CN102994527A - Avena nuda farnesyl diphosphate synthase gene YFPS and detection method for separation and clone, site-specific mutagenesis and enzyme functions - Google Patents

Abstract

The invention belongs to the field of molecular biology and relates to a detection technology for separation and clone, site-specific mutagenesis, zymoprotein prokaryotic expression, zymoprotein separation and purification and enzyme functions of a branch-point key enzyme gene participating in synthesis of an isoprenoid matter in a wheat mevalonic acid metabolic pathway. The method can provide important technical storage for further performing the gene improvement and modification, constructing an eucaryon gene expression carrier of a farnesyl diphosphate synthase gene, and converting corresponding crops; secondly can be used for obtaining plants with important commercial values in virtue of secondary metabolism, and discussing a relationship of the overexpression of the farnesyl diphosphate synthase gene in a receiver plant and important agronomic traits such as secondary metabolites, crop grain sizes and crop grain weights; and improving the yield of the crops, analyzing structures of introns, exons and promoters, studying functions of the promoters, developing related molecular markers.

Description

The detection method of maize farnesyl phosphate synthase gene YFPS and separating clone thereof, rite-directed mutagenesis and enzyme function

Technical field

The invention belongs to biology field, relate to a kind of separating clone that participates in the key gene of the synthetic tapping point of isoprenoid material in the wheat mevalonic acid pathways metabolism, site-directed point mutation, the prokaryotic expression of zymoprotein, separation and purification and the enzyme Function detection technology of zymoprotein.

Background technology

The isoprenoid material is to keep growth and development of plants, photosynthesis, electronics transmission, response environment the necessary important substance such as to coerce.Such material can be used as the part of photosynthetic pigments (such as chlorophyll, carotenoid), growth substance and plant hormone (such as phytokinin, dormin, Plant hormones regulators,gibberellins and brassinolide), membrane structure such as Sitosterol, electronics transmit acceptor such as plastoquinone, as grape saccharide receptor such as dolichol in the glucosyl reaction, and the growth (such as isopentene group albumen, phytokinin) of energy regulating cell.In addition, a lot of plant isoprene also have important commercial value such as rubber, flavorant, beverage, vitamin A. D. E and natural insecticide such as pyrethrin etc.

The isoprenoid material mainly synthesizes by a series of enzyme catalysiss in the mevalonate pathway, and wherein the key enzyme of tapping point is farnesyl pyrophosphate synthase (FPS in this pathways metabolism; EC2.5.1.1/EC2.5.1.10), be one of the rate-limiting enzyme of the whole pathways metabolism of control.This enzyme carries out condensation with isopentenylpyrophosphate (IPP) and the dimethyl allene tetra-sodium (DMAPP) of a molecule by the 1'-4 order, at first form geranyl tetra-sodium (GPP), then form an intermediate product farnesyl pyrophosphate multidrop points, particularly important (FPP) with another molecule isopentenylpyrophosphate condensation.At present respectively from 40 kind of plant such as Arabidopis thaliana (Arabidopsisthaliana), paddy rice (Oryza sativa), corn (Zea mays), Chinese sorghum (Sorghum bicolor), rubber (Heveabrasiliensis) separating clone farnesyl phosphate synthase gene, before the present patent application, also do not have open or delivered about research data information such as the separation and purification of separating clone farnesyl phosphate synthase gene, site-directed point mutation, gene prokaryotic, zymoprotein from Landrace of Common Wheat " maize " and enzyme function vitro detection thereof.Particularly carry out the research of rite-directed mutagenesis for wild-type maize farnesyl phosphate synthase gene, now still blank, can't obtain better effect by the applying gene mutating technology.

Summary of the invention

For in the prior art in the disappearance of wheat farnesyl phosphate synthase gene correlation technique, the present inventor provides a whole set of separation and purification and enzyme Function detection technology about Landrace of Common Wheat " maize " farnesyl phosphate synthase gene clone, site-directed point mutation, gene prokaryotic, high purity zymoprotein.Record the wild-type farnesyl pyrophosphate synthase that obtains from Landrace of Common Wheat maize clone the Vmax of substrate dimethyl allene tetra-sodium (DMAPP), isopentenylpyrophosphate (IPP) and geranyl tetra-sodium (GPP) is respectively 10.0 ± 0.6,31.2 ± 0.8 and 23.3 ± 0.8mol/min/mg; The KM value is respectively 0.80 ± 0.12,0.71 ± 0.04 and 0.76 ± 0.06 μ M; Kcat is respectively 0.23 ± 0.01,0.72 ± 0.02 and 0.54 ± 0.02S-1, Kcat/KM is respectively 2.88x105,1.01x106 and 7.11x105M-1S-1, and proof clone's wild-type maize farnesyl phosphate synthase gene has natural biological function thus.Record maize farnesyl pyrophosphate synthase mutant H278L the Vmax of substrate dimethyl allene tetra-sodium (DMAPP), isopentenylpyrophosphate (IPP) and geranyl tetra-sodium (GPP) is respectively 16.1 ± 1.4,46.3 ± 2.8 and 41.9 ± 6.3mol/min/mg; The KM value is respectively 2.31 ± 0.35,1.52 ± 0.19 and 2.27 ± 0.62 μ M; Kcat is respectively 0.88 ± 0.08,2.53 ± 0.15 and 2.29 ± 0.34S-1, and Kcat/KM is respectively 3.81x105,1.66x106 and 1.01x106M-1S-1; Record maize farnesyl pyrophosphate synthase mutant D295E the Vmax of substrate dimethyl allene tetra-sodium (DMAPP), isopentenylpyrophosphate (IPP) and geranyl tetra-sodium (GPP) is respectively 32.6 ± 2.1,76.3 ± 0.8 and 70.9 ± 9.5mol/min/mg; The KM value is respectively 2.14 ± 0.25,0.46 ± 0.02 and 2.15 ± 0.51 μ M; Kcat is respectively 2.55 ± 0.16,5.97 ± 0.06 and 5.54 ± 0.74S-1, Kcat/KM is respectively 1.19x106,1.30x107 and 2.58x106M-1S-1, show by the change to amino acid code, can improve the catalytic activity of enzyme, L-glutamic acid (E) residue of wherein replacing is comparatively remarkable to the raising of enzymic activity.The present invention is for further carrying out genetic modification and modification, make up the eukaryotic gene expression vector of farnesyl phosphate synthase gene and transform corresponding crop, especially obtain the plant of important commercial value by secondary metabolism, inquire into overexpression and the secondary metabolite of farnesyl phosphate synthase gene in recipient plant, crop kernel size and grain heavily wait the relation of Main Agronomic Characters, and then raising crop yield, and to the farnesyl phosphate synthase gene intron, exon and promoter structure are analyzed, the research promoter function, develop relevant molecule marker the important technology deposit is provided.

The coding region gene sequence of maize farnesyl phosphate synthase gene YFPS provided by the invention is shown in Seq ID No:1, and the aminoacid sequence of its coding is shown in Seq ID No:2.

Farnesyl phosphate synthase gene cDNA overall length in the above-mentioned maize is 1330bp, the 5' non-coding region that comprises 1 40bp, the 3' non-coding region of 1 1065bp coding region and 1 225bp, at 1308 Nucleotide places the polyA tail is arranged, translation initiation codon ATG is from 41 Nucleotide, and terminator codon TAG is positioned at 1103 Nucleotide places, the polypeptide that comprises 354aa of encoding, molecular weight is about 42kDa, and its gene order and aminoacid sequence are shown in Seq ID No:3;

The present inventor provides concrete separating clone method, site-directed point mutation and the prokaryotic expression thereof of this gene and the method for enzyme Function detection to be:

1. the separation and Extraction of maize blade RNA

Specification sheets according to the Trizol test kit carries out.The RNA that obtains is kept in the DEPC water for subsequent use.

2. the first chain cDNA's is synthetic

Carry out according to Takara reverse transcription test kit specification sheets.

3. gene intermediate sequence amplification, connection and conversion

According to the high conservative region design gene intermediate sequence amplimer of FPS aminoacid sequence in the plant, the corresponding sequence of amplification maize YFPS.Upstream primer is YRF:5'TCAACGCCACTTCAGAGGAAAACCG3', and its gene order is shown in Seq ID No:4; Downstream primer is: YRR:5'TCCCGCTCATACTTGTGAAATGCCGT3', its gene order is shown in Seq ID No:5.Carry out PCR according to certain condition, utilize DNA glue to reclaim test kit and reclaim the 527bp specific band.

The dna fragmentation that reclaims is connected with pGEM-T Easy carrier.Utilize the heat shock method to transform intestinal bacteria DH 5 α, the picking positive colony, the preparation plasmid DNA is also carried out dna sequencing, obtains the goal gene fragment by the NCBI comparison.

4. utilize the RACE technology to obtain fast the gene end sequence

4.1 gene end sequence rapid amplifying

Utilize the gene intermediate sequence of the 527bp of above-mentioned acquisition, terminal according to 5' and the 3' of the method rapid amplifying gene of the SMARTTmRACE cDNA Amplification kit of Clontech Laboratories INC, screening recon, and order-checking.The amplification of gene 5' terminal fragment, the primer UPM (Universal Primer A Mix) that has mainly utilized test kit to provide is upstream primer, downstream primer with the amplification gene intermediate sequence: 5'TCCCGCTCATACTTGTGAAATGCCGT3', its gene order is downstream primer shown in Seq ID No:5; The amplification of gene 3' terminal fragment, utilize that test kit provides primer UPM (Universal Primer A Mix) be downstream primer, upstream primer with the amplification gene intermediate sequence: 5'TCAACGCCACTTCAGAGGAAAACCG3', its gene order is upstream primer shown in Seq ID No:4, why adopt this two sequences, main is exactly in order to be conducive to the later stage splicing of sequence.

4.2 gene intermediate sequence and RACE sequence are used Contig Express 9.1 splicing full length sequences, then the contig sequence of gained are manually proofreaded.

The amplification of 5 full length gene sequences

5.1 the design of full length gene primer

According to intermediate sequence and RACE sequence contig result, design total length amplimer.

The upstream primer sequence is YFPSF:5'CTTCTCGTCCCTTCTCGCTC3', and its gene order is shown in Seq ID No:6;

The downstream primer sequence is YFPSR:5'GATAGGCTAGAAAAACATTAG3', and its gene order is shown in Seq ID No:7.

5.2 the pcr amplification of full-length gene

Take the first chain cDNA as template amplification total length goal gene, carry out glue recovery, connection, conversion, the detection of PCR recon, plasmid extraction and the order-checking of full-length gene PCR product, the acquisition full length sequence is 1330bp.

The prokaryotic expression of 6 genes

6.1 gene prokaryotic design of primers

According to gained full length sequence sequencing result, utilize DNAMAN software that the gene order of gained is translated into aminoacid sequence, then compare to determine the ORF of maize farnesyl phosphate synthase gene with NCBI known organism farnesyl pyrophosphate synthase aminoacid sequence, design is connected into the primer of pLM1 expression vector.At the 5' of gene end, design is with 7 sub-primers of amino acid code in ribosome bind site (AGGAGGA), restriction enzyme SalI restriction enzyme site (GTCGAC), initiator codon, 6 Histidine codons and the farnesyl phosphate synthase gene: 5'CGCGCGTCGACAGGAGGAATTTAAAATGAGAGGATCGCATCATCACCACCATCA CGCGGCGGCGGCGGTGGCGTTGTC3', and its gene order is shown in Seq ID No:8; At the 3' of gene end, design has restriction enzyme Hind III restriction enzyme site (AAGCTT), terminator codon (TAG) and contains 7 amino acid whose primer: 5'CTGCAGAAGCTTCTATTTCTGCCTCTTGTAGATCTTC3' of coding, and its gene order is shown in Seq ID No:9;

6.2 the structure of prokaryotic expression vector

The enzyme that comprises gene prokaryotic sequence pcr amplification product is cut, enzyme is cut product and carrier is connected, conversion, positive colony recon PCR are identified, enzyme is cut evaluation, extraction of plasmid DNA, dna sequencing checking.

The rite-directed mutagenesis of 7 farnesyl phosphate synthase gene codons

7.1 the design of codon mutation primer

Because the aminoacid sequence comparison is found, the 278th H of maize farnesyl pyrophosphate synthase is different from other plant with the 295th D, for inquiring into the function of these amino-acid residues, its H is sported L, codon CAT sports CTT, the primer of mutant is: YH278LF:5'GTGCAAGCTCTTGAGCTTGCAGATGAGAGCC3', and its gene order is shown in Seq ID No:10; YH278LR:5'GGCTCTCATCTGCAAGCTCAAGAGCTTGCAC,, its gene order is shown in Seq ID No:11; D is sported E, codon GAT sports GAG, the primer of mutant is: YD295EF:5'GGGAAGTCAGAGCCAGAGTCTGTTGC3', its gene order is shown in Seq ID No:12, YD295ER:5'GCAACAGACTCTGGCTCTGACTTCCC3', its gene order is shown in Seq ID No:13.

7.2 the pcr amplification of mutant

Take the maize farnesyl phosphate synthase gene wild-type expression vector plasmid that makes up as dna profiling, suitable annealing temperature is carried out pcr amplification.

7.3 the conversion of mutant pcr amplification product, order-checking

Remove template plasmid DNA with the Dpn1 restriction enzyme, transform bacillus coli DH 5 alpha, the plasmid of amplification sudden change, and extract plasmid and carry out dna sequencing, to determine having or not of mutational site.Positive colony is transformed in the expression strain, carries out protein expression.

8 farnesyl phosphate synthase genes are expressed

At first carry out the optimization of farnesyl pyrophosphate synthase protein expression condition, comprise the optimization of IPTG concentration, inducing temperature etc.According to the optimal conditions of determining, carry out the great expression of farnesyl pyrophosphate synthase protein.

The purifying of 9 farnesyl pyrophosphate synthase proteins

Utilize ion-exchange column separating purification farnesyl pyrophosphate synthase protein.Cross the protein of column purification, being loaded on dialyses in certain solution in the dialysis tubing desalts, and the protein of purifying saves backup in-86 ℃.

10 adopt spectrophotometer to detect the farnesyl pyrophosphate synthase activity.

Record the maize farnesyl pyrophosphate synthase Vmax of substrate dimethyl allene tetra-sodium (DMAPP), isopentenylpyrophosphate (IPP) and geranyl tetra-sodium (GPP) is respectively 10.0 ± 0.6,31.2 ± 0.8 and 23.3 ± 0.8mol/min/mg; The KM value is respectively 0.80 ± 0.12,0.71 ± 0.04 and 0.76 ± 0.06 μ M; Kcat is respectively 0.23 ± 0.01,0.72 ± 0.02 and 0.54 ± 0.02S-1, and Kcat/KM is respectively 2.88x105,1.01x106 and 7.11x105M-1S-1, and proof clone's wheat farnesyl phosphate synthase gene has natural biological and learns function thus.

Record maize farnesyl pyrophosphate synthase mutant H278L the Vmax of substrate dimethyl allene tetra-sodium (DMAPP), isopentenylpyrophosphate (IPP) and geranyl tetra-sodium (GPP) is respectively 16.1 ± 1.4,46.3 ± 2.8 and 41.9 ± 6.3mol/min/mg; The KM value is respectively 2.31 ± 0.35,1.52 ± 0.19 and 2.27 ± 0.62 μ M; Kcat is respectively 0.88 ± 0.08,2.53 ± 0.15 and 2.29 ± 0.34S-1, and Kcat/KM is respectively 3.81x105,1.66x106 and 1.01x106M-1S-1; Record maize farnesyl pyrophosphate synthase mutant D295E the Vmax of substrate dimethyl allene tetra-sodium (DMAPP), isopentenylpyrophosphate (IPP) and geranyl tetra-sodium (GPP) is respectively 32.6 ± 2.1,76.3 ± 0.8 and 70.9 ± 9.5mol/min/mg; The KM value is respectively 2.14 ± 0.25,0.46 ± 0.02 and 2.15 ± 0.51 μ M; Kcat is respectively 2.55 ± 0.16,5.97 ± 0.06 and 5.54 ± 0.74S-1, Kcat/KM is respectively 1.19x106,1.30x107 and 2.58x106M-1S-1, show by the change to the amino-acid residue codon, can improve the catalytic activity of enzyme, L-glutamic acid (E) residue of wherein replacing is comparatively remarkable to the raising of enzymic activity.

The present invention is for further carrying out genetic modification and modification, make up the eukaryotic gene expression vector of farnesyl phosphate synthase gene and transform corresponding crop, especially obtain the plant of important commercial value by secondary metabolism, inquire into overexpression and the secondary metabolite of farnesyl phosphate synthase gene in recipient plant, crop kernel size and grain heavily wait the relation of Main Agronomic Characters, and then raising crop yield, and to the farnesyl phosphate synthase gene intron, exon and promoter structure are analyzed, the research promoter function, develop relevant molecule marker the important technology deposit is provided, carry out rite-directed mutagenesis by the gene to the clone especially simultaneously, thereby gene is carried out autotelic carry out external transformation or modification, inquire into indivedual important amino acids to the impact of enzymic activity, can obtain the high gene of enzymatic activity or the low gene of enzymatic activity according to research purpose external, significant to obtaining excellent goal gene according to research purpose in the crop genetic improvement.

Description of drawings

Fig. 1 is maize blade RNA electrophorogram,

1 is 1KbDNA marker among the figure; 2-5 is maize RNA;

Fig. 2 is maize farnesyl phosphate synthase gene intermediate sequence PCR product electrophoretogram,

1 is 1kb DNA ladder among the figure, and 2-13 is maize farnesyl phosphate synthase gene intermediate sequence PCR product, and length is 527bp;

Fig. 3 is maize farnesyl phosphate synthase gene end sequence rapid amplifying PCR product electrophorogram,

1-3 is 5'race PCR product among the figure, and size is 1001bp; 4 is 1kb DNA ladder; 5-11 is the 3'racePCR product, and size is 856bp;

Fig. 4 is the full-length cDNA electrophorogram of maize farnesyl phosphate synthase gene,

1 is 1kb DNA ladder among the figure; 2-6 is full-length cDNA, and length is 1330bp;

Fig. 5 is the pLM1 plasmid enzyme restriction electrophorogram that contains maize farnesyl phosphate synthase gene ORF,

1 is 1kb DNA ladder among the figure; 2 is the plasmid DNA to the positive colony that contains goal gene; 3 for after utilizing Sal I and Hind III double digestion, obtains purpose fragment and the pLM1 plasmid of 1106bp;

Fig. 6 is maize farnesyl pyrophosphate synthase wild-type and the mutein SDS-PAGE electrophorogram of purifying,

1-2 is wild-type among the figure; 3 is protein molecular weight standard; 4 is mutant L278H; 5 is mutant E295D.

Embodiment

Embodiment 1(wheat leaf blade RNA extracts)

(1) cultivates maize with vermiculite in constant incubator (28 ℃) and grow to tri-leaf period.

(2) in the liquid nitrogen blade is ground to Powderedly, moves on in the EP pipe that DEPC processes.

(3) add an amount of RNAiso Plus.

(4) leave standstill 5min under the room temperature.

(5) chloroform of adding 1/5 RNAiso Plus volume.Vibration is to milky white shape.

(6) leave standstill 5min under the room temperature.

(7) 12000g, 4 ℃ of centrifugal 15min.

(8) supernatant moves on in the EP pipe of new DEPC processing, adds and the isopyknic Virahol of supernatant mixing.Leave standstill 10min under the room temperature.

(9) 12000g, 4 ℃ of centrifugal 10min.

(10) in precipitation, add 75% ethanol that 1mL prepares with DEPC water.4 ℃ of centrifugal 5min of 12000g.

(11) keep precipitation, be dried to colourless in the stink cupboard.

(12) add 40 μ L DEPC water dissolution.Packing and electrophoresis detection after half an hour.Get 0.5 μ L and 0.8 μ L RNA sample, the record of taking pictures of 1.0% agarose native gel electrophoresis, voltage 140V, electrophoresis 30min, gel imaging system, the result is as shown in Figure 1.

Synthesizing of embodiment 2(cDNA article one chain)

Explanation according to Takara reverse transcription test kit is carried out.

(1) the following mixed solution of preparation in the microtube pipe

(2) carry out sex change, the annealing reaction of following condition at the PCR instrument: 65 degree 5 minutes---chilling on ice.

(3) the following inverse transcription reaction liquid of preparation in above-mentioned Microtube pipe.

(4) on the PCR instrument, carry out reverse transcription reaction by following condition: 42 ℃, 60min; 70 ℃, 15min; 4 ℃ of coolings.

The amplification of embodiment 3(intermediate sequence)

The design of primers of 1 intermediate sequence

With Primer5.0 primer-design software and DNAMAN software, according to the high conservative region design primer of the aminoacid sequence of FPS in the plant.Upstream primer is YRF:5'TCAACGCCACTTCAGAGGAAAACCG3', and its gene order is shown in Seq ID No:4; Downstream primer is: its gene order of YRR:5'TCCCGCTCATACTTGTGAAATGCCGT3' is shown in Seq ID No:5.

The PCR system is: cDNA 2ul, buffer 1.5 μ L, Taq enzyme 0.3 μ L, dNTP 0.7 μ L, YRF 0.6 μ L, YRR 0.6 μ L, 10%DMSO, ddH2O 9.8 μ L.

The PCR program is: 94 ℃ of 3min, 94 ℃ of 45s, 62 ℃ of 45s, 72 ℃ of 1min, 72 ℃ of 6min, 32cycles.

The PCR result of 2 intermediate sequences detects

Get 8 μ L pcr amplification products and 1 μ L tetrabromophenol sulfonphthalein mixing, click and enter in 1.5% sepharose, electrophoresis 45min under 120V voltage, ultraviolet gel imaging system observe and take a picture.PCR obtains the dna fragmentation of a 527bp as shown in Figure 2, and the result as shown in Figure 2.

The recovery of 3 amplified fragments

The PCR product in the lower observation of ultraviolet lamp (wavelength 302nm), extracts the target DNA band through conventional sepharose (TaKaRa Agarose, 1.5% concentration) electrophoresis.Reclaim test kit (TaKaRa Agarose Gel DNA Purification KitVer2.0, the precious biological product in Dalian) with DNA glue and reclaim specific band.

(1) under ultraviolet lamp, excises the sepharose that contains target DNA with clean, aseptic operation blade, exhaust gel surface liquid with paper handkerchief, should notice that as far as possible excision does not contain target DNA gel partly this moment.

(2) in blob of viscose, add blob of viscose melting liquid DR-I Buffer.

(3) 75 ℃ of heating and melting blob of viscoses behind the mixing, should be interrupted vibration and mix this moment, makes blob of viscose fully melt (about 6～10min).

(4) add the DR-II Buffer of DR-I Buffer 1/2 volume, the pressure-vaccum mixing when the dna fragmentation that separates about 400bp, adds final concentration and is 20% Virahol again in mentioned solution.

(5) the Spin Column in the test kit is placed on the Collection Tube.

(6) solution with aforesaid operations is transferred among the Spin Column, 12000rpm, and centrifugal 1min abandons filtrate.Filtrate is added among the Spin Column again, once centrifugal, can improve the DNA rate of recovery.

(7) add 500 μ L Rinse A, the centrifugal 1min of 12000rpm abandons filtrate.

(8) add 700 μ L Rinse B, the centrifugal 1min of 12000rpm abandons filtrate.

(9) repeat 8 once.

(10) Spin Column is placed on the new 1.5mL centrifuge tube, adds sterile purified water or the Elution Buffer of 60 ℃ of preheatings of 25 μ L in Spin Column film centre, room temperature leaves standstill 1min.

(11) the centrifugal 1min of 12000rpm, eluted dna ,-20 ℃ of preservation DNA are for subsequent use.

4 reclaim the electrophoresis detection of product

Get the intermediate sequence PCR product that 5 μ L reclaim, with electrophoresis detection organic efficiency in 1.5% sepharose.

The connection of 5PCR product

Determine ratio between product and the pGEM-T Easy Vector according to the concentration that reclaims fragment.Connection Step is as follows:

(1) adds DNA 3.75 μ L, T carrier 0.25 μ L, gently mixing.

(2) 45 ℃ of water-bath 5min change 5min on ice immediately over to.

(3) add again T4DNA ligase enzyme 0.5 μ L and 2x Rapid Ligation Buffer0.5 μ L mixing, on the PCR instrument 16 ℃ connect more than the 16h.

6 transform, cultivate

(1) adding of 5 μ L connecting fluids is contained in the centrifuge tube of 50 μ L competent cells, the pressure-vaccum mixing is placed 30min on ice.

(2) 42 ℃ of water-bath heat shock 90s, immediately ice bath 2min.

(3) add 950 μ L LB liquid nutrient mediums, place 37 ℃ of shaking tables, 230rpm shaking culture 1h makes cell recovery and expresses resistance.

(4) the centrifugal 3min of 3000rmp.In Bechtop, remove 900 μ L supernatants, stay 100 μ L.

(5) get 70 μ L bacterium liquid and coat equably on the LB solid medium, remain 30 μ L and be coated on the another one LB solid medium.Be inverted for 37 ℃ and cultivate 12 16h, until bacterium colony occurs.

7 positive recombinants are identified

Get single hickie bacterium colony with the choicest of sterilization rifle and contain in the LB liquid nutrient medium of 100 μ g/mL Amp in 4mL, 230rpm, 37 ℃ of overnight shakings are cultivated.Take bacterium liquid as template, with PCR method the clone who contains Insert Fragment is screened.Bacterium liquid PCR reaction system and response procedures are with reference to above method.Get 2.5 μ L PCR reaction product, detect through 1.5% agarose gel electrophoresis.

8 extraction of plasmid DNAs

(1) get 1500 μ L bacterium liquid and add in the Eppendorf pipe, 12000rpm, centrifugal 1min abandons supernatant, drains raffinate.

(2) add 250 μ L solution I, place on the vortex vibrator and vibrate, thalline fully suspends.

(3) add 250 μ L solution II, put upside down mixing 4-6 time gently, 1min under the room temperature.Whole process does not surpass 5min.

(4) add 350 μ L solution III, mixing is placed 5min under the room temperature gently.

(5) 12000rmp, centrifugal 10min.

(6) get supernatant liquor, move in the post.The centrifugal 2mi n of 8000rmp.

(7) remove waste liquid, add 500 μ L washing solutions, 10000rmp, 1min.

(8) repeat (7).

(9) remove waste liquid, pillar is in the centrifugal 2min of 10000rmp.

(10) place 10min under the pillar room temperature.

(11) pillar is set in the new Eppendorf pipe, adds 50 μ L Elution Buffer.Place 2min under the room temperature, the centrifugal 2min of 10000rmp.(it is best that Elution Buffer is preheating to 60 ℃ of effects)

(12)-20 ℃ save backup.

9 plasmid DNA concentrations detect and order-checking

Get 2.5 μ L plasmids electrophoresis detection concentration in 1.0% sepharose.Get positive plasmid and serve the order-checking of sea living worker Bioisystech Co., Ltd.

The 10DNA sequential analysis

By DNAMAN and NCBI compare of analysis, obtain the partial sequence of maize farnesyl phosphate synthase gene.

Embodiment 4(obtains end sequence fast by the RACE technology)

RACE is based on the round pcr basis by known one section cDNA fragment, thereby obtains the method that complete 5' end and 3' hold by extend amplification to two ends.

The 1RACE primer

The upstream primer of 5'RACE: the primer UPM that test kit provides (Universal Primer A Mix),

The downstream primer of 5'RACE: 5'TCCCGCTCATACTTGTGAAATGCCGT3', its gene order is shown in Seq ID No:5;

3'RACE upstream primer: 5'TCAACGCCACTTCAGAGGAAAACCG3', its gene order shown in Seq ID No:4,

3'RACE downstream primer: the primer UPM that test kit provides (Universal Primer A Mix).

2 first chain cDNA are synthetic

(1) 1. for 5'-RACE-Ready cDNA

2. for 3 '-RACE-Ready cDNA

RNA 2μL

3'-CDS primer A 1μL

DEPC water 2μL

(2) little centrifugal.

(3) carry out 70 ℃ at the PCR instrument, 2min.

(4) place 2min on ice, little centrifugal.

(5) upwards add respectively in the pipe:

(6) vortex and centrifugal.

(7) carry out 42 ℃ at the PCR instrument, 1.5h

(8) add respectively the Tricine-EDTA Buffer of 100 μ L.

（9）72℃，7min。

(10)-20 ℃ preservation is 3 months.

3RACE rapid amplifying end sequence

(1) prepares Master Mix

(2) vortex, little centrifugal.

(3) 1. for 5'-RACE

2. for 3'-RACE

(4) mixing, centrifugal.

(5) PCR program

5'-RACE PCR program: 94 ℃ of 1min, 94 ℃ of 35s, 60 ℃ of 35s, 72 ℃ of 2min, 35 circulations, 72 ℃ of 8min.Amplify the dna fragmentation of an about 1001bp.

3'-RACE PCR program: 94 ℃ of 3min, 94 ℃ of 30s, 66 ℃ of 30s, 72 ℃ of 3min, 30 circulations, 72 ℃ of 6min.Amplify the dna fragmentation of an about 856bp.

The PCR product of gained detects through 1.5% agarose gel electrophoresis, and takes a picture, and the result as shown in Figure 3.

The materials such as described damping fluid, and concrete operation step is all according to the method operation of the SMARTTmRACE cDNA Amplification kit of Clontech Laboratories INC.

4RACE PCR product purification, connection, step of converting

RACE PCR product purification method:

The PCR product in the lower observation of ultraviolet lamp (wavelength 302nm), extracts the target DNA band through conventional sepharose (TaKaRa Agarose, 1.5% concentration) electrophoresis.Reclaim test kit (TaKaRa Agarose Gel DNA Purification KitVer2.0, the precious biological product in Dalian) with DNA glue and reclaim specific band.

(1) under ultraviolet lamp, excises the sepharose that contains target DNA with clean, aseptic operation blade, exhaust gel surface liquid with paper handkerchief, should notice that as far as possible excision does not contain target DNA gel partly this moment.

(2) in blob of viscose, add blob of viscose melting liquid DR-I Buffer.

(3) 75 ℃ of heating and melting blob of viscoses behind the mixing, should be interrupted vibration and mix this moment, makes blob of viscose fully melt (about 6～10min).

(4) add the DR-II Buffer of DR-I Buffer 1/2 volume, the pressure-vaccum mixing when the dna fragmentation that separates about 400bp, adds final concentration and is 20% Virahol again in mentioned solution.

(5) the Spin Column in the test kit is placed on the Collection Tube.

(6) solution with aforesaid operations is transferred among the Spin Column, 12000rpm, and centrifugal 1min abandons filtrate.Filtrate is added among the Spin Column again, once centrifugal, can improve the DNA rate of recovery.

(7) add 500 μ L Rinse A, the centrifugal 1min of 12000rpm abandons filtrate.

(8) add 700 μ L Rinse B, the centrifugal 1min of 12000rpm abandons filtrate.

(9) repeat 8 once.

(10) Spin Column is placed on the new 1.5mL centrifuge tube, adds sterile purified water or the Elution Buffer of 60 ℃ of preheatings of 25 μ L in Spin Column film centre, room temperature leaves standstill 1min.

(11) the centrifugal 1min of 12000rpm, eluted dna ,-20 ℃ of preservation DNA are for subsequent use.

Method of attachment

Determine ratio between product and the pGEM-T Easy Vector according to the concentration that reclaims fragment.Connection Step is as follows:

(1) adds DNA 3.75 μ L, T carrier 0.25 μ L, gently mixing.

(2) 45 ℃ of water-bath 5min change 5min on ice immediately over to.

(3) add again T4DNA ligase enzyme 0.5 μ L and 2x Rapid Ligation Buffer0.5 μ L mixing, on the PCR instrument 16 ℃ connect more than the 16h.

Method for transformation

(1) adding of 5 μ L connecting fluids is contained in the centrifuge tube of 50 μ L competent cells, the pressure-vaccum mixing is placed 30min on ice.

(2) 42 ℃ of water-bath heat shock 90s, immediately ice bath 2min.

(3) add 950 μ L LB liquid nutrient mediums, place 37 ℃ of shaking tables, 230rpm shaking culture 1h makes cell recovery and expresses resistance.

(4) the centrifugal 3min of 3000rmp.In Bechtop, remove 900 μ L supernatants, stay 100 μ L.

(5) get 70 μ L bacterium liquid and coat equably on the LB solid medium, remain 30 μ L and be coated on the another one LB solid medium.Be inverted for 37 ℃ and cultivate 12～16h, until bacterium colony occurs.

The screening of 5RACE PCR product recon

Screening method one: the bacterium liquid of hickie is carried out bacterium liquid PCR with 5'-RACE primer and 3'-RACE primer.

Screening method two: carry out bacterium liquid PCR with T7 and SP6 primer.Program is: 94 ℃ of 3min, 94 ℃ of 45s, 64 ℃ of 45s, 72 ℃ of 2min, 35cycles, 72 ℃ of 10min.

6 intermediate sequences and RACE sequence are used Contig Express 9.1 splicing full length sequences

Open contig Express9.1 software, input " Project---Add Fragments---From ABI file... ".The ABI file of selecting order-checking company to issue in " Import Sequence From " dialog box is clicked " Assemble---Assemble Selected Fragments ".Then the contig sequence of gained is manually proofreaded.

The amplification of embodiment 5(farnesyl phosphate synthase gene full length sequence)

The design of 1 primer

According to intermediate sequence and RACE sequence contig result, design total length primer.

The upstream primer sequence is YFPSF:5'CTTCTCGTCCCTTCTCGCTC3', and its gene order is shown in Seq ID No:6; The downstream primer sequence is YFPSR:5'GATAGGCTAGAAAAACATTAG3', and its gene order is shown in Seq ID No:7.

The pcr amplification of 2 full-length genes

Take the first chain cDNA as template amplification total length maize farnesyl phosphate synthase gene YFPS, its PCR system is: water9.3 μ L, 10x PCR buffer 1.5 μ L, dNTP 0.7 μ L, YFPSF 0.6 μ L, YFPSR 0.6 μ L, LATag0.3 μ L, DMSO 2 μ L.

The PCR program is: 94 ℃ of 5min, 94 ℃ of 45s, 63 ℃ of 45s, 72 ℃ of 2min, 72 ℃ of 10min, 35cycles.

The glue recovery of 3 full-length gene PCR products, connection, conversion, the detection of bacterium liquid PCR recon, plasmid extraction and order-checking

Full-length gene PCR product purification method

The PCR product in the lower observation of ultraviolet lamp (wavelength 302nm), extracts the target DNA band through conventional sepharose (TaKaRa Agarose, 1.5% concentration) electrophoresis.Reclaim test kit (TaKaRa Agarose Gel DNA Purification KitVer2.0, the precious biological product in Dalian) with DNA glue and reclaim specific band.

(1) under ultraviolet lamp, excises the sepharose that contains target DNA with clean, aseptic operation blade, exhaust gel surface liquid with paper handkerchief, should notice that as far as possible excision does not contain target DNA gel partly this moment.

(2) in blob of viscose, add blob of viscose melting liquid DR-I Buffer.

(3) 75 ℃ of heating and melting blob of viscoses behind the mixing, should be interrupted vibration and mix this moment, makes blob of viscose fully melt (about 6 10min).

(4) add the DR-II Buffer of DR-I Buffer 1/2 volume, the pressure-vaccum mixing when the dna fragmentation that separates about 400bp, adds final concentration and is 20% Virahol again in mentioned solution.

(5) the Spin Column in the test kit is placed on the Collection Tube.

(6) solution with aforesaid operations is transferred among the Spin Column, 12000rpm, and centrifugal 1min abandons filtrate.Filtrate is added among the Spin Column again, once centrifugal, can improve the DNA rate of recovery.

(7) add 500 μ L Rinse A, the centrifugal 1min of 12000rpm abandons filtrate.

(8) add 700 μ L Rinse B, the centrifugal 1min of 12000rpm abandons filtrate.

(9) repeat (8) once.

(10) Spin Column is placed on the new 1.5mL centrifuge tube, adds sterile purified water or the Elution Buffer of 60 ℃ of preheatings of 25 μ L in Spin Column film centre, room temperature leaves standstill 1min.

(11) the centrifugal 1min of 12000rpm, eluted dna ,-20 ℃ of preservation DNA are for subsequent use.

Method of attachment

Connection Step is as follows:

(1) adds DNA 3.75 μ L, T carrier 0.25 μ L, gently mixing.

(2) 45 ℃ of water-bath 5min change 5min on ice immediately over to.

(3) add again T4DNA ligase enzyme 0.5 μ L and 2x Rapid Ligation Buffer0.5 μ L mixing, on the PCR instrument 16 ℃ connect more than the 16h.

Method for transformation

(1) adding of 5 μ L connecting fluids is contained in the centrifuge tube of 50 μ L competent cells, the pressure-vaccum mixing is placed 30min on ice.

(2) 42 ℃ of water-bath heat shock 90s, immediately ice bath 2min.

(3) add 950 μ L LB liquid nutrient mediums, place 37 ℃ of shaking tables, 230rpm shaking culture 1h makes cell recovery and expresses resistance.

(4) the centrifugal 3min of 3000rmp.In Bechtop, remove 900 μ L supernatants, stay 100 μ L.

(5) get 70 μ L bacterium liquid and coat equably on the LB solid medium, remain 30 μ L and be coated on the another one LB solid medium.Be inverted for 37 ℃ and cultivate 12～16h, until bacterium colony occurs.

Bacterium liquid PCR recon detects

Get single hickie bacterium colony with the choicest of sterilization rifle and contain in the LB liquid nutrient medium of 100 μ g/mL Amp in 4mL, 230rpm, 37 ℃ of overnight shakings are cultivated.Take bacterium liquid as template, with PCR method the clone who contains Insert Fragment is screened.Bacterium liquid PCR reaction system and response procedures are with reference to above method.Get 2.5 μ L PCR reaction product, detect through 1.5% agarose gel electrophoresis.

Plasmid extraction

(1) get 1500 μ L bacterium liquid and add in the Eppendorf pipe, 12000rpm, centrifugal 1min abandons supernatant, drains raffinate.

(2) add 250 μ L solution I, place on the vortex vibrator and vibrate, thalline fully suspends.

(3) add 250 μ L solution II, put upside down mixing 4-6 time gently, 1min under the room temperature.Whole process does not surpass 5min.

(4) add 350 μ L solution III, mixing is placed 5min under the room temperature gently.

(5) 12000rmp, centrifugal 10min.

(6) get supernatant liquor, move in the post.The centrifugal 2min of 8000rmp.

(7) remove waste liquid, add 500 μ L washing solutions, 10000rmp, 1min.

(8) repeat (7).

(9) remove waste liquid, pillar is in the centrifugal 2min of 10000rmp.

(10) place 10min under the pillar room temperature.

(11) pillar is set in the new Eppendorf pipe, adds 50 μ L Elution Buffer.Place 2min under the room temperature, the centrifugal 2min of 10000rmp.(it is best that Elution Buffer is preheating to 60 ℃ of effects)

(12)-20 ℃ save backup.

Order-checking

Get 2.5 μ L plasmids electrophoresis detection concentration in 1.0% sepharose.Get positive plasmid and serve the order-checking of sea living worker Bioisystech Co., Ltd.

The prokaryotic expression of embodiment 6(farnesyl phosphate synthase gene)

1 maize farnesyl phosphate synthase gene prokaryotic expression design of primers

According to gained full length sequence sequencing result, utilize DNAMAN software that the gene order of gained is translated into aminoacid sequence, then compare to determine the ORF of maize farnesyl phosphate synthase gene with NCBI known organism farnesyl pyrophosphate synthase aminoacid sequence, design is connected into the primer of pLM1 expression vector.At the 5' of gene end, design is with 7 sub-primers of amino acid code in ribosome bind site (AGGAGGA), restriction enzyme SalI restriction enzyme site (GTCGAC), initiator codon, 6 Histidine codons and the farnesyl phosphate synthase gene: 5'CGCGCGTCGACAGGAGGAATTTAAAATGAGAGGATCGCATCATCACCACCATCA CGCGGCGGCGGCGGTGGCGTTGTC3', and its gene order is shown in Seq ID No:8; At the 3' of gene end, design has restriction enzyme Hind III restriction enzyme site (AAGCTT), terminator codon (TAG) and contains 7 amino acid whose primer: 5'CTGCAGAAGCTTCTATTTCTGCCTCTTGTAGATCTTC3' of coding, and its gene order is shown in Seq ID No:9.

The pcr amplification of 2 maize farnesyl phosphate synthase gene prokaryotic expression sequences

Take farnesyl pyrophosphate synthase full-length gene and the plasmid that do not contain mutating alkali yl as template, carry out pcr amplification, its PCR system is: water 9.3 μ L, 10x GC-PCR I buffer 1.5 μ L, dNTP 0.7 μ L, P1 0.6 μ L, P20.6 μ L, LA-Tag 0.3 μ L.

The PCR program is: 94 ℃ of 5min, 94 ℃ of 45s, 64 ℃ of 45s, 72 ℃ of 2min, 72 ℃ of 10min, 35cycles.

Gained PCR product checks order.

The enzyme of 3 farnesyl phosphate synthase gene prokaryotic expression sequence pcr amplification products is cut

Utilize Sal I and the Hind III restriction enzyme of fermentas company, the PCR of purifying and pLM I are carried out respectively enzyme cut, then glue reclaims enzyme and cuts product.Scheme is as follows:

(1) in the 0.5mL centrifuge tube, add successively:

(2) 37 ℃ of 3h, then 80 ℃ of 30min inactivators.Cut the result with 1.2% gel electrophoresis detection enzyme simultaneously.

(3) enzyme is cut correct fragment and carry out the glue recovery.

4 enzymes are cut connection and the conversion of product

According to reclaiming fragment concentrations, determine the connection ratio between purpose fragment and the pLM I endonuclease bamhi, T4DNA Ligase and the 2x Ligation Buffer of an amount of NEB of adding company behind both mixings.The vortex mixing, centrifugal.On the PCR instrument 16 ℃ connect more than the 16h.After connection is finished, Transformed E .coil DH5 α bacterial strain.Be coated on only to contain to be inverted on the antibiotic LB solid medium of amp and cultivate 16h.

5 positive colony recon PCR, enzyme are cut and are identified and plasmid extraction

Hickie on the picking substratum is with LB liquid nutrient medium incubated overnight.Then be bacterium liquid PCR.Correct positive plasmid is served the Hai Shenggong order-checking, to guarantee in the operating process such as PCR, not introduce sudden change.

The optimization of 6 farnesyl pyrophosphate synthase protein expression conditions

(1) optimization of IPTG concentration

1) from the fresh bacterium liquid of expression strain that contains recombinant plasmid, takes out respectively in the test tube that 30 μ L are seeded to the LB liquid nutrient medium (wherein containing 100 μ g/mL penbritins) that contains 10mL.

2) 37 ℃, 200rpm shaking culture to bacterium liquid OD600 value are about at 0.8 o'clock, add IPTG to final concentration be respectively 0.2,0.3,0.4,0.5,0.6mmol/L.

3) induce 8h for 37 ℃.The centrifugal collection thalline of 5000r/min 10-15min.

4) with isopyknic deionization aqua sterilisa flushing thalline.The centrifugal collection thalline of 5000r/min 10-15min.

5) with 1mL start Buffer(20mM potassiumphosphate, PH7.4,0.5M NaCl) resuspended thalline.

6) add 5mg lysozyme, 37 ℃ 1 hour.

7)-80 ℃ placement was greater than 1 hour.

8) 30 ℃ of water-baths are thawed.

9) ultrasonication cell 10s, interval 30s.(130 watts) are 1min altogether.

10) collect lysate, carry out SDS-PAGE electrophoresis, dyeing, decolouring, observation and analytical electrophoresis result.

(2) optimization of inducing temperature

1) from the fresh bacterium liquid of expression strain that contains recombinant plasmid, takes out respectively in the test tube that 30 μ L are seeded to the LB liquid nutrient medium (wherein containing 100 μ g/mL penbritins) that contains 10mL.

2) 37 ℃, 200rpm shaking culture to bacterium liquid OD600 value are about at 0.8 o'clock, add IPTG to final concentration be 0.5mmol/L, in 37 ℃ of lower 130rpm abduction delivering 8h, or (about 15 ℃) 130rpm expression of spending the night under room temperature condition.Collect thalline and carry out the ultrasonic disruption processing, carry out SDS-PAGE electrophoresis, dyeing, decolouring, observation and analytical electrophoresis result, the result as shown in Figure 6.

The great expression of 7 farnesyl pyrophosphate synthase proteins

(1) with positive recombinant plasmid transformed competence colibacillus e. coli bl21 (DE3).

(2) overnight incubation in 10mL LB substratum (Amp concentration is 100mg/L).

(3) BL21 that contains the goal gene plasmid (DE3) the bacterium liquid of getting the 5mL incubated overnight is added to 500mL LB and cultivates (Amp concentration is 100mg/L).37 ℃ of shaking tables are cultivated about 2.5h, and during to OD600=0.8, adding the IPTG(final concentration is 0.5mM) (2.5mL100mM IPTG or 59.5mg).

(4) 130rmp shaking table overnight incubation under the room temperature condition.

(5) the centrifugal collection thalline of 5000r/min 10-15min.With isopyknic deionization aqua sterilisa flushing thalline.The centrifugal collection thalline of 5000r/min10-15min.

The purifying of 8 albumen

(1) with 40mL start Buffer(20mM potassiumphosphate, PH7.4,0.5M NaCl) resuspended thalline.

(2) add 5mg lysozyme, 37 ℃ 1 hour.

(3)-80 ℃ placement was greater than 1 hour.

(4) 30 ℃ of water-baths are thawed.

(5) ultrasonication cell 10s, interval 30s.(130 watts).

(6) the centrifugal 15min of 7000r collects supernatant liquor, is used for protein purification.

(7) strainer, the syringe of Hi-Trap post and 0.45 μ m connect, and get the 5mL aqua sterilisa and slowly inject the ethanol that post is removed post.

(8) get again 3mL 0.1M single nickel salt and inject post, wash the nickel ion that does not have combination off with the 5mL deionized water, then use 5mL start Buffer balance.

(9) get the 10-20mL supernatant and inject post

(10) wash post with 5mL start Buffer.

(11) 5mL wash Buffer(20mM potassiumphosphate, PH7.4,0.5M NaCl, 50mM imidazole imidazoles) wash post.

(12) with 5mL elution Buffer (20mM potassiumphosphate, PH7.4,0.5M NaCl, 500mM imidazole) soluble protein, collect with the 1.5mL centrifuge tube, every pipe is collected 1mL.

The dialysis of 9 purifying proteins is desalted

The protein of crossing column purification is moved in dialysis tubing, dialysed 20 hours for 4 ℃ in the magnetic stirring apparatus that contains 5% glycerine, 5mM beta-mercaptoethanol, 20mM Tris-HCl damping fluid (PH7.5), dialyzate is changed 3 times in the centre.The protein of purifying saves backup in-86 ℃ of refrigerators.

The rite-directed mutagenesis of embodiment 7(maize farnesyl phosphate synthase gene codon)

The design of 1 codon mutation primer

Because the aminoacid sequence comparison is found, the 278th H of maize farnesyl pyrophosphate synthase is different from other plant with the 295th D, for inquiring into the function of these amino-acid residues, its H is sported L, codon CAT sports CTT, the primer of mutant is: YH278LF:5'GTGCAAGCTCTTGAGCTTGCAGATGAGAGCC3', and its gene order is shown in Seq ID No:10; YH278LR:5'GGCTCTCATCTGCAAGCTCAAGAGCTTGCAC,, its gene order is shown in Seq ID No:11; D is sported E, codon GAT sports GAG, the primer of mutant is: YD295EF:5'GGGAAGTCAGAGCCAGAGTCTGTTGC3', its gene order is shown in Seq ID No:12, YD295ER:5'GCAACAGACTCTGGCTCTGACTTCCC3', its gene order is shown in Seq ID No:13.

The pcr amplification system of 2 mutant

Take the maize farnesyl phosphate synthase gene wild-type expression vector plasmid that makes up as dna profiling, carry out pcr amplification.Amplification system is as follows.

In 0.5ml PCR pipe, add successively following reagent, the about 0.1 μ g of template DNA, 10 times of pfu DNA polymerasebuffer 5 μ l, 10mM dNTP mixture 1 μ l, 100 μ M forward primers, 1 μ l, 100 μ M reverse primers, 1 μ l, 2.5U/ μ l pfu DNA polymerase1 μ l adds sterilization MiliQ water to final volume 50 μ l.

Wherein, when the amplification object was maize farnesyl pyrophosphate synthase mutant H278L, forward primer was YH278LF, and reverse primer is YH278LR;

When the amplification object was maize farnesyl pyrophosphate synthase mutant D295E, forward primer was YD295EF, and reverse primer is YD295ER;

3 mutant pcr amplification programs and PCR product are processed

The pcr amplification program is 95 ℃ of sex change 30S, annealing 1min, 72 ℃ are extended 13min(and press 1kb DNA at 72 ℃ of extension 2min), totally 13 circulations.PCR finishes, and the PCR pipe is placed temperature is down to below 37 ℃, and added 1 μ l restriction enzyme DpnI (10U/ μ l) in the PCR mixture, spends the night in 37 ℃, to remove template DNA;

Wherein when the amplification object was maize farnesyl pyrophosphate synthase mutant H278L, annealing temperature was 62 ℃;

When the amplification object was maize farnesyl pyrophosphate synthase mutant D295E, annealing temperature was 64 ℃;

The purifying of 4 mutant pcr amplification products

In the DNA mixture of DpnI degraded, add isopyknic chloroform, vortex mixing, centrifugal removal protein.Supernatant liquor is transferred in the new Eppendorf centrifuge tube, added the 10M NH4Ac of 1/3 volume and the dehydrated alcohol of 8/3 volume, mixing, 4 ℃, the centrifugal 10min of 13,000rpm.Remove supernatant liquor, add an amount of 70% ethanol, centrifugal 5min under identical centrifugal speed; Remove supernatant liquor, centrifuge tube is placed 15min at Bechtop, to remove residual ethanol, then add the DNA of 20 μ l TE or sterilized water dissolving sudden change.

The conversion of 5 mutant pcr amplification products

10 μ l DNA are mixed with 80 μ l HB101 competent cells, and transfer in the electric shock cup of a precooling, place 5min on ice after, use 1.25kV or 2.5kV voltage to transform.Transform complete, the SOC nutrient solution that adds immediately the 0.5ml room temperature in the electric shock cup, mixing, and transfer in the new Eppendorf centrifuge tube, in 37 ℃ of shaking tables, after 200rpm cultivates 40min, the centrifugal 30S of 8000rpm, stay 50-100 μ l supernatant liquor suspension sedimentation cell, then be coated on the LB plate culture medium that contains penbritin, be inverted incubated overnight for 37 ℃.

6 mutant plasmid DNA extraction, order-checking

Picking 3-5 bacterium colony of growing at the LB plate culture medium is seeded in the LB liquid nutrient medium, cultivates 6 hours the plasmid of amplification sudden change for 37 ℃.Extract plasmid DNA, and order-checking, the bacterium colony that produces sudden change chosen.

7 mutant prokaryotic expressions, protein purification, enzyme assay

Positive colony is transformed in the expression strain, carries out protein expression, purifying and enzyme assay and enzyme kinetics are measured, and concrete grammar is with embodiment 6 and embodiment 8.

The determination of activity of embodiment 8(maize farnesyl pyrophosphate synthase)

The activity of maize farnesyl pyrophosphate synthase, the mensuration of kinetic parameter, the tetra-sodium that utilizes Pyrophosphate phosphohydrolase that enzymatic reaction is produced changes into monophosphate and forms colourless Keggin type molybdenum phosphate hydrochlorate mixture (PmoVI 12O403-) with the molybdate reaction, be formed on the blue complex (PMoV4MoVI8O407-) that 830nm has absorption peak by the beta-mercaptoethanol reduction, available spectrophotometer detects, and specifically tests as follows.

1 adds following reagent successively in each hole of the dull and stereotyped microplate reader in 96 holes, the cumulative volume that makes reaction system is 100 μ L.

77.5μl H2O,

50mM Tris，5μL（1M）

2mM MgCl2,5μL（40mM）

5mg/ml BSA,5μL（100mg/ml）

1mM DTT,5μL（20mM）

0.5μL IPP（200mg/200mL）

0.5 μ L DMAPP(200mg/200mL) or GPP

0.1 μ g FPPS(can according to circumstances adjust)

Put into 37 ℃ of reactions of microplate reader 5min behind the mixing.

2 take out 96 orifice plates adds 0.5mL pyrophosphatase, puts into 37 ℃ of reactions of microplate reader 5min.

3 take out 96 orifice plates adds the 10mL ammonium molybdate, puts into 37 ℃ of reactions of microplate reader 5min.

4 take out 96 orifice plates adds the 10mL beta-mercaptoethanol, and 5mL Eikonogen Reagent puts into 37 ℃ of reactions of microplate reader 20min.

5 take out 96 orifice plates takes down lid, puts into microplate reader and reads 830nm place absorbancy.

The mensuration of enzyme kinetics parameter: to the mensuration of the KM value of IPP, at first fixedly the concentration of DMAPP is 33.6mM, measures the enzyme activity unit under 5 different concns of IPP; To the mensuration of the KM value of DMAPP, at first fixedly the concentration of IPP is 33.6mM, measures the enzyme activity unit under 5 different concns of DMAPP; To the mensuration of the KM value of GPP, at first fixedly the concentration of IPP is 33.6mM, measures the enzyme activity unit under 5 different concns of GPP, then according to meeh's formula y=ax/ (b+x), utilizes SigmaPlot12 can obtain KM value and Vmax value.

Finally record wild-type maize farnesyl pyrophosphate synthase the Vmax of substrate dimethyl allene tetra-sodium (DMAPP), isopentenylpyrophosphate (IPP) and geranyl tetra-sodium (GPP) is respectively 10.0 ± 0.6,31.2 ± 0.8 and 23.3 ± 0.8mo l/min/mg; The KM value is respectively 0.80 ± 0.12,0.71 ± 0.04 and 0.76 ± 0.06 μ M; Kcat is respectively 0.23 ± 0.01,0.72 ± 0.02 and 0.54 ± 0.02S-1, Kcat/KM is respectively 2.88x105,1.01x106 and 7.11x105M-1S-1, and proof clone's wild-type maize farnesyl phosphate synthase gene has natural biological function thus.

Record maize farnesyl pyrophosphate synthase mutant H278L the Vmax of substrate dimethyl allene tetra-sodium (DMAPP), isopentenylpyrophosphate (IPP) and geranyl tetra-sodium (GPP) is respectively 16.1 ± 1.4,46.3 ± 2.8 and 41.9 ± 6.3mol/min/mg; The KM value is respectively 2.31 ± 0.35,1.52 ± 0.19 and 2.27 ± 0.62 μ M; Kcat is respectively 0.88 ± 0.08,2.53 ± 0.15 and 2.29 ± 0.34S-1, and Kcat/KM is respectively 3.81x105,1.66x106 and 1.01x106M-1S-1;

Record maize farnesyl pyrophosphate synthase mutant D295E the Vmax of substrate dimethyl allene tetra-sodium (DMAPP), isopentenylpyrophosphate (IPP) and geranyl tetra-sodium (GPP) is respectively 32.6 ± 2.1,76.3 ± 0.8 and 70.9 ± 9.5mol/min/mg; The KM value is respectively 2.14 ± 0.25,0.46 ± 0.02 and 2.15 ± 0.51 μ M; Kcat is respectively 2.55 ± 0.16,5.97 ± 0.06 and 5.54 ± 0.74S-1, Kcat/KM is respectively 1.19x106,1.30x107 and 2.58x106M-1S-1, show by the change to the amino-acid residue codon, can improve the catalytic activity of enzyme, L-glutamic acid (E) residue of wherein replacing is comparatively remarkable to the raising of enzymic activity.

The present invention is for further carrying out genetic modification and modification, make up the eukaryotic gene expression vector of farnesyl phosphate synthase gene and transform corresponding crop, especially obtain the plant of important commercial value by secondary metabolism, inquire into overexpression and the secondary metabolite of farnesyl phosphate synthase gene in recipient plant, crop kernel size and grain heavily wait the relation of Main Agronomic Characters, and then raising crop yield, and to the farnesyl phosphate synthase gene intron, exon and promoter structure are analyzed, the research promoter function, develop relevant molecule marker the important technology deposit is provided.

Claims (3)

1. the coding region gene sequence of maize farnesyl phosphate synthase gene YFPS is shown in Seq ID No:1, and the aminoacid sequence of its coding is shown in Seq ID No:2.

2. maize farnesyl phosphate synthase gene YFPS as claimed in claim 1 is at the eukaryotic gene expression vector that makes up farnesyl phosphate synthase gene and transform application on the corresponding crop.

3. application rights requires 1 described maize farnesyl phosphate synthase gene to carry out rite-directed mutagenesis.

Images