.5 mL of pyrophosatase was added and the reaction was carried out at 37 ℃ for 5 min. 10mL of ammonium molybdate was added and the reaction was carried out at 37 ℃ for 5 min. 10mL of beta-mercaptoethanol, 5mL of Eikonogen Reagent, was added and reacted at 37 ℃ for 20 min. The 96-well plate is taken out, the cover is taken down, and the plate is placed into a microplate reader to read the absorbance at 830 nm.

(2) Determination of enzyme kinetic parameters

Determination of kinetic parameters of IPP enzyme: the DMAPP concentration was 33.6 mM and 5 units of enzyme activity were measured at different concentrations of IPP.

For the determination of the DMAPP enzyme kinetic parameters, the IPP concentration was 33.6 mM, and 5 enzyme activity units of DMAPP at different concentrations were determined.

For the GPP enzyme kinetic parameter determination, the IPP concentration is 33.6 mM, and 5 enzyme activity units of GPP with different concentrations are determined. K can be obtained by using SigmaPlut 12 according to the Mie's formula y = ax/(b + x)_MValues and Vmax values.

Second, experimental results

Wheat farnesyl pyrophosphate synthase geneTaFPSDNA sequence of coding region

Wheat variety Jimai 22TaFPSGene coding region cDNA sequence (1065 bp) (SEQ ID NO. 25)

ATGGCGGCGGCGGCGGTGGCGTTGTCGAACGGCTCCGGTGGCGACTCCAAGGCCGAGTTCGCGGAAATATACAGCAGGCTCAAGGAGGAGATGCTCGAGGACCCCGCCTTCGAGTTCACCGACGAGTCGCTCCAGTGGATCGACCGCATGCTGGATTACAATGTCCTAGGAGGAAAGTGCAACCGTGGGCTCTCTGTCATCGATAGCTACAAGACATTGAAAGGTGTAGATGTTTTGAGGAAGGAGGAGACGTTTCTTGCCTGCACCCTTGGTTGGTGTATTGAATGGCTTCAAGCATATTTTCTTGTGCTTGATGATATCATGGACAATTCCCAGACACGACGGGGCCAGCCTTGCTGGTTTAGGGTGCCTCAGGTTGGCCTTATTGCTGTAAATGATGGGATTATCCTTCGCAACCATATTTCACGGATCCTTCAACGCCACTTCAGAGGAAAACCGTATTATGTTGATCTCATTGATTTGTTCAATGAGGTTGAATTTAAGACAGCTTCAGGGCAGTTGTTGGATCTTATCACTACTCACGAGGGAGAAAAGGATCTCACAAAATATAACTTGAATGTTCACCGGCGCATTGTGCAATACAAGACAGCGTACTATTCATTTTATCTTCCGGTTGCATGTGCATTGCTGCTGTCGGGTGAGAATTTGGATAACTTCGGCGATGTAAAGAACATTCTTGTTGAAATGGGAACATACTTTCAAGTTCAGGATGATTATCTAGATTGTTTTGGAGATCCTGAATCTATTGGCAAGATTGGAACTGACATTGAAGACTACAAGTGTTCCTGGTTAGTTGTGCAAGCTCTTGAGCTTGCAGATGAGAGCCAAAAGGGCATTCTACTTGAAAATTATGGGAAGTCAGAGCCAGAGTCTGTTGCAAAAGTGAAGGATCTGTATAAAGAACTTGATCTGGAGACGGCATTTCACAAGTATGAGCGGGAGAGCTACAATAAGCTGATCGCCGACATCGAGGCCCAGCCAAGCAAAGCTGTTCAGAAAGTTTTGATGTCTTTCCTGGAGAAGATCTACAAGAGGCAGAAATAG

Amino acid sequence of (II) wheat farnesyl pyrophosphate synthase TaFPS

The amino acid sequence (354 aa) of wheat variety Jimai 22 TaFPS (SEQ ID NO. 26) and the conserved region are shown in FIG. 1.

Wheat variety Jimai 22TaFPSThe codons of the gene and the encoded amino acid residues are shown in FIGS. 2-5.

(III) separation and purification of wild type and mutant enzyme proteins of wheat farnesyl pyrophosphate synthase

The electrophoresis results of the separated, purified and dialyzed protein show that the soluble wheat farnesyl pyrophosphate synthase wild type and mutant enzyme protein with higher purity (figure 6) is obtained, and can be used for in vitro enzyme catalytic reaction and enzyme kinetic study.

(IV) enzyme kinetic parameters of wheat farnesyl pyrophosphate synthase wild type and mutant

The enzyme kinetic parameters of the wheat cultivar jimai 22 farnesyl pyrophosphate synthase wild type and the 8-gene mutant enzyme proteins for the substrates dimethylallyl pyrophosphate (DMAPP), isopentenyl pyrophosphate (IPP) and geranyl pyrophosphate (GPP) were obtained experimentally (table 1). The result shows that the catalytic activity of the wheat farnesyl pyrophosphate synthase can be obviously improved or reduced by changing the codon of the amino acid coded by the wheat farnesyl pyrophosphate synthase gene.

For a substrate DMAPP, only the Vmax value of the mutant TaFPS/L278H is improved by 1.44 times compared with that of the wild type, while the Vmax values of other mutants are all smaller than that of the wild type, particularly the Vmax value of a conserved region mutant is obviously reduced, wherein the Vmax value of the mutant TaFPS/L174M is reduced by 54.6 times compared with that of the wild type; k of all mutants_MThe values are all larger than those of the wild type, but the conservative region mutant is obviously increased, wherein the K of the mutant TaFPS/Y100F_MThe value was maximal, 31.4 times that of the wild type.

For substrate IPP, the Vmax value of only mutant TaFPS/L278H is improved compared with that of wild type, and is 1.04 times of that of wild type, and K of the mutant is_MThe value is also minimal; vmax values of the conservative region mutant are obviously reduced, wherein the Vmax value of TaFPS/C60F is minimum and is reduced by 170 times compared with that of the wild type; k which is also a conserved domain mutant_MThe increase in value was significant, with K of mutant TaFPS/Y100F_MThe value was also maximal, 26.6 times that of the wild type.

For the substrate GPP, the Vmax values of all mutants are lower than those of the wild typeLow, but significant reduction in Vmax values of the conserved domain mutant, where mutant TaFPS/C60S was 191-fold less than wild-type; k of all mutants_MThe values are all larger than those of the wild type, but the conservative region mutant is obviously increased, wherein the K of the mutant TaFPS/C60L_MThe value was maximal, 36-fold higher than wild type.

TABLE 1 enzyme kinetic parameters of wheat farnesyl pyrophosphate synthase wild type and mutants

The foregoing is only a preferred embodiment of this patent, and it should be noted that, for those skilled in the art, various modifications and substitutions can be made without departing from the technical principle of this patent, and these modifications and substitutions should also be regarded as the protection scope of this patent.

SEQUENCE LISTING

<110> institute of agricultural sciences of Shandong province

<120> wheat farnesyl pyrophosphate synthase TaFPS gene mutant and creation method thereof

<130> 2017

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence

<400> 1

tggtgtattg aatggcttca agc 23

<210> 2

<211> 29

<212> DNA

<213> Artificial sequence

<400> 2

tcatcctgaa cttgaaagta tgctcccat 29

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence

<400> 3

tcatcctgaa cttgaaagta tgctcccat 29

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence

<400> 4

acggcttcag ggcagttgtt gga 23

<210> 5

<211> 78

<212> DNA

<213> Artificial sequence

<400> 5

cgcgcgtcga caggaggaat ttaaaatgag aggatcgcat catcaccacc atcacgcggc 60

ggcggcggtg gcgttgtc 78

<210> 6

<211> 37

<212> DNA

<213> Artificial sequence

<400> 6

ctgcagaagc ttctatttct gcctcttgta gatcttc 37

<210> 7

<211> 28

<212> DNA

<213> Artificial sequence

<400> 7

gtcctaggag gaaagagcaa ccgtgggc 28

<210> 8

<211> 28

<212> DNA

<213> Artificial sequence

<400> 8

gcccacggtt gctctttcct cctaggac 28

<210> 9

<211> 28

<212> DNA

<213> Artificial sequence

<400> 9

gtcctaggag gaaagttcaa ccgtgggc 28

<210> 10

<211> 28

<212> DNA

<213> Artificial sequence

<400> 10

gcccacggtt gaactttcct cctaggac 28

<210> 11

<211> 28

<212> DNA

<213> Artificial sequence

<400> 11

gtcctaggag gaaagctcaa ccgtgggc 28

<210> 12

<211> 28

<212> DNA

<213> Artificial sequence

<400> 12

gcccacggtt gagctttcct cctaggac 28

<210> 13

<211> 26

<212> DNA

<213> Artificial sequence

<400> 13

gcttcaagca ttttttcttg tgcttg 26

<210> 14

<211> 26

<212> DNA

<213> Artificial sequence

<400> 14

caagcacaag aaaaaatgct tgaagc 26

<210> 15

<211> 27

<212> DNA

<213> Artificial sequence

<400> 15

gcttcagggc agatgttgga tcttatc 27

<210> 16

<211> 27

<212> DNA

<213> Artificial sequence

<400> 16

gataagatcc aacatctgcc ctgaagc 27

<210> 17

<211> 26

<212> DNA

<213> Artificial sequence

<400> 17

ctagattgtt atggagatcc tgaatc 26

<210> 18

<211> 26

<212> DNA

<213> Artificial sequence

<400> 18

gattcaggat ctccataaca atctag 26

<210> 19

<211> 31

<212> DNA

<213> Artificial sequence

<400> 19

gtgcaagctc ttgagcatgc agatgagagc c 31

<210> 20

<211> 31

<212> DNA

<213> Artificial sequence

<400> 20

ggctctcatc tgcatgctca agagcttgca c 31

<210> 21

<211> 26

<212> DNA

<213> Artificial sequence

<400> 21

gggaagtcag atccagagtc tgttgc 26

<210> 22

<211> 26

<212> DNA

<213> Artificial sequence

<400> 22

gcaacagact ctggatctga cttccc 26

<210> 23

<211> 1065

<212> DNA

<213> Triticum aestivum L.

<400> 23

atggcggcgg cggcggtggc gttgtcgaac ggctccggtg gcgactccaa ggccgagttc 60

gcggaaatat acagcaggct caaggaggag atgctcgagg accccgcctt cgagttcacc 120

gacgagtcgc tccagtggat cgaccgcatg ctggattaca atgtcctagg aggaaagtgc 180

aaccgtgggc tctctgtcat cgatagctac aagacattga aaggtgtaga tgttttgagg 240

aaggaggaga cgtttcttgc ctgcaccctt ggttggtgta ttgaatggct tcaagcatat 300

tttcttgtgc ttgatgatat catggacaat tcccagacac gacggggcca gccttgctgg 360

tttagggtgc ctcaggttgg ccttattgct gtaaatgatg ggattatcct tcgcaaccat 420

atttcacgga tccttcaacg ccacttcaga ggaaaaccgt attatgttga tctcattgat 480

ttgttcaatg aggttgaatt taagacagct tcagggcagt tgttggatct tatcactact 540

cacgagggag aaaaggatct cacaaaatat aacttgaatg ttcaccggcg cattgtgcaa 600

tacaagacag cgtactattc attttatctt ccggttgcat gtgcattgct gctgtcgggt 660

gagaatttgg ataacttcgg cgatgtaaag aacattcttg ttgaaatggg aacatacttt 720

caagttcagg atgattatct agattgtttt ggagatcctg aatctattgg caagattgga 780

actgacattg aagactacaa gtgttcctgg ttagttgtgc aagctcttga gcttgcagat 840

gagagccaaa agggcattct acttgaaaat tatgggaagt cagagccaga gtctgttgca 900

aaagtgaagg atctgtataa agaacttgat ctggagacgg catttcacaa gtatgagcgg 960

gagagctaca ataagctgat cgccgacatc gaggcccagc caagcaaagc tgttcagaaa 1020

gttttgatgt ctttcctgga gaagatctac aagaggcaga aatag 1065

<210> 24

<211> 354

<212> PRT

<213> Triticum aestivum L.

<400> 24

Met Ala Ala Ala Ala Val Ala Leu Ser Asn Gly Ser Gly Gly Asp Ser

1 5 10 15

Lys Ala Glu Phe Ala Glu Ile Tyr Ser Arg Leu Lys Glu Glu Met Leu

20 25 30

Glu Asp Pro Ala Phe Glu Phe Thr Asp Glu Ser Leu Gln Trp Ile Asp

35 40 45

Arg Met Leu Asp Tyr Asn Val Leu Gly Gly Lys Cys Asn Arg Gly Leu

50 55 60

Ser Val Ile Asp Ser Tyr Lys Thr Leu Lys Gly Val Asp Val Leu Arg

65 70 75 80

Lys Glu Glu Thr Phe Leu Ala Cys Thr Leu Gly Trp Cys Ile Glu Trp

85 90 95

Leu Gln Ala Tyr Phe Leu Val Leu Asp Asp Ile Met Asp Asn Ser Gln

100 105 110

Thr Arg Arg Gly Gln Pro Cys Trp Phe Arg Val Pro Gln Val Gly Leu

115 120 125

Ile Ala Val Asn Asp Gly Ile Ile Leu Arg Asn His Ile Ser Arg Ile

130 135 140

Leu Gln Arg His Phe Arg Gly Lys Pro Tyr Tyr Val Asp Leu Ile Asp

145 150 155 160

Leu Phe Asn Glu Val Glu Phe Lys Thr Ala Ser Gly Gln Leu Leu Asp

165 170 175

Leu Ile Thr Thr His Glu Gly Glu Lys Asp Leu Thr Lys Tyr Asn Leu

180 185 190

Asn Val His Arg Arg Ile Val Gln Tyr Lys Thr Ala Tyr Tyr Ser Phe

195 200 205

Tyr Leu Pro Val Ala Cys Ala Leu Leu Leu Ser Gly Glu Asn Leu Asp

210 215 220

Asn Phe Gly Asp Val Lys Asn Ile Leu Val Glu Met Gly Thr Tyr Phe

225 230 235 240

Gln Val Gln Asp Asp Tyr Leu Asp Cys Phe Gly Asp Pro Glu Ser Ile

245 250 255

Gly Lys Ile Gly Thr Asp Ile Glu Asp Tyr Lys Cys Ser Trp Leu Val

260 265 270

Val Gln Ala Leu Glu Leu Ala Asp Glu Ser Gln Lys Gly Ile Leu Leu

275 280 285

Glu Asn Tyr Gly Lys Ser Glu Pro Glu Ser Val Ala Lys Val Lys Asp

290 295 300

Leu Tyr Lys Glu Leu Asp Leu Glu Thr Ala Phe His Lys Tyr Glu Arg

305 310 315 320

Glu Ser Tyr Asn Lys Leu Ile Ala Asp Ile Glu Ala Gln Pro Ser Lys

325 330 335

Ala Val Gln Lys Val Leu Met Ser Phe Leu Glu Lys Ile Tyr Lys Arg

340 345 350

Gln Lys

Claims (4)

1. The method for creating the mutant of the gene TaFPS of the farnesyl pyrophosphate synthase of the wheat is characterized in that the mutant is obtained by site-directed mutagenesis according to the following method: site-directed mutagenesis is carried out on DNA sequences corresponding to different amino acid sequences of a conservative region and a non-conservative region of a wheat farnesyl pyrophosphate synthase gene TaFPS and other plants;

the amino acids at the 60C, 100Y, 174L and 250F positions in the conservative region of the wheat farnesyl pyrophosphate synthase gene TaFPS and the 278L and 295E positions in the non-conservative region are respectively mutated into 60S, 60F, 60L, 100F, 174M, 250Y, 278H and 295D;

the upstream and downstream primers of the wheat farnesyl pyrophosphate synthase TaFPS mutant are respectively as follows:

TaFPS/C60S, wherein the sequence F is SEQ ID NO.9, the sequence TaFPS/C60S, the sequence R is SEQ ID NO.10, and the codon is mutated from TGC to AGC;

TaFPS/C60F, wherein the sequence F is SEQ ID NO.11, the sequence TaFPS/C60F, the sequence R is SEQ ID NO.12, and the codon is mutated from TGC to TTC;

TaFPS/C60L, wherein F sequence is SEQ ID NO.13, TaFPS/C60L, R sequence is SEQ ID NO.14, and codon is mutated from TTC of mutant TaFPS/C60F to CTC;

TaFPS/Y100F, wherein F sequence is SEQ ID NO.15, TaFPS/Y100F, R sequence is SEQ ID NO.16, and codon is mutated from TAT to TTT;

TaFPS/L174M, wherein the sequence F is SEQ ID NO.17, the sequence R is SEQ ID NO.18, TaFPS/L174M, and the codon is mutated from TTG to ATG;

TaFPS/F250Y, wherein the F sequence is SEQ ID NO.19, the TaFPS/F250Y, the R sequence is SEQ ID NO.20, and the codon is mutated from TTT to TAT;

TaFPS/L278H, wherein the sequence F is SEQ ID NO.21, the sequence TaFPS/L278H, the sequence R is SEQ ID NO.22, and the codon is mutated from CTT to CAT;

TaFPS/E295D with sequence F of SEQ ID NO.23 and TaFPS/E295D with sequence R of SEQ ID NO.24, with codons mutated from GAG to GAT.

2. The mutant of the farnesyl pyrophosphate synthase TaFPS gene of wheat created by the method of creating a mutant of the farnesyl pyrophosphate synthase TaFPS gene of wheat according to claim 1, wherein: mutant TaFPS gene TaFPS/C60S, TaFPS/C60F, TaFPS/C60L, TaFPS/Y100F, TaFPS/L174M, TaFPS/F250Y, TaFPS/L278H and TaFPS/E295D of the wheat farnesyl pyrophosphate synthase gene TaFPS conserved region at 60C, 100Y, 174L and 250F and non-conserved region at 278L and 295E position are respectively mutated into 60S, 60F, 60L, 100F, 174M, 250Y, 278H and 295D.

3. The mutant wheat farnesyl pyrophosphate synthase TaFPS gene according to claim 2, wherein: the gene mutant TaFPS/C60S, TaFPS/C60F, TaFPS/C60L, TaFPS/Y100F, TaFPS/L174M, TaFPS/F250Y, TaFPS/L278H and TaFPS/E295D of the farnesyl pyrophosphate synthase of wheat are respectively provided with an upstream primer and a downstream primer:

TaFPS/C60S, wherein the sequence F is SEQ ID NO.9, the sequence TaFPS/C60S, the sequence R is SEQ ID NO.10, and the codon is mutated from TGC to AGC;

TaFPS/C60F, wherein the sequence F is SEQ ID NO.11, the sequence TaFPS/C60F, the sequence R is SEQ ID NO.12, and the codon is mutated from TGC to TTC;

TaFPS/C60L, wherein F sequence is SEQ ID NO.13, TaFPS/C60L, R sequence is SEQ ID NO.14, and codon is mutated from TTC of mutant TaFPS/C60F to CTC;

TaFPS/Y100F, wherein F sequence is SEQ ID NO.15, TaFPS/Y100F, R sequence is SEQ ID NO.16, and codon is mutated from TAT to TTT;

TaFPS/L174M, wherein the sequence F is SEQ ID NO.17, the sequence R is SEQ ID NO.18, TaFPS/L174M, and the codon is mutated from TTG to ATG;

TaFPS/F250Y, wherein the F sequence is SEQ ID NO.19, the TaFPS/F250Y, the R sequence is SEQ ID NO.20, and the codon is mutated from TTT to TAT;

TaFPS/L278H, wherein the sequence F is SEQ ID NO.21, the sequence TaFPS/L278H, the sequence R is SEQ ID NO.22, and the codon is mutated from CTT to CAT;

TaFPS/E295D with sequence F of SEQ ID NO.23 and TaFPS/E295D with sequence R of SEQ ID NO.24, with codons mutated from GAG to GAT.

4. Use of a mutant of the wheat farnesyl pyrophosphate synthase TaFPS gene according to claim 2 or 3, wherein: the application of the mutant of the gene TaFPS of the farnesyl pyrophosphate synthase of the wheat in changing the expression of the farnesyl pyrophosphate synthase gene in crops such as wheat and other plants, changing the yield of secondary metabolites, improving the grain size and grain weight agronomic characters; and the application of researching the structures of the intron, the exon and the promoter of the wheat farnesyl pyrophosphate synthase gene, researching the function of the promoter and developing related molecular markers.

Images