CN107375317A - The 3p of miR 149 and its intend like thing prepare prevent and treat obesity, atherosclerosis, high fat of blood medicine in application - Google Patents
The 3p of miR 149 and its intend like thing prepare prevent and treat obesity, atherosclerosis, high fat of blood medicine in application Download PDFInfo
- Publication number
- CN107375317A CN107375317A CN201710513616.2A CN201710513616A CN107375317A CN 107375317 A CN107375317 A CN 107375317A CN 201710513616 A CN201710513616 A CN 201710513616A CN 107375317 A CN107375317 A CN 107375317A
- Authority
- CN
- China
- Prior art keywords
- mir
- thing
- application
- atherosclerosis
- high fat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention belongs to biomedicine field, it is related to microRNA purposes, the particularly 3p of miR 149 and its intends application like thing in the medicine for preventing and treating obesity, atherosclerosis, high fat of blood and its complication is prepared.Ejection preparation, oral formulations, spray agent, ointment formulation or patch etc. can be made according to the conventional method of medicine preparation in said medicine.
Description
Technical field
The invention belongs to biomedicine field, is related to microRNA purposes, particularly miR-149-3p and its plan are like thing
Application in the medicine for preparing preventing and treating obesity, atherosclerosis, high fat of blood and its complication.
Background technology
With the development of the social economy, the fat hot issue for turning into World Focusing, it has also become global pandemic disease.
Cri dernier cri disease learns investigation display, and up to more than 1/3rd crowds are overweight or fat in the U.S., and United States Medicine will be considered that fertilizer
Fat is a kind of disease.In China, with the improvement of living standards, living-pattern preservation, the quantity of obese patient also drastically on
Rise, overweight and fat incidence is up to 29%.The U.S. is used for fat and relevant disease medical expense and is up to 117,000,000,000 every year
Dollar, obesity brings heavy social burden and financial burden.
Worldwide, the disease that atherosclerotic cardiovascular disease is global incidence and the death rate ranks first
Disease.《Chinese cardiovascular disease report 2012》Statistics shows：The existing people of cardiovascular patient 2.9 hundred million in China, its Myocardial stalk
Dead patient at least 2,500,000, the annual new hair people of myocardial infarction patient 500,000, just has 1 people to die from angiocardiopathy in about every 10 seconds.It is coronal
Atherosclerotic heart disease, have become a kind of important diseases for influenceing human health.Coronary atherosclerosis occurs
Mechanism is complicated, it is now recognized that various factors such as inflammation, oxidative stress, anhormonia, fibrinolytic and clotting mechanism exception etc. cause blood
Endothelial tube is impaired, endothelial dysfunction, then leukocyte, infiltration, foam wanshing, smooth muscle cell migration, finally
It result in the formation of Lipid Plaque.
An important factor for atherosclerosis is an inflammatory disease, and hypercholesterolemia is disease development.Artery
Atherosis early stage, LDL intrusion arterial walls, accumulate in subendothelial, then oxidized modification.OxLDL stimulating endothelial cells adhere to
Molecule (ICAM-1, VCAM-1) is expressed, and chemotactic factor (CF) (CCL2) secretion, increases leucocyte (monocyte, lymphocyte, neutrality
Granulocyte) migrate to inner membrance.Cholesterol its important effect in many diseases, such as the morning in atherogenesis
The various metabolic diseases such as phase, diabetes.Therefore, regulation and control cholesterol metabolic can prevent the relevant disease of lipid-metabolism.In order to
It is horizontal to monitor steroidal, cell feedback system fading margin SREBP transcription.In low-level cholesterol profiles, SREBP is transported to
Golgiosome, nucleus, the transcription of activation target gene (HMGCR, LDLR) are entered after activation.In high-caliber cholesterol profiles,
Suppress target gene transcription.Although eukaryotic absorbs cholesterol by being endogenously synthesized with lipoprotein, cholesterol can not degrade, must
It must discharge and be transported to liver, be re-used or excreted, the process is reverse cholesterol transport.Cellular cholesterol stream
Go out by ABCA1 and ABCG1 regulations, the cholesterol flowed out through ABCA1 is combined with the APOA1 of low esterification, and ABCG1 relates generally to maturation
HDL esterification.ABCA1 also adjusts HDL biosynthesis.In mouse and primate, miR-33a/b adjust just ABCA1 and
ABCG1 3 ' UTR areas, miR-33 suppress cellular cholesterol and flow out to ApoA1 and HDL, and it is horizontal to reduce HDL-C in circulation.Gene
MiR-33 mouse are knocked out, plasm HDL-C levels rise, reduce the athero- progress of artery.ABCA1 has 3 ' very long UTR sequences, institute
To there is many miRNA to adjust its expression, such as miR-26, miR-10b, miR106b, miR-758 etc..
MicroRNAs is small point of the endogenous non-coding single stranded RNA of a kind of evolution conservative for being about 22 nucleotides or so
Son.From Lee in 1993 etc. find first be referred to as lin-4 miRNA since, biosynthesis of the researcher to miRNA, function
And mechanism of action has carried out substantial amounts of research.MicroRNAs participates in the processes such as cell differentiation, propagation, apoptosis.MicroRNAs exists
Important effect is respectively provided with angiogenesis and angiocardiopathy.These miRNAs nucleotide sequences and the 3 ' of target gene mRNA
UTR sequence is complementary to be combined, and suppresses expression of target gene, so as to regulate and control various biological functions.
Although a series of medicines can be used for treating, no matter fat and angiocardiopathy the incidence of disease and cost are in flourishing state
Family still all continues to increase in developing country, and current treatment mainly slows down the progress of disease.In order to develop new prevention
And curative drug, we develop microRNA-149-3p and its intend preparing preventing and treating obesity, atherosclerosis, height like thing
Application in blood fat and its medicine of complication.
The content of the invention
Purposes of the present invention on microRNA, particularly miR-149-3p and its plan are fat, dynamic in preparation preventing and treating like thing
Application in the medicine of pulse atherosclerosis, high fat of blood and its complication.Described miR-149-3p nucleotide sequence such as SEQ
Shown in ID NO.1：>hsa-miR-149-3p MIMAT0004609AGGGAGGGACGGGGGCUGUGC.
It is right on the basis of miR-149-3p nucleotide sequence that the miR-149-3p plans are classified as like the nucleotides sequence of thing
Ribose modification that other nucleotides in addition to GGGAGGG bases are carried out, base modification and one kind in phosphate backbones modification or
Several combinations or the increase and decrease of nucleotides are replaced.Lived as long as the nucleotide sequence after modification still has with miR-149-3p identicals
Property should just belong within invention which is intended to be protected.
Preferably, the miR-149-3p intends being classified as the base in miR-149-3p nucleotide sequence like the nucleotides sequence of thing
The modification that methylates has been carried out on plinth to base, and 5 ' ends have been marked using cholesterol.
Described complication includes hypertension, myocardial hypertrophy, heart failure, high cholesterol, fatty liver, diabetes, nephrosis synthesis
Sign, apnea syndrome etc..Present invention additionally comprises miR-149-3p as obesity, atherosclerosis, high fat of blood, coronary heart disease
Diagnosis detection blood serum designated object.Described miR-149-3p nucleotide sequence is as obesity, atherosclerosis, coronary disease
The risk index of disease, high fat of blood and its complication.Described miR-149-3p nucleotide sequence is as fat, artery congee
Sample hardening, coronary heart disease, the prognostic indicator of high fat of blood and its complication.
Present invention also offers one kind prevention and treatment obesity, atherosclerosis, high fat of blood, coronary heart disease, hypertension and
The pharmaceutical composition of complication, the composition include miR-149-3p or miR-149-3p plan like thing and pharmaceutically
The carrier of receiving.Ejection preparation, oral formulations, spraying system can be made according to the conventional method of medicine preparation in above-mentioned composition
Agent, ointment formulation or patch etc..
Brief description of the drawings
Fig. 1 sonde methods detection intracellular miR-149 is horizontal；
Fig. 2 Dual-Luciferase report analyses miR-149-3p suppresses GSK3a expression；
Fig. 3 atherosclerosis diet miR-149-/- mice plasma TG, TC, LDL-C, HDL-C change.
Embodiment
The invention will now be further described with reference to specific embodiments, advantages of the present invention and feature will be with description and
It is apparent.But embodiment is exemplary, does not form any restrictions to the scope of the present invention.Those skilled in the art should
Understand, the details and form of technical solution of the present invention can be modified without departing from the spirit and scope of the invention
Or replace, but these modifications and replacement are each fallen within protection scope of the present invention.
Embodiment 1
MiR-149 detection methods：
HepG2 cells add 10% hyclone culture in DMEM, are inoculated in 6 orifice plates, density 4 × 105/ hole, is placed in 37 DEG C, and 5%
CO2Incubator.After 16-20h, cell density reaches 80%.Transfection miR-149-3p (has purchased from the sharp rich biotechnology in Guangzhou
Limit company, hsa-miR-149-3p, MIMAT0004609, AGGGAGGGACGGGGGCUGUGC) or miR-control, transfection agents
Amount and method are as shown in the table, and 24h extracts total microRNA after transfection.
Extract total microRNA (mirVana miRNAIsolation Kit Prcotcol (ambion) method cells
Cracking:
(1) 10 are collected2-107Cell or 0.5-25mg tissues, cold PBS washings.
A. suspension cell：Count, 102-107Cell low-speed centrifugal, abandons supernatant, is resuspended in 1mL PBS, centrifugation, places
On ice；B. attached cell：Culture medium is abandoned, PBS washings, is placed on ice.Pancreatin digests, and counts, and inactivates pancreatin, centrifugation, abandons
Supernatant, 1mL PBS are resuspended in, low-speed centrifugal precipitation, are placed on ice.
(2) lysate sample
A. PBS is abandoned, adds 300-600 μ L Lysis/Binding Solution.Negligible amounts cell is such as separated, with 300 μ L；Number
The relatively multi-purpose 600uL of amount.Attached cell, directly cracked in culture dish, lysate is collected with scraper, be transferred to EP pipes.B. be vortexed or
Strength is blown and beaten, and complete cell lysis, obtains homogeneous lysate.
(3) Organic extraction：
Add the HomogenateAdditive of 1/10 times of miRNA volume, be incubated 10 minutes on ice.Plus 1/10 times of miRNA volume A.
Homogenate Additive, be vortexed or reversion for several times, fully mix；B. it is incubated 10 minutes on ice.
Acid phenol's chloroform:A. plus the phenol chloroform (must be extracted from bottom) of lysate volume is waited；B. be vortexed 30-
60 seconds；C. room temperature 10000g is centrifuged 5 minutes, is such as layered not notable, repetition.Collect aqueous phase to manage in new EP, record volume.
Total microRNA separation：
(1) add the ethanol of 1.25 volume 100%, be sufficiently mixed (300 μ l add 375 μ l ethanol)；
(2) Filter Cartridge cross Lysate/ethanol mixtures (A. assembling pillars；B. maximum is taken to be no more than 700 μ
L mixed liquors are in worry post；C.10000g centrifuge 15 seconds；D. liquid is abandoned, reuses collecting pipe)；
(3) add 700 μ LWash Solution 1 (adding ethanol), centrifuge the 5-10 seconds, abandon liquid, reuse collecting pipe；
(4) add 500 μ LWash Solution 2/3 (adding ethanol), centrifuge the 5-10 seconds, abandon liquid.It is repeated 1 times.Sky was from 1 minute.100
95 DEG C of deionized water elutions of μ L.
RT-PCR reacts (applied biosystems TagMan Small RNA Assays)
It is prepared by Mix:U6/miR-149 reverse primers melt on ice
Reverse transcription primer and template
Reverse transcription reaction
A. 5*RT primers and template are melted on ice；RT primers before use, be vortexed, slightly from；
B.7 μ L Mix mix 0.2mL centrifuge tubes with 5 μ L templates, centrifugation；
C. plus 3 μ L reverse primers, the mouth of pipe is closed, is mixed, centrifugation；
D. on ice 5 minutes, until PCR reacts.
Parameter values to program the thermal cycler
Inversion product deposits -80 DEG C.
qPCR
The molten lucifuge of probe ice
QPCR response parameters are set
Horizontal sonde method detection intracellular miR-149 result is as shown in figure 1, as seen from Figure 1, with transfection miR-
The increase of 149 dosage, the horizontal increases of intracellular miR-149, illustrate that sonde method is used successfully to miR-149 detections.
Embodiment 2
Dual-Luciferase report analysis
Cell transfecting：HepG2 cells add 10% hyclone culture in DMEM, and repopulating cell adjusts cell density in 24 orifice plates
For 0.8 × 105/ hole, 37 DEG C are placed in, 5%CO2Incubator.After 16-20h, cell density reaches 80%.Take 2.5 μ l miR-149
(20 μM) or miR-control (20 μM) and 0.3 μ g Dual-Luciferase expression plasmids are diluted in 50 μ l opti-MEM culture mediums
In.Lipofectamine20001.5 μ l are taken in 50 μ l opti-MEM.The liposome diluted is mixed with plasmid, room temperature is incubated
Educate 30 minutes.Complete medium in plate is changed into opti-MEM nutrient solutions 400 μ l, then the μ l/ holes of mixed liquor 100 in 24 holes
Plate, gently shake mixing.37 DEG C, 5%CO2After incubator culture 6h, it is replaced by complete medium and continues to cultivate.
PmirGLO Dual-Luciferase report analysis steps
(1) culture medium in culture dish is abandoned, is washed with precooling PBS, thoroughly removes PBS；
(2) 1*PLB lysates are added according to following table
(3) it is placed in shaking table jog 15 minutes, is transferred to 96 orifice plates；
(4) 96 hole blanks are placed in ELIASA reading, survey background value；
(5) blank is taken out, 20 μ L cell pyrolysis liquids are added per hole, then 100 μ l LAR II (lucifuge) are added with the volley of rifle fire, piping and druming is twice
Mix；
(6) rapid ELIASA reading；
(7) plank is taken out, per the μ l STOP＆GLO Reagent (lucifuge) of Kong Zaijia 100, is blown and beaten twice, rapid reading；
(8) analyze data.
Dual-Luciferase report analysis miR-149-3p suppresses GSK3a expressions of results as shown in Fig. 2 as seen from Figure 2,
MiR-149-3p does not suppress pmirGLO vector expressions, only suppresses pmirGLO-GSK3a expression.
Embodiment 3
Influences of the miR-149-3p to mouse lipid metaboli
6-8 week old males miR-149-3p-/- mouse and identical genetic background wild mouse (can use this area conventional method structure
Build), raise in SPF barrier systems, free water, atherosclerosis diet (increase income animal feed Co., Ltd,
D12109c).Mouse is put to death after raising 20 weeks, detects indices.The μ l of 1% yellow Jackets 150 are injected intraperitoneally, are used after anesthesia
The capillary that sterilizes is instilled in sterile EP pipes from inserting needle on the inside of mouse orbit, blood, and take a blood sample about 300 μ l.37 DEG C of incubation 1h, then
8000rpm centrifuges 10min, and the serum after separation, detection TC, TG, HDL-C and LDL-C are horizontal, and (the limited public affairs of science and technology are built up in Nanjing
Department).TG, TC, LDL-C, HDL-C result of variations are as shown in figure 3, from figure 3, it can be seen that miR-149-3p-/-In mice plasma
The horizontal significantly rise of TG, TC, LDL-C, and the horizontal declines of HDL-C, this explanation miR-149-3p suppress disorders of lipid metabolism.
SEQUENCE LISTING
<110>He'nan University
<120>MiR-149-3p and its intend like thing prepare preventing and treating obesity, atherosclerosis, high fat of blood medicine in answer
With
<130> 1
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> RNA
<213>Artificial sequence
<400> 1
agggagggac gggggcugug c 21
Claims (7)
1.miR-149-3p and its medicine for intending preventing and treating obesity, atherosclerosis, high fat of blood and its complication in preparation like thing
In application.
2. application as claimed in claim 1, it is characterised in that：Described complication is hypertension, myocardial hypertrophy, heart failure, height
Any of cholesterol, fatty liver, diabetes, nephrotic syndrome, apnea syndrome are several.
3. application as claimed in claim 1, it is characterised in that：The miR-149-3p intends being classified as like the nucleotides sequence of thing
On the basis of miR-149-3p nucleotide sequence in addition to GGGAGGG bases other nucleotides carry out base modification,
Ribose modification, phosphate backbones modification or the increase and decrease of nucleotides are replaced.
4. application as claimed in claim 2, it is characterised in that：The miR-149-3p intends being classified as like the nucleotides sequence of thing
The modification that methylates has been carried out on the basis of miR-149-3p nucleotide sequence to base, and 5 ' ends have been carried out using cholesterol
Mark.
5. a kind of pharmaceutical composition for being used to prevent and treat obesity, atherosclerosis, high fat of blood and its complication, it is characterised in that contain
Have the right the miR-149-3p described in requirement 3 and/or its intend the carrier that like thing and pharmaceutically receives.
6. the pharmaceutical composition as described in claim 5, it is characterised in that described carrier is virus, cholesterol, nanometer
Grain, chitosan or liposome etc..
7. the pharmaceutical composition as described in claim any one of 5-6, it is characterised in that by described pharmaceutical composition according to medicine
Ejection preparation, oral formulations, spray agent, ointment formulation or patch is made in the conventional method of preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710513616.2A CN107375317B (en) | 2017-06-28 | 2017-06-28 | Application of miR-149-3p and mimic thereof in preparation of medicines for preventing and treating obesity, atherosclerosis and hyperlipidemia |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710513616.2A CN107375317B (en) | 2017-06-28 | 2017-06-28 | Application of miR-149-3p and mimic thereof in preparation of medicines for preventing and treating obesity, atherosclerosis and hyperlipidemia |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107375317A true CN107375317A (en) | 2017-11-24 |
| CN107375317B CN107375317B (en) | 2020-09-04 |
Family
ID=60333959
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710513616.2A Active CN107375317B (en) | 2017-06-28 | 2017-06-28 | Application of miR-149-3p and mimic thereof in preparation of medicines for preventing and treating obesity, atherosclerosis and hyperlipidemia |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107375317B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119385A (en) * | 2016-08-11 | 2016-11-16 | 河南大学 | MiRNA molecule mark hsa miR 149 3p of a kind of diagnosed type 2 diabetic and application thereof |
-
2017
- 2017-06-28 CN CN201710513616.2A patent/CN107375317B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119385A (en) * | 2016-08-11 | 2016-11-16 | 河南大学 | MiRNA molecule mark hsa miR 149 3p of a kind of diagnosed type 2 diabetic and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| HANYING DING ET AL.: "Fasting induces a subcutaneous-to-visceral fat switch mediated by microRNA-149-3p and suppression of PRDM16", 《NATURE COMMUNICATIONS》 * |
| 丁寒莹: "miRNA调节皮下脂肪功能及芒果苷元治疗胰岛素抵抗的机制研究", 《中国博士学位论文全文数据库 医药卫生科技辑》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107375317B (en) | 2020-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2886652B1 (en) | Extraction, preparation, and application of plant micro-ribonucleic acid | |
| US20190153446A1 (en) | Mir-149-3p and method for treating metabolic disease using the same | |
| CN110075124A (en) | AMSC-MALAT1-Exo is used to prepare application in the drug for the treatment of liver diseases and preparation method thereof | |
| CN106701922A (en) | Application of micro RNA in preventing or treating femoral head necrosis caused by glucocorticoid | |
| CN114028453A (en) | Broad-spectrum antiviral drug, and pharmaceutical composition and application thereof | |
| Nian et al. | Gut microbiota metabolite TMAO promoted lipid deposition and fibrosis process via KRT17 in fatty liver cells in vitro | |
| Cai et al. | Tetrahedral framework nucleic acids based small interfering RNA targeting receptor for advanced glycation end products for diabetic complications treatment | |
| Tang et al. | Significance of MR/OPN/HMGB1 axis in NAFLD-associated hepatic fibrogenesis | |
| CN109701023A (en) | It treats coronal young weak pulse embolism and causes myocardial damage drug and animal model constructing method | |
| CN108610409B (en) | Application of ETV5 in preparation of medicine for preventing or treating obesity and related metabolic diseases | |
| CN107375317A (en) | The 3p of miR 149 and its intend like thing prepare prevent and treat obesity, atherosclerosis, high fat of blood medicine in application | |
| CN106880638A (en) | Inhibitor, inhibitor combination and the application of the hyper-proliferative of keratinocyte can be suppressed | |
| Li et al. | Exosome-derived miR-5p-72106_14 in vascular endothelial cells regulates fate determination of BMSCs | |
| US20220313793A1 (en) | Application of flavin-containing monooxygenase 2 (fmo2) in preparing drug for treatment of non-alcoholic fatty liver disease (nafld) | |
| Zhang et al. | New advances on the inhibition of Siwei Xiaoliuyin combined with Temozolomide in glioma based on the regulatory mechanism of miRNA21/221 | |
| Pan et al. | LncRNA TSIX knockdown restores spinal cord injury repair through miR-30a/SOCS3 axis | |
| CN109224076A (en) | Gene miR-140-3P and its mimics relevant to lung cancer diagnosis and treatment and application | |
| CN107496390A (en) | Application of the protosappanin A derivative in caused by chemotherapeutic medicines heart injury is protected | |
| CN118766941A (en) | Application of lometapi and composition thereof in preparing medicines for treating hepatic fibrosis | |
| CN116814630A (en) | Small RNA of Tze Huang for preventing and/or treating nonalcoholic fatty liver, small RNA composition, preparation method and application | |
| WO2020248771A1 (en) | Preparation method for diabetes early warning and/or diagnostic reagent kit based on hsa-mir-320a, medicament for preventing diabetes, screening method for medicament, and preparation method therefor | |
| CN107841503A (en) | MiR 199a 5p analogies, mortifier and its recombinant expression carrier and application | |
| CN117224528A (en) | Application of stone-like chlorophyllin in preparation of fatty liver prevention and treatment medicine | |
| CN110042157A (en) | Application of the miR-380-3p in the product of preparation diagnosis, prevention and/or treatment nonalcoholic fatty liver | |
| Zheng et al. | Analysis of the mechanism of liquiritigenin in promoting cardiomyocyte regeneration based on miRNA-34b-TIA-1-SG molecular network-mediated autophagy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |