CN107384888B - Mutation-modified high-temperature-resistant trehalose synthase and application thereof - Google Patents
Mutation-modified high-temperature-resistant trehalose synthase and application thereof Download PDFInfo
- Publication number
- CN107384888B CN107384888B CN201710661311.6A CN201710661311A CN107384888B CN 107384888 B CN107384888 B CN 107384888B CN 201710661311 A CN201710661311 A CN 201710661311A CN 107384888 B CN107384888 B CN 107384888B
- Authority
- CN
- China
- Prior art keywords
- trehalose synthase
- leu
- asp
- arg
- pro
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/12—Disaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01245—Alpha,alpha-trehalose synthase (2.4.1.245)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a high-temperature resistant trehalose synthase modified by mutation and application thereof. A high-temperature resistant trehalose synthase modified by fragment mutation is characterized in that the 145 th to 156 th amino acids of the trehalose synthase of Thermobaculum terrenum are mutated from KDSRIIFIDTER fragments into ADTRIIFTDTEV, or the 145 th amino acid is mutated from isoleucine into threonine. The invention carries out mutation design on key amino acid of a substrate entering channel of the trehalose synthase for the first time, and the catalytic efficiency of the modified trehalose synthase is improved to a certain extent compared with that of the original trehalose synthase under the same reaction condition, particularly reflects the influence on the reaction balance time, and can be balanced by improving the balance from more than 10 hours to 4 hours, thereby laying the foundation for the industrial production of the trehalose.
Description
Technical Field
The invention relates to a high-temperature-resistant trehalose synthase modified by mutation and application thereof, in particular to a modified thermophilic bacterium thermobacter terrinum trehalose synthase (TtTS) crystal structure and application thereof, and relates to a trehalose synthase which is obtained by directional modification and has good thermal stability and high catalytic efficiency and application thereof, belonging to the technical field of biotechnology.
Background
Trehalose (Trehalose) is a non-reducing disaccharide composed of two pyranoid ring glucose molecules connected by α -1, 1-glycosidic bonds, widely exists in organisms such as bacteria, yeast, filamentous fungi, plants, insects, invertebrates, and the like, and has a stable property and a very important biological significance in organisms.
In view of the wide and important application value of trehalose, research on finding efficient, convenient and low-cost production methods of trehalose is widely regarded. The prior trehalose production methods mainly comprise a yeast extraction method, a fermentation method and an enzymatic synthesis method. The trehalose produced by the enzyme method has the characteristics of high specificity, rapidness, mildness and the like, and becomes a hot spot for researching and developing trehalose industrial production and is one of feasible ways with short-term effect.
Trehalose synthase (EC5.4.99.16, Trehalose synthase, TreS) is an intramolecular glucosyltransferase which can convert α -1,4 glycosidic bond of maltose into α -1,1 glycosidic bond to generate Trehalose by only one step of reaction, has short reaction process, is easy to regulate, does not need to consume high-energy substances, does not need to coexist with phosphate, and only needs one enzyme to react in one step, so the Trehalose synthase conversion method is a method suitable for industrial production of Trehalose, has good application prospect and receives wide attention.
Chinese patent document CN104946610A (application No. 201510363951.X) discloses a high-temperature resistant trehalose synthase and an expression gene and application thereof. The nucleotide sequence of the modified expression gene of the high-temperature resistant trehalose synthase is shown as SEQ ID No. 1; the amino acid sequence of the modified high-temperature resistant trehalose synthase is shown as SEQ ID NO. 2. The invention firstly cuts off a flexible region in a structure based on a three-dimensional structure of Pseudomonas putida trehalose synthase (Pseudomonas putida KT2440), and retains a stable structural domain of an active center thereof, thereby obtaining more stable trehalose synthase.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a high-temperature resistant trehalose synthase which is subjected to mutation transformation and application thereof. The mutated trehalose synthase is subjected to site-directed mutagenesis on the crystal structure and the three-dimensional structure of the original enzyme, so that the catalytic efficiency of the enzyme is improved.
The technical scheme of the invention is as follows:
a high-temperature resistant trehalose synthase modified by fragment mutation is characterized in that the amino acid from the 145 th to 156 th positions of the trehalose synthase of Thermobaculum terrenum is mutated from KDSRIIFIDTER fragment into ADTRIIFTDTEV.
Preferably, the amino acid sequence of the high-temperature resistant trehalose synthase modified by fragment mutation is shown as SEQ ID NO. 2.
The expression gene of the high-temperature resistant trehalose synthase modified by fragment mutation has a nucleotide sequence shown in SEQ ID No. 1.
A high-temperature resistant trehalose synthase modified by point mutation is characterized in that the 145 th amino acid of the trehalose synthase of Thermobaculum terrenum is mutated from isoleucine to threonine.
According to the invention, the amino acid sequence of the high-temperature resistant trehalose synthase modified by point mutation is shown as SEQ ID NO. 4.
The expression gene of the high-temperature resistant trehalose synthase modified by point mutation has a nucleotide sequence shown in SEQ ID No. 3.
The invention provides a crystal structure of trehalose synthase, and the three-dimensional structure is shown in figure 1.
The crystal structure of the trehalose synthase is monomer protein and contains a Tris (Tris hydroxymethyl) aminomethane ligand.
Space group: i4122;
cell parameters
a＝159.176，b＝159.176，c＝152.815；
The molecular weight of the trehalose synthase is as follows: 68KDa
The trehalose synthase with higher catalytic efficiency is obtained by mutating some amino acids in a flexible region of a protein substrate access channel by a molecular biological means according to the crystal structure of the existing Thermobacuumterrenum trehalose synthase and screening the trehalose synthase with higher catalytic efficiency. The modified trehalose synthase is obtained by utilizing a series of purification means such as affinity chromatography, ion exchange chromatography, molecular sieve chromatography and the like after being efficiently expressed by escherichia coli pronucleus. The catalytic efficiency of the trehalose synthase is obviously improved compared with the original trehalose synthase.
A recombinant plasmid, which contains the expression gene of the high-temperature resistant trehalose synthase.
According to the invention, the carrier plasmid of the recombinant plasmid is pET-21 b.
A transgenic cell line, wherein the recombinant vector is transformed in the transgenic cell line.
Preferably, according to the invention, the host cell of the transgenic cell line is Escherichia coli BL21DE (3).
The expression gene, recombinant plasmid or transgenic cell line of the high-temperature resistant trehalose synthase is applied to the preparation of the high-temperature resistant trehalose synthase.
The application of the high-temperature resistant trehalose synthase in preparing trehalose.
The trehalose synthase is obtained by molecular modification of Thermobaculum terrenum trehalose synthase. The specific method comprises the following steps: according to the crystal structure of the Thermobaculum terrenum trehalose synthase, mutation is carried out on a trehalose synthase substrate access channel to construct a mutant (1), wherein the 145 th 156 th position of the mutant is mutated from TtTS: KDSRIIFIDTER to DsTS: ADTRIIFTDTEV; (2) i is mutated into T from TsTS at 145 th site; then, the trehalose synthase with higher catalytic efficiency is obtained by testing the mutant.
Advantageous effects
The invention reports the three-dimensional structure of the trehalose synthase of thermotolerant bacteria for the first time, and performs mutation design on key amino acid of a substrate entry channel on the basis of the structure of the trehalose synthase to obtain the novel trehalose synthase with good thermal stability and higher catalytic efficiency. Experiments prove that the catalytic efficiency of the modified trehalose synthase is improved to a certain extent compared with that of the original trehalose synthase under the same reaction conditions, particularly the influence on the reaction equilibrium time is reflected, and the balance can be improved to 4 hours from the original balance reaching more than 10 hours, so that the foundation is laid for the industrial production of the trehalose.
Drawings
FIG. 1 is a crystal structure diagram of Thermobaculum terrenum trehalose synthase;
in the figure: (A) the color of domains A, B and C in the structure is dark gray, and light gray, respectively, (B) the secondary structure of TtTS;
FIG. 2 is a graph comparing TtTS and MtTS structures;
FIG. 3 is a metal ion binding site in TtTS;
in the figure: the electron density diagram (FO-FC) shows four metal ion binding sites.
FIG. 4 is a graph of the effect of trehalose synthase reaction time on conversion after molecular engineering;
in the figure: (A) represents TtTS before mutagenesis; (B) a graph representing the effect of the reaction time of the fragment mutant TtTS: KDSRIIFIDTER (145-156)/DsTS: ADTRIIFTDTEV on the conversion; (C) graph representing the effect of reaction time on conversion for the point mutant TsTS I145T.
Detailed Description
The technical solution of the present invention is further illustrated with reference to the following examples, but the scope of the present invention is not limited thereto.
Example 1: the present invention mainly relates to a crystal structure of TtTS and a method for analyzing the same. In one aspect, the invention further resolves the crystal structure of TtTS on a molecular level basis. The structural information of the protein is suitable for designing enzyme with high stability and high catalytic activity.
Cloning to obtain Thermobaculum terrenum trehalose synthase gene
According to the full-length amino acid sequence of Thermobaculum terrenum trehalose synthase (TtTS) disclosed in NCBI as a template, PCR amplification is carried out by using specific primers, wherein the nucleotide sequences of the primers are as follows:
upstream primer CGCACCCCTCCGATCCCA
Downstream primer AGGCAGCTGTTCCTGTGGTT
The PCR reaction system is as follows:
the above PCR reaction was performed according to the following procedure:
pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, extension at 72 ℃ for 4min, 28 cycles; final extension at 72 deg.C for 10 min;
after the PCR is finished, the length of the fragment is analyzed through agarose gel electrophoresis with the mass concentration of 1%, a 1644bp target band is cut according to the size of the fragment, and a DNA purification kit of the Boda Tak is used for recovering gel cutting products.
Example 2: transforming the modified trehalose synthase gene into an expression host to obtain a positive expression strain
Double digestion reaction of plasmid vector
Reaction conditions are as follows: reacting for 2-3 h at 37 ℃.
Fragment PCR System:
and (3) carrying out electrophoresis on the PCR product and the double enzyme digestion product of the vector through 1% agarose gel, and carrying out purification and recovery by using a DNA gel recovery kit to prepare a ligation product.
The nucleotide sequences of the primers are shown below:
upstream primer 1(TtTS145-156): GTGCCGCGCGGCAGCCATATGATGAATGATGATCCGACGTGG
Downstream primer 1(TtTS145-156) TCGGTGAAGATGATGCGGGTGTCGGCGTATTTATCATCCGTATCGCTCCA
Upstream primer 2(TtTS145-156) GCATCATCTTCACCGACACCGAGGTCTCTAATTGGACCTGGGATCAGG
Downstream primer 2(TtTS145-156) TTGTCGACGGAGCTCGAATTCAGGCAGCTGTTCCTGTGGTTT
Upstream primer 1 (TtstS: I145T): GTGCCGCGCGGCAGCCATATGATGAATGATGATCCGACGTGG
Downstream primer 1 (TtstS: I145T): GCGTTCCGTATCCGTAAAGATGATGCGTGCATCT
Upstream primer 2 (TtstS: I145T): TCTTTACGGATACGGAACGCTCTAATTGGAC
Downstream primer 2 (TtstS: I145T): TTGTCGACGGAGCTCGAATTCAGGCAGCTGTTCCTGTGGTTT
Transformation of recombinant plasmids
(1) Preparation of competent cells
① selecting BL21 single colony (or selecting preserved strain) to inoculate into 10ml liquid LB culture medium, culturing at 37 deg.C and 210rpm overnight;
② inoculating 5ml of the bacterial liquid into 500ml of LB medium, shaking at 37 ℃ and 210rpm for 70-80 min to OD600To 0.375;
③ placing the bacterial liquid on the ice-water mixture for 10min, and precooling a 50ml centrifuge tube at the same time;
④ transferring the bacterial liquid into a centrifuge tube, collecting the thallus at 4 ℃, 3700rpm for 10min, and discarding the supernatant;
⑤ approximately 10ml of ice-cold activation buffer (0.1M CaCl) was added to each centrifuge tube2) By usingDispersing the sterilized 5ml of gunpoint, adding about 30ml of ice-precooled activation buffer solution into each tube, reversing, uniformly mixing, and standing on ice for 20 min;
⑥ 4 deg.C, 3700rpm, centrifuging for 10min, discarding supernatant, draining residual liquid, pre-cooling with ice and storing buffer (0.1M CaCl) in 500ml bacterial liquid 12ml215% glycerol), break up the precipitate, (transfer in portions, then break up by suction).
⑦ the competence was dispensed into ice-pre-cooled sterilized EP, 100. mu.l per tube, and placed on ice (a pot of ice-water mix was prepared).
⑧ and freezing at-80 deg.C to obtain competent cell.
Note that: the whole process is carried out at low temperature as much as possible, the used gun tips, centrifuge tubes, EP tubes, buffers and the like are sterilized, the whole process is operated in a super clean bench, and test efficiency and whether contamination is caused after competent cells are finished are carried out.
(2) Ligation product conversion
① mu.L of the ligation product was added to 100. mu.L of freshly prepared competent cells BL21DE (3), mixed gently and ice-cooled for 30 min;
② 42 deg.C heat shock for 90s, and rapidly cooling in ice bath for 3 min;
③ adding 200 μ L LB culture medium, shaking at 37 deg.C and 180rpm/min for 60min to restore normal growth state of bacteria, and expressing antibiotic resistance gene encoded by plasmid;
④ spreading 200 μ L of the above bacterial liquid on resistant LB solid medium (ampicillin 100 mg/L);
⑤ after the bacterial liquid is sucked dry, the plate is inverted and cultured for 12-16 h at 37 ℃.
Identification of Positive clones
(1) Colony PCR identification
Selecting a single colony, carrying out shake culture at 37 ℃ for 6-8 h, sucking 1 mu L of bacterial liquid, and carrying out PCR identification according to a 15 mu L PCR reaction system; if the clone is positive, a target band can be detected by agarose gel electrophoresis.
(2) Protein expression and solubility identification
Adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.6mM into the residual bacterial liquid after colony PCR identification, inducing and expressing for 1h at 12000rpm/min, centrifuging for 1min, discarding supernatant, and collecting thalli. Add 2 Xloading buffer (purchased from Shanghai bio-protein loading buffer), suspend the pellet with the tip of a gun, and denature for 10min at 90 ℃. If the clone is positive, protein expression can be detected by SDS-PAGE.
(3) DNA sequencing
The positive clone identified by the two methods is sequenced to obtain the nucleotide sequence shown as SEQ ID NO.1 inserted in the positive clone.
Example 3: fermenting and culturing positive expression strain, separating and purifying trehalose synthase recombinant protein
Seed culture: selecting positive clones by a conventional method, placing the positive clones in 5mL of LB liquid medium containing 100mg/L ampicillin, and carrying out shake culture at 37 ℃ for 5-6 h;
ultrasonic disruption of bacterial cells: ultrasound 3s, interval 6s, 400W, 60 times.
Ultracentrifugation: the cell disruption solution after the ultrasonic treatment is centrifuged for 45min at 14000rpm and 4 ℃, and the supernatant is collected for further separation and purification.
Ni-NTA affinity chromatography: pouring the collected supernatant containing the soluble protein into a regenerated Ni-NTA column; after the supernatant was flushed, 10 column volumes were washed with wash buffer (25mM Tris-HCl, pH8.0, 100mM NaCl, 15mM imidazole) to remove non-specifically adsorbed proteins; eluting the target protein with an elution buffer (25mM Tris-HCl, pH8.0, 100mM NaCl, 250mM imidazole), and collecting with a clean pre-cooled beaker; SDS-PAGE electrophoresis was used to determine whether the protein was soluble, whether the soluble protein was able to bind to Ni-NTA, whether it could be eluted and the concentration of the protein.
Anion exchange chromatography purification (Source-Q): soluble protein removed by Ni-NTA affinity chromatography is diluted 3-4 times with solution A (25mM Tris-HCl, pH8.0), loaded onto ion exchange column SourceQ well balanced with solution A, and eluted with linear gradient using solution A and solution B (25mM Tris-HCl, pH8.0, 1M NaCl). The change in absorbance at 280nm (A280) was observed, and the collected tubes near the respective peak positions were collected and subjected to SDS-PAGE electrophoresis to obtain the target protein.
Purifying a molecular sieve: the character of the protein on the ion exchange column is judged according to the shape of the protein peak of the ion exchange column, whether the protein peak has a shoulder or not, whether the protein peak is symmetrical or sharp or not. The well-characterized protein was concentrated to 2mL by ultrafiltration and loaded onto a gel filtration chromatography column Superdex-200 equilibrated with solution C (25mM Tris-HCl, pH8.0, 100mM NaCl) at a flow rate of 0.4 mL/min. And collecting protein peaks, performing SDS-PAGE electrophoresis, and detecting the purity and the properties of the protein. The amino acid sequence is shown in SEQ ID NO.2 after sequencing.
Example 4: trehalose synthase crystal obtaining
The purified protein sample (95% electrophoretically pure) was centrifuged at 12,000rpm for 1min at 4 ℃ and the supernatant was mixed with the pool liquid (Well buffer) as the solution was added. The initial screening for Crystal growth was carried out using approximately 600 conditions of Index1-96, Crystal screen II, SaltRx, Wizard I, Wizard II, Wizard III, PEG ion, PEGRx-1 and Natrix, respectively. Hanging drop optimization was performed for the conditions with crystals (confirmed by microscopic observation, crystal staining and crystal lysis running SDS electrophoresis) to obtain higher resolution protein crystals.
Example 5: trehalose synthase Structure assay
Before collecting crystal data, the diffraction quality of the crystal needs to be pre-tested, the crystal with better diffraction quality is selected for low-temperature freezing, and then a synchrotron radiation light source is used for data collection. The crystals were frozen in liquid nitrogen using 15-20% glycerol as an anti-freeze and data collection was performed at a temperature of 100K. Data collection is performed by using a Shanghai synchrotron radiation light source BL17U wire station, and a detector is ADSC Q315 r. The X-ray diffraction data were processed by HKL-2000, and R-factors of TtTS were rwok-0.1760 and Rfree-0.2148, respectively. The final results of data diffraction and collection are shown in table 1:
TABLE 1 data processing of TtTS crystal structure
Example 6: structural modification of trehalose synthase
Researches show that Thermobaculum terrinum trehalose synthase has the problem of low catalytic efficiency, particularly in the aspect of too long reaction equilibrium time, which greatly limits the application of the trehalose synthase in industry. Through amino acid sequence alignment and structural superimposition of Thermobaculum terrenum trehalose synthase and Deinococcus radiodurans trehalose synthase, it is found that changes to the substrate access channel improve the catalytic efficiency of Thermobaculum terrenum trehalose synthase. The mutant with higher catalytic efficiency is obtained by adopting a method of integral mutation and key amino acid site-directed mutation.
Example 7: method for determining enzyme activity of trehalose synthase
20% maltose and 20mM Na were added to the reaction system2HPO4-NaH2PO4Buffer pH7.0, 1. mu.M trehalose synthase from Herhermobacterium terrenum, at 37 ℃ for 2 h. Determining the conversion rate of trehalose by a high-pressure liquid phase method, wherein an amino column is adopted in the determination process; the column temperature is 40 ℃, the mobile phase adopts a mixed solution of acetonitrile and water, and the volume ratio of the acetonitrile to the water is 3: 1; the flow rate is 1 mL/min; the detector is a differential detector; the detection time is 25 min. The results of the standard product detection are shown in FIG. 3, and the conversion is calculated according to the following formula:
and fitting a curve by using software according to the maltose peak area, the trehalose peak area and the glucose peak area in the high performance liquid chromatography result to calculate the mass of the three, wherein m3 is the mass converted into trehalose, m2 is the mass converted into glucose, and m1 is the mass of the residual maltose.
Examples of the experiments
Separately using an unmutated trehalose synthase (TtTS); fragment-mutated trehalose synthase (DsTS) and point-mutated trehalose synthase (TsTS) were determined as described in example 7, and the results are shown in FIG. 4.
As shown in FIG. 4, when A is subjected to fragment mutation, it is obvious that the equilibrium time is shortened by about 6 hours compared with that of the non-mutated A, and the conversion rate is also improved to a certain extent; and for B (TsTS: I145T), the key amino acid is mutated, the balance time is shortened and the conversion rate is greatly improved compared with that before mutation, and the improvement on the enzyme activity is more remarkable.
As can be seen from FIG. 4, since the substrate channel domain is mainly composed of KDARIIFIDTER (138-149)12 amino acids, the mutation of the fragment was performed based on the amino acid sequence alignment and structural superimposition of Thermobaculum terrenum trehalose synthase and Deinococcus radiodurans trehalose synthase, and the mutation was found to greatly improve the reaction equilibrium time by HPLC and to improve the transformation efficiency to some extent.
On the basis, key amino acids in 12 amino acids of the substrate channel domain are mutated (TsTS: I145T), and the result of HPLC shows that the mutation of isoleucine at the 145 th position of Thermobaculum terrenum trehalose synthase into threonine greatly improves the enzyme activity.
The results show that the invention modifies the catalytic channel of the thermophilic bacterium Thermobaculum terrinum trehalose synthase to obtain the trehalose synthase with higher catalytic efficiency and better thermal stability, this is quite different from the modification of trehalose synthase described in Chinese patent publication CN104946610A (application No. 201510363951.X), mainly because the present invention does not adopt a method of cutting off the flexible region in the structure to retain the active center, but mutating amino acids which play a key role therein, the structural integrity is kept as much as possible, which has the advantages of greatly improving the enzyme activity, but also basically does not affect other properties of the trehalose synthase, and can further explore the role of the amino acids in the mechanism that the trehalose synthase catalyzes the substrate maltose to be converted into the trehalose as the target product, thereby providing certain support for the follow-up research.
SEQUENCE LISTING
<110> university of Qilu Industrial science
<120> high-temperature resistant trehalose synthase modified through mutation and application thereof
<160>4
<170>PatentIn version 3.5
<210>1
<211>1644
<212>DNA
<213> Artificial Synthesis
<400>1
atgaatgatg atccgacgtg gtacaaagat gccattatct atgaagtggg cgtgcgttgc 60
tttttcgata gcaacaacga tggtagcggt gacattccgg gtctgacggc taaactggat 120
tatatcgaat ctttaggtgt gacagccatt tggctgttac cgttttatgc tagtccactg 180
aaagatggcg gctatgacat atcagattat cgtagcttac atccggattt tggtacgatc 240
gaagatttta aagtgtttct ggatgaagca catcgtcgcg gcattcgcgt tatcaccgaa 300
ttagtgctga atcatacgag cgatcagcat cagtggtttc gcgaagcccg ctctaatccg 360
aatagtccat atcgtgatta ttatgtgtgg agcgatacgg atgataaata cgccgacacc 420
cgcatcatct tcaccgacac cgaggtctct aattggacct gggatcagga agcgggcaaa 480
tattattggc atcgcttctt cagtcatcag ccggacttga attatgataa tcctaaagtt 540
cagcaggaaa ttctggatat tgtgggctat tggttagata tgggcgttga tggtctgcgc 600
ttagatgcag ttccttatct gtatgaacgc gaaggtacaa attgcgaaaa cctcccagaa 660
acacatgaat ttctgaaaaa actgcgcaaa tttgttgatg ataattggcc taatcggatg 720
ctgttagcag aagccaatca gtggccagaa gatgttgttg cctattttgg taatggcgat 780
gaatgtcaca tggcctatca ttttcctatc atgccacgca tgtatatggc cctgcgccgc 840
gaagatcgtc atccaatcac ggaaatctta cgccgcaccc ctccgatccc agaaacatgt 900
cagtgggccc tgtttctgcg caatcatgat gaactgacct tagaaatggt gacggatgaa 960
gaacgcgatt atatgtatca tgaatatgcc aaagatcctc gaatgcgcct gaacttgggc 1020
attcgtcgcc gcttagctcc gttactggat aatagcgaac gtcgcattca gttaatgcac 1080
ctgctgctgt ttaccttacc gggtacacca atcatctatt atggcgatga aatcggcatg 1140
ggggacaatg tgtacctggg cgatcgtgat ggcgtgcgca ccccaatgca gtggagcggg 1200
gatcgtaatg cgggcttttc tcgcgctaat ccacaggccc tgtatcttcc tcctattcgt 1260
gatccggtgt tcacctatga agccgttaat gtggaagccc aggaacaggt tccgacctca 1320
ctgttaaatt ggatgaaacg taccattcag attagaaaga aatatccggt gtttggtcgc 1380
ggctcaattc gctttttaca gccaagtaat cgtgcagttc tggcctatat tcgccagtat 1440
caggatacaa ccatcctgtg cgcttgcaat ctgagtcgct tttgtcaggc agcagaactg 1500
gatctgagcg attttaaagg tctgtatccg gttgaactgt atggcaaaac cgtgtttcca 1560
cagatcggcg aactgccgta tctgctgacc tttggtccac atgtgtttta ttggtttgaa 1620
ttaaaaccac aggaacagct gcct 1644
<210>2
<211>548
<212>PRT
<213> Artificial Synthesis
<400>2
Met Asn Asp Asp Pro Thr Trp Tyr Lys Asp Ala Ile Ile Tyr Glu Val
1 5 10 15
Gly Val Arg Cys Phe Phe Asp Ser Asn Asn Asp Gly Ser Gly Asp Ile
20 25 30
Pro Gly Leu Thr Ala Lys Leu Asp Tyr Ile Glu Ser Leu Gly Val Thr
35 40 45
Ala Ile Trp Leu Leu Pro Phe Tyr Ala Ser Pro Leu Lys Asp Gly Gly
50 55 60
Tyr Asp Ile Ser Asp Tyr Arg Ser Leu His Pro Asp Phe Gly Thr Ile
65 70 75 80
Glu Asp Phe Lys Val Phe Leu Asp Glu Ala His Arg Arg Gly Ile Arg
85 90 95
Val Ile Thr Glu Leu Val Leu Asn His Thr Ser Asp Gln His Gln Trp
100 105 110
Phe Arg Glu Ala Arg Ser Asn Pro Asn Ser Pro Tyr Arg Asp Tyr Tyr
115 120 125
Val Trp Ser Asp Thr Asp Asp Lys Tyr Ala Asp Thr Arg Ile Ile Phe
130 135 140
Thr Asp Thr Glu Val Ser Asn Trp Thr Trp Asp Gln Glu Ala Gly Lys
145 150 155 160
Tyr Tyr Trp His Arg Phe Phe Ser His Gln Pro Asp Leu Asn Tyr Asp
165 170 175
Asn Pro Lys Val Gln Gln Glu Ile Leu Asp Ile Val Gly Tyr Trp Leu
180 185 190
Asp Met Gly Val Asp Gly Leu Arg Leu Asp Ala Val Pro Tyr Leu Tyr
195 200 205
Glu Arg Glu Gly Thr Asn Cys Glu Asn Leu Pro Glu Thr His Glu Phe
210 215 220
Leu Lys Lys Leu Arg Lys Phe Val Asp Asp Asn Trp Pro Asn Arg Met
225 230 235 240
Leu Leu Ala Glu Ala Asn Gln Trp Pro Glu Asp Val Val Ala Tyr Phe
245 250 255
Gly Asn Gly Asp Glu Cys His Met Ala Tyr His Phe Pro Ile Met Pro
260 265 270
Arg Met Tyr Met Ala Leu Arg Arg Glu Asp Arg His Pro Ile Thr Glu
275 280 285
Ile Leu Arg Arg Thr Pro Pro Ile Pro Glu Thr Cys Gln Trp Ala Leu
290 295 300
Phe Leu Arg Asn His Asp Glu Leu Thr Leu Glu Met Val Thr Asp Glu
305 310 315 320
Glu Arg Asp Tyr Met Tyr His Glu Tyr Ala Lys Asp Pro Arg Met Arg
325 330 335
Leu Asn Leu Gly Ile Arg Arg Arg Leu Ala Pro Leu Leu Asp Asn Ser
340 345 350
Glu Arg Arg Ile Gln Leu Met His Leu Leu Leu Phe Thr Leu Pro Gly
355 360 365
Thr Pro Ile Ile Tyr Tyr Gly Asp Glu Ile Gly Met Gly Asp Asn Val
370 375 380
Tyr Leu Gly Asp Arg Asp Gly Val Arg Thr Pro Met Gln Trp Ser Gly
385 390 395 400
Asp Arg Asn Ala Gly Phe Ser Arg Ala Asn Pro Gln Ala Leu Tyr Leu
405 410 415
Pro Pro Ile Arg Asp Pro Val Phe Thr Tyr Glu Ala Val Asn Val Glu
420 425 430
Ala Gln Glu Gln Val Pro Thr Ser Leu Leu Asn Trp Met Lys Arg Thr
435 440 445
Ile Gln Ile Arg Lys Lys Tyr Pro Val Phe Gly Arg Gly Ser Ile Arg
450 455 460
Phe Leu Gln Pro Ser Asn Arg Ala Val Leu Ala Tyr Ile Arg Gln Tyr
465470 475 480
Gln Asp Thr Thr Ile Leu Cys Ala Cys Asn Leu Ser Arg Phe Cys Gln
485 490 495
Ala Ala Glu Leu Asp Leu Ser Asp Phe Lys Gly Leu Tyr Pro Val Glu
500 505 510
Leu Tyr Gly Lys Thr Val Phe Pro Gln Ile Gly Glu Leu Pro Tyr Leu
515 520 525
Leu Thr Phe Gly Pro His Val Phe Tyr Trp Phe Glu Leu Lys Pro Gln
530 535 540
Glu Gln Leu Pro
545
<210>3
<211>1644
<212>DNA
<213> Artificial Synthesis
<400>3
atgaatgatg atccgacgtg gtacaaagat gccattatct atgaagtggg cgtgcgttgc 60
tttttcgata gcaacaacga tggtagcggt gacattccgg gtctgacggc taaactggat 120
tatatcgaat ctttaggtgt gacagccatt tggctgttac cgttttatgc tagtccactg 180
aaagatggcg gctatgacat atcagattat cgtagcttac atccggattt tggtacgatc 240
gaagatttta aagtgtttct ggatgaagca catcgtcgcg gcattcgcgt tatcaccgaa 300
ttagtgctga atcatacgag cgatcagcat cagtggtttc gcgaagcccg ctctaatccg 360
aatagtccat atcgtgatta ttatgtgtgg agcgatacgg atgataaata caaagatgca 420
cgcatcatct ttacggatac ggaacgctct aattggacct gggatcagga agcgggcaaa 480
tattattggc atcgcttctt cagtcatcag ccggacttga attatgataa tcctaaagtt 540
cagcaggaaa ttctggatat tgtgggctat tggttagata tgggcgttga tggtctgcgc 600
ttagatgcag ttccttatct gtatgaacgc gaaggtacaa attgcgaaaa cctcccagaa 660
acacatgaat ttctgaaaaa actgcgcaaa tttgttgatg ataattggcc taatcggatg 720
ctgttagcag aagccaatca gtggccagaa gatgttgttg cctattttgg taatggcgat 780
gaatgtcaca tggcctatca ttttcctatc atgccacgca tgtatatggc cctgcgccgc 840
gaagatcgtc atccaatcac ggaaatctta cgccgcaccc ctccgatccc agaaacatgt 900
cagtgggccc tgtttctgcg caatcatgat gaactgacct tagaaatggt gacggatgaa 960
gaacgcgatt atatgtatca tgaatatgcc aaagatcctc gaatgcgcct gaacttgggc 1020
attcgtcgcc gcttagctcc gttactggat aatagcgaac gtcgcattca gttaatgcac 1080
ctgctgctgt ttaccttacc gggtacacca atcatctatt atggcgatga aatcggcatg 1140
ggggacaatg tgtacctggg cgatcgtgat ggcgtgcgca ccccaatgca gtggagcggg 1200
gatcgtaatg cgggcttttc tcgcgctaat ccacaggccc tgtatcttcc tcctattcgt 1260
gatccggtgt tcacctatga agccgttaat gtggaagccc aggaacaggt tccgacctca 1320
ctgttaaatt ggatgaaacg taccattcag attagaaaga aatatccggt gtttggtcgc 1380
ggctcaattc gctttttaca gccaagtaat cgtgcagttc tggcctatat tcgccagtat 1440
caggatacaa ccatcctgtg cgcttgcaat ctgagtcgct tttgtcaggc agcagaactg 1500
gatctgagcg attttaaagg tctgtatccg gttgaactgt atggcaaaac cgtgtttcca 1560
cagatcggcg aactgccgta tctgctgacc tttggtccac atgtgtttta ttggtttgaa 1620
ttaaaaccac aggaacagct gcct 1644
<210>4
<211>548
<212>PRT
<213> Artificial Synthesis
<400>4
Met Asn Asp Asp Pro Thr Trp Tyr Lys Asp Ala Ile Ile Tyr Glu Val
1 5 10 15
Gly Val Arg Cys Phe Phe Asp Ser Asn Asn Asp Gly Ser Gly Asp Ile
20 25 30
Pro Gly Leu Thr Ala Lys Leu Asp Tyr Ile Glu Ser Leu Gly Val Thr
35 40 45
Ala Ile Trp Leu Leu Pro Phe Tyr Ala Ser Pro Leu Lys Asp Gly Gly
50 55 60
Tyr Asp Ile Ser Asp Tyr Arg Ser Leu His Pro Asp Phe Gly Thr Ile
65 70 75 80
Glu Asp Phe Lys Val Phe Leu Asp Glu Ala His Arg Arg Gly Ile Arg
85 90 95
Val Ile Thr Glu Leu Val Leu Asn His Thr Ser Asp Gln His Gln Trp
100 105 110
Phe Arg Glu Ala Arg Ser Asn Pro Asn Ser Pro Tyr Arg Asp Tyr Tyr
115 120 125
Val Trp Ser Asp Thr Asp Asp Lys Tyr Lys Asp Ala Arg Ile Ile Phe
130 135 140
Thr Asp Thr Glu Arg Ser Asn Trp Thr Trp Asp Gln Glu Ala Gly Lys
145 150 155 160
Tyr Tyr Trp His Arg Phe Phe Ser His Gln Pro Asp Leu Asn Tyr Asp
165 170 175
Asn Pro Lys Val Gln Gln Glu Ile Leu Asp Ile Val Gly Tyr Trp Leu
180 185 190
Asp Met Gly Val Asp Gly Leu Arg Leu Asp Ala Val Pro Tyr Leu Tyr
195 200 205
Glu Arg Glu Gly Thr Asn Cys Glu Asn Leu Pro Glu Thr His Glu Phe
210 215 220
Leu Lys Lys Leu Arg Lys Phe Val Asp Asp Asn Trp Pro Asn Arg Met
225 230 235 240
Leu Leu Ala Glu Ala Asn Gln Trp Pro Glu Asp Val Val Ala Tyr Phe
245 250 255
Gly Asn Gly Asp Glu Cys His Met Ala Tyr His Phe Pro Ile Met Pro
260 265 270
Arg Met Tyr Met Ala Leu Arg Arg Glu Asp Arg His Pro Ile Thr Glu
275 280 285
Ile Leu Arg Arg Thr Pro Pro Ile Pro Glu Thr Cys Gln Trp Ala Leu
290 295 300
Phe Leu Arg Asn His Asp Glu Leu Thr Leu Glu Met Val Thr Asp Glu
305 310 315 320
Glu Arg Asp Tyr Met Tyr His Glu Tyr Ala Lys Asp Pro Arg Met Arg
325 330 335
Leu Asn Leu Gly Ile Arg Arg Arg Leu Ala Pro Leu Leu Asp Asn Ser
340 345 350
Glu Arg Arg Ile Gln Leu Met His Leu Leu Leu Phe Thr Leu Pro Gly
355 360 365
Thr Pro Ile Ile Tyr Tyr Gly Asp Glu Ile Gly Met Gly Asp Asn Val
370 375 380
Tyr Leu Gly Asp Arg Asp Gly Val Arg Thr Pro Met Gln Trp Ser Gly
385 390 395 400
Asp Arg Asn Ala Gly Phe Ser Arg Ala Asn Pro Gln Ala Leu Tyr Leu
405 410 415
Pro Pro Ile Arg Asp Pro Val Phe Thr Tyr Glu Ala Val Asn Val Glu
420 425 430
Ala Gln Glu Gln Val Pro Thr Ser Leu Leu Asn Trp Met Lys Arg Thr
435 440 445
Ile Gln Ile Arg Lys Lys Tyr Pro Val Phe Gly Arg Gly Ser Ile Arg
450 455 460
Phe Leu Gln Pro Ser Asn Arg Ala Val Leu Ala Tyr Ile Arg Gln Tyr
465 470 475 480
Gln Asp Thr Thr Ile Leu Cys Ala Cys Asn Leu Ser Arg Phe Cys Gln
485 490 495
Ala Ala Glu Leu Asp Leu Ser Asp Phe Lys Gly Leu Tyr Pro Val Glu
500 505 510
Leu Tyr Gly Lys Thr Val Phe Pro Gln Ile Gly Glu Leu Pro Tyr Leu
515 520 525
Leu Thr Phe Gly Pro His Val Phe Tyr Trp Phe Glu Leu Lys Pro Gln
530 535 540
Glu Gln Leu Pro
545
Claims (11)
1. The amino acid sequence of the high-temperature resistant trehalose synthase modified by fragment mutation is shown as SEQ ID NO. 2.
2. The expression gene of the high-temperature resistant trehalose synthase modified by segment mutation according to claim 1, wherein the nucleotide sequence is shown as SEQ ID NO. 1.
3. The amino acid sequence of the high-temperature resistant trehalose synthase modified by point mutation is shown as SEQ ID No. 4.
4. The expression gene of the high temperature resistant trehalose synthase modified by the point mutation as claimed in claim 3, wherein the nucleotide sequence is shown as SEQ ID NO. 3.
5. A recombinant plasmid containing the expression gene of the high-temperature-resistant trehalose synthase of claim 2 or claim 4.
6. The recombinant plasmid of claim 5, wherein the vector plasmid of the recombinant plasmid is pET-21 b.
7. A transgenic cell line transformed with the recombinant plasmid of claim 6.
8. The transgenic cell line of claim 7, wherein the host cell of the transgenic cell line is Escherichia coli BL21DE (3).
9. Use of the expression gene of the thermostable trehalose synthase of claim 2 or claim 4 for the preparation of a thermostable trehalose synthase.
10. Use of the recombinant plasmid according to claim 5 or the transgenic cell line according to claim 7 for the preparation of a thermostable trehalose synthase.
11. Use of a high temperature resistant trehalose synthase according to claim 1 or claim 3 in the preparation of trehalose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710661311.6A CN107384888B (en) | 2017-08-04 | 2017-08-04 | Mutation-modified high-temperature-resistant trehalose synthase and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710661311.6A CN107384888B (en) | 2017-08-04 | 2017-08-04 | Mutation-modified high-temperature-resistant trehalose synthase and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107384888A CN107384888A (en) | 2017-11-24 |
| CN107384888B true CN107384888B (en) | 2020-06-30 |
Family
ID=60344642
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710661311.6A Active CN107384888B (en) | 2017-08-04 | 2017-08-04 | Mutation-modified high-temperature-resistant trehalose synthase and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107384888B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6133034A (en) * | 1992-05-27 | 2000-10-17 | Calgene, Inc. | Methods and compositions related to the production of trehalose |
| CN105524936A (en) * | 2016-02-02 | 2016-04-27 | 齐鲁工业大学 | Mutant trehalose synthase as well as expression gene and application thereof |
| CN106434586A (en) * | 2016-10-08 | 2017-02-22 | 南京工业大学 | Trehalose synthase mutant and gene thereof |
-
2017
- 2017-08-04 CN CN201710661311.6A patent/CN107384888B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6133034A (en) * | 1992-05-27 | 2000-10-17 | Calgene, Inc. | Methods and compositions related to the production of trehalose |
| CN105524936A (en) * | 2016-02-02 | 2016-04-27 | 齐鲁工业大学 | Mutant trehalose synthase as well as expression gene and application thereof |
| CN106434586A (en) * | 2016-10-08 | 2017-02-22 | 南京工业大学 | Trehalose synthase mutant and gene thereof |
Non-Patent Citations (1)
| Title |
|---|
| maltose alpha-D-glucosyltransferase[Chloroflexi bacterium 54-19];Kantor;《NCBI：NCBI：ACCESSION OJV89591》;20161209;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107384888A (en) | 2017-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109022387B (en) | Mutant Pfu DNA polymerase and preparation method and application thereof | |
| CN111979163B (en) | Recombinant Roche bacterium, preparation method and application thereof | |
| CN113817707B (en) | Mutant recombinant reverse transcriptase and preparation method and application thereof | |
| CN113308453B (en) | Amidohydrolase SaAH, and coding gene and application thereof | |
| CN109402092B (en) | Chitinase derived from marine environment and gene thereof | |
| CN108753744B (en) | Sesquiterpene cyclase, preparation and application thereof, and 2Z, 4E-alpha-ionyl ethane synthesis method | |
| CN112899253B (en) | Polypeptide with DNA polymerase activity, recombinant vector, preparation method and application thereof | |
| CN109609524A (en) | Protein and the application of a kind of lactobacillus plantarum nitrite reductase gene and its coding | |
| CN110423787B (en) | Preparation method of uniform brown algae trisaccharide | |
| CN107384888B (en) | Mutation-modified high-temperature-resistant trehalose synthase and application thereof | |
| CN110257361A (en) | A kind of algin catenase and its gene and application | |
| CN114645033B (en) | Nucleoside triphosphate hydrolase and purification method and application thereof | |
| CN113621589B (en) | Aldolone reductase KmAKR mutant, engineering bacteria and application thereof | |
| CN112175980A (en) | Method for improving activity of polymerase large fragment by site-directed mutagenesis and application | |
| CN112940088B (en) | Amino acid sequence for improving protein order in DosH protein and related mutation site and recombinant protein | |
| CN113122525B (en) | Formaldehyde conversion protein and application thereof | |
| CN106434586A (en) | Trehalose synthase mutant and gene thereof | |
| CN113637650A (en) | Alanine dehydrogenase SaAD and coding gene and application thereof | |
| CN109022471B (en) | Escherichia coli expression system for producing oxalate oxidase, and production method and application of oxalate oxidase | |
| US20110020896A1 (en) | Mutant dna polymerases and their genes | |
| CN113564141B (en) | Single-cell genome amplification enzyme mutant and application thereof | |
| CN114517193B (en) | Gamma-polyglutamic acid degrading enzyme and preparation method thereof | |
| RU2787531C1 (en) | RECOMBINANT pET32A-TNF-Thy PLASMIDE PROVIDING THE SYNTHESIS OF THE FUSION PROTEIN Α-TUMOR NECROSIS FACTOR - THYMOSIN ALPHA 1, BACTERIAL STRAIN ESCHERICHIA COLI BL21(DE3)/pET32a-THF-Thy - PRODUCER OF THE HYBRID PROTEIN TNF-THY AND TNF-THY Thy | |
| CN113621585B (en) | Taq DNA polymerase and endonuclease chimera, and preparation method and application thereof | |
| CN114381442B (en) | High-fidelity DNA polymerase capable of being rapidly extended and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220225 Address after: No.13, 3rd floor, building 1, No.1, Tidu street, Qingyang District, Chengdu, Sichuan 610031 Patentee after: Chengdu yishenrui Technology Co.,Ltd. Address before: 250353 University Road, Changqing District, Ji'nan, Shandong Province, No. 3501 Patentee before: Qilu University of Technology Effective date of registration: 20220225 Address after: 710065 Room 501, unit 1, building 1, Yanxiang City Plaza, No. 56, Jinye 1st Road, high tech Zone, Xi'an, Shaanxi Province Patentee after: Shaanxi Yonglei Biotechnology Co.,Ltd. Address before: No.13, 3rd floor, building 1, No.1, Tidu street, Qingyang District, Chengdu, Sichuan 610031 Patentee before: Chengdu yishenrui Technology Co.,Ltd. |
|
| TR01 | Transfer of patent right |