CN107365728B

CN107365728B - Plant endophyte for degrading PAEs and application of plant endophyte in repairing PAEs contaminated soil

Info

Publication number: CN107365728B
Application number: CN201710736090.4A
Authority: CN
Inventors: 莫测辉; 冯乃宪; 喻娇; 李彦文; 赵海明; 向垒; 蔡全英; 李慧; 吴冰霄
Original assignee: Jinan University
Current assignee: Jinan University
Priority date: 2017-08-24
Filing date: 2017-08-24
Publication date: 2020-04-14
Anticipated expiration: 2037-08-24
Also published as: CN107365728A

Abstract

The invention discloses a plant endophyte for degrading PAEs and application thereof in repairing PAEs contaminated soil. The strain is Bacillus megaterium (Bacillus megaterium) YJB3, is preserved in China center for type culture Collection of Wuhan university in Wuhan City in 2017 at 28 th month 06, and has the preservation number: CCTCC NO: m2017389. The YJB3 bacterial liquid is used for colonizing endophytes in plant rhizosphere or in vivo through rhizosphere soil inoculation, spray treatment or seed bacterium soaking, or directly added into PAEs polluted soil, so that the soil phthalate pollution remediation efficiency can be improved. The method is simple, safe and economical to operate, does not introduce secondary pollution to the soil environment, can avoid the pollution risk of agricultural products, and has important significance for efficiently utilizing regional low-concentration polluted soil to produce safe agricultural products and realizing 'production and repair at the same time'.

Description

Plant endophyte for degrading PAEs and application of plant endophyte in repairing PAEs contaminated soil

Technical Field

The invention belongs to the field of organic contaminated soil remediation, and particularly relates to an application method of a plant endophyte for degrading Phthalic Acid Esters (PAEs) and capable of remedying PAEs contaminated soil singly or in combination with plants.

Background

Agricultural products such as pesticides, chemical fertilizers, agricultural films and the like are unreasonably used, and activities such as industrial three-waste discharge and the like continuously release a large amount of PAEs organic pollutants, so that the farmland soil pollution is increasingly serious. PAEs in the polluted soil are absorbed and accumulated by crops, and the quality safety of agricultural products is seriously threatened. PAEs are a class of environmental hormone pollutants with endocrine disruption, reproductive development toxicity, hepatotoxicity and "triple-effect" effects. Ingestion of agricultural products containing PAEs on a daily diet results in long-term low dose exposure, severely compromising human health. The soil remediation is the most direct mode for eliminating PAEs pollution of farmland soil, and compared with the traditional soil remediation technologies such as soil dressing method, chemical leaching, gas stripping, heat treatment and other physical and chemical methods, the bioremediation has the characteristics of low cost, safety, effectiveness, environmental friendliness and the like. The bioremediation method mainly comprises microbial remediation, plant remediation, microbial-plant combined remediation and the like. The functional microorganisms capable of efficiently degrading organic pollutants such as PAEs can be obtained from various environments outside the plant body or can be separated from the plant body, and the research on the latter is few, but the functional microorganisms have many advantages compared with the former in application, for example, functional plant endophytes can degrade the organic pollutants such as PAEs in polluted soil independently or together with plants, and can also assist host plants in reducing the accumulation and toxic effect caused by the organic pollutants such as PAEs in the body and promote the growth of the host plants. This is because the endophytes enter the plant body through the stomata of the plant leaves, the bark holes of the stems, the root wounds and other ways, and then colonize the tissue inside each organ of the plant and the intercellular spaces. Good mutual-benefiting symbiosis relationship is established between endophytes and plant hosts, and the endophytes form an important component in a plant micro-ecosystem and occupy special ecological niches.

It is worth noting that the endophyte can be inoculated in the rhizosphere or in vivo of crops, so as to reduce the pollution of organic pollutants such as PAEs in rhizosphere soil, reduce the accumulation of PAEs of crops, effectively avoid the pollution risk of PAEs of crops, enable the content of pollutants in the crops, especially edible parts, to be lower than the food sanitation safety limit standard, and further ensure the quality safety of agricultural products. However, as far as we know, no patent or literature reports that the endophyte is applied independently or combined with plants to repair PAEs polluted soil and reduce the absorption and accumulation of PAEs by crops so as to produce safe agricultural products by efficiently utilizing the polluted soil and realize 'production and repair' at the same time.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide a plant endophyte for degrading PAEs.

The invention also aims to provide application of the plant endophyte for degrading PAEs.

The invention provides a plant endophyte with a function of efficiently degrading PAEs, and the application of the plant endophyte for repairing PAEs polluted soil, promoting the degradation of PAEs in the soil and reducing the absorption and accumulation of PAEs by crops singly or in combination. The method is simple and safe to operate, low in cost and free of secondary pollution to the soil environment, crop biomass can be increased, PAEs polluted soil can be effectively repaired, absorption and accumulation of the PAEs by the crops are reduced, the crop pollution risk is avoided, and the quality safety of agricultural products is guaranteed.

The purpose of the invention is realized by the following technical scheme:

the invention provides a plant endophyte for degrading PAEs, a strain is named as Bacillus megaterium YJB3, and the strain is separated and screened from a plant body through gradient domestication and enrichment.

The plant endophyte for degrading PAEs is Bacillus megaterium (Bacillus megaterium) YJB3, and the preservation information is as follows: the preservation unit: china Center for Type Culture Collection (CCTCC), preservation date: 28/06/2017, deposit address: wuhan university, the preservation number: CCTCC NO: m2017389.

The separation and screening of the endophyte comprises the following steps:

(1) plant material surface disinfection step: cleaning collected fresh plant material sample with sterile water, cutting into small segments with length of 1cm with sterile scissors, sterilizing the surface in a super clean bench according to the following procedures, and sterilizing with 1% -3% H₂O₂Rinsing for 1-4 min, rinsing for 2-4 times with sterile water, rinsing for 2-5 min with 70% (v/v) alcohol, rinsing for 2-4 times with sterile water, rinsing for 2-5 min with 3-5% NaClO solution, and rinsing for 2-4 times with sterile water;

(2) and (3) testing the disinfection effect of the surface of the plant material: respectively taking 100 mu L of sterile water for washing the plant material for the last time and plant samples with disinfected surfaces, culturing the plant samples on an LB solid flat plate at 30 ℃ for 24h, and then, no microorganism grows out, which indicates that the surface of the plant material is thoroughly sterilized and the separation and screening of endophytes can be carried out;

(3) enrichment and domestication of endophytes of plants: placing plant materials with thoroughly disinfected surfaces into a sterile mortar, adding 0.1-2 g of sterile quartz sand and 5-10 mL of sterile phosphate buffer solution (PBS, pH 7.0-7.5), grinding and crushing to homogenate, taking 1-5 mL of supernatant, inoculating the supernatant into 100-150 mL of inorganic salt liquid culture medium containing PAEs as a unique carbon source, culturing in a shaking table at the rotating speed of 120-150 rpm at 30 ℃ for 5-7 days as a period, and gradually increasing the initial concentration of the PAEs from 50mg/L to 1000 mg/L;

(4) separating and screening plant endophytes: after acclimatization is finished, the culture solution is diluted to 10 degrees in gradient^-5～10^-7Coating the strain on an inorganic salt solid medium plate containing 500-1000 mg/L of PAEs, culturing at constant temperature of 30 ℃, and after bacteria grow on the plate, purifying a target strain by a marking method, wherein the strain YJB3 can use the PAEs as a unique carbon source and grow vigorously to serve as the target strain, namely: bacillus megaterium (Bacillus megaterium) YJB 3.

The plant material surface disinfection step in the step (2) can also be as follows: cleaning a collected fresh plant material sample with sterile water, cutting a small section with the length of 1cm by using sterile scissors, completely immersing the plant material in a triangular flask with a plug or a beaker with a cover filled with 150-200 mL of sterile water, and carrying out ultrasonic disinfection for 20min at the working frequency of 20KHz and the power of 150W.

The inorganic salt culture medium (g.L)^-1)：K₂HPO₄5.8，KH₂PO₄4.5，(NH4)₂SO₄2.0，MgCl₂0.16，CaCl₂0.02，Na₂MoO₄·2H₂O 0.0024，KNO₃0.0012，FeCl₃0.0018，MnCl₂·2H₂O 0.0015，pH7.0。

The 16S rDNA nucleotide sequence of the bacillus megaterium (B.megaterium) YJB3 is shown as SEQ ID NO: 1 is shown.

The bacillus megaterium (B.megaterium) YJB3 has the morphological and physiological and biochemical characteristics as follows: the bacterial colony is smooth and light yellow, the edge is neat, the thallus is easy to pick up, gram-positive bacteria and long rod-shaped, the width is 1.5-2.0 mu m, and the length is 5.2-7.8 mu m; aerobic, positive in catalase reaction, positive in sugar fermentation, positive in starch hydrolysis test, positive in methyl red test, positive in urease test, citrate test and H₂The S experiment is negative, the Voges-Proskauer experiment is negative, the indole experiment is negative, and the gelatin hydrolysis experiment is negative.

The Phthalate (PAEs) is diethyl phthalate (DEP) or/and dimethyl phthalate (DMP) or/and dibutyl phthalate (DBP) and/or di-n-octyl phthalate (DnP) and/or di-2-ethylhexyl phthalate (DEHP) and/or Butyl Benzyl Phthalate (BBP).

The endophyte degrading PAEs is applied to the restoration of PAEs polluted soil by single or combined plants.

The preparation method of the bacillus megaterium (B.megaterium) YJB3 bacterial liquid comprises the following steps: inoculating the slant preserved B.megaterium YJB3 strain into 1000mL LB liquid medium, shake culturing at 30 deg.C and 120rpm for 7-9 h, centrifuging at 3000r/min to collect thallus, suspending in PBS solution, and diluting to 10%⁶～10⁹CFU/mL bacterial suspension and 0.5-1.5 g/L sodium acetate are supplemented as an initial carbon source.

The Bacillus megaterium (B.megaterium) YJB3 was inoculated at a concentration of 10⁶～10⁹And (3) directly adding the bacterial suspension of CFU/mL into a soil medium polluted by PAEs, and ventilating after uniformly stirring.

The Bacillus megaterium (B.megaterium) YJB3 was added at a concentration of 10⁶～10⁹The inoculation amount of the CFU/mL is 1-10 mL, and the CFU/mL is inoculated in plant rhizosphere soil or inoculated in a plant body to be combined with plants to repair PAEs polluted soil.

The method for inoculating the plant endophyte into the plant body can be as follows: taking full plant seeds, soaking the seeds in 5% sodium hypochlorite for sterilization for 15-20 min, washing the seeds with sterile deionized water for 2-3 times, and soaking the seeds in the sterile deionized waterHas a concentration of 10⁶～10⁹And (3) suspending the bacillus megaterium YJB3 in a suspension of CFU/mL for 30-180 min.

The method for inoculating the plant endophyte into the plant body can be as follows: spraying or smearing to give a concentration of 10⁶～10⁹And (3) inoculating the CFU/mL bacillus megaterium YJB3 bacterial suspension on plant leaf surfaces.

The method for inoculating the plant endophyte into the plant body can be as follows: immersing the root system of the plant seedling into the solution with the concentration of 10⁶～10⁹And (3) suspending the bacillus megaterium YJB3 in a suspension of CFU/mL for 30-90 min.

The plant can be sedum alfredii, alfalfa, ryegrass, black nightshade and the like used for soil phytoremediation or crops such as rice, corn, cabbage, tomatoes and the like. Seeds of the above plants are commercially available.

Compared with the prior art, the invention has the following advantages and effects:

the invention provides a strain of endophyte Bacillus megaterium YJB3 which can degrade PAEs and is separated and screened from a plant body through gradient domestication and enrichment. The endophyte B.megaterium YJB3 bacterial liquid is used for colonizing the plant rhizosphere or in vivo by means of rhizosphere soil inoculation, spray treatment or seed bacterium soaking, or directly added into PAEs polluted soil, so that the soil phthalate pollution remediation efficiency can be improved, and the PAEs absorbed and accumulated by crops can be reduced. The method is simple, safe and economical to operate, does not introduce secondary pollution to the soil environment, can avoid the pollution risk of agricultural products, and has important significance for efficiently utilizing regional low-concentration polluted soil to produce safe agricultural products and realizing 'production and repair at the same time'.

Drawings

Fig. 1 is a plot of bacillus megaterium (b.megaterium) YJB3 colony and cell morphology.

FIG. 2 shows rDNA PCR results of Bacillus megaterium (B.megaterium) YJB 316S.

Fig. 3 is a b.megaterium YJB3 phylogenetic tree.

FIG. 4 is the effect of Bacillus megaterium (B.megaterium) YJB3 on PAEs shedding behavior in the rhizosphere micro-domain of cabbage heart in an earth culture environment; wherein S0 denotes a root growth zone, S0-1 denotes a rhizosphere zone at a distance of 1mm from the root surface; s1-3 refers to the rhizosphere zone 1-3mm away from the root surface; s3-5 refers to the rhizosphere region 3-5mm from the root surface.

Fig. 5 is the effect of bacillus megaterium YJB3 on the absorption and accumulation of PAEs by cabbage heart in an earth culture environment.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

Example 1

Collecting plant samples from the artificial wetland, and immediately carrying out endophyte separation screening test. Conventional endophyte separation methods are adopted. Cleaning fresh plant material sample with sterile water, cutting into 1cm long segments with sterile scissors, sterilizing the surface in a super clean bench according to the following procedures, 3% H₂O₂Rinsing for 2.5min, rinsing with sterile water for 4 times, rinsing with 70% alcohol for 3 times, rinsing with sterile water for 3 times, rinsing with 3% NaClO solution for 5min, rinsing with sterile water for 3 times, respectively taking 100 μ L of sterile water for rinsing plant materials for the last time and plant samples subjected to surface sterilization, transferring into LB solid medium (10 g of peptone, 5g of yeast extract, 10g of NaCl, 1.8% agar powder, 1000mL of constant volume, pH7.0, and 121 ℃ sterilization) plates, culturing at 30 ℃ for 24h without microbial growth, thoroughly sterilizing the surface of the plant materials, placing the plant materials into a sterile mortar, adding 0.5g of sterile quartz sand and 10mL of sterile phosphate buffer (pH7.2), grinding and crushing to homogenate, taking 1mL of supernatant, inoculating into 100mL of inorganic salt liquid culture medium containing DBP as a unique carbon source, culturing at 30 ℃, 150rpm, keeping out of the sun, and culturing by a shaking table, taking a period every 5 days, and gradually increasing the initial concentration of DBP, domesticating from 50mg/L to 1000mg/L in a gradient way; after acclimatization is finished, the culture solution is diluted to 10 degrees in gradient^-5Spreading on DBP inorganic salt solid culture medium plate containing 500mg/L, culturing at constant temperature of 30 deg.C, after bacterial growth on the plate, purifying by scribing to obtain target strain YJB3, transferring to LB test tube inclined plane, and storing in refrigerator at 4 deg.C.

Example 2

Collecting plant samples from the artificial wetland, and immediately carrying out endophyte separation screening test. Cleaning a collected fresh plant material sample with sterile water, cutting a small section with the length of 1cm by using sterile scissors, completely immersing the plant material in a triangular flask with a plug or a beaker with a cover, which is filled with 150 mL-200 mL of sterile water, and carrying out ultrasonic disinfection for 25min, wherein the working frequency is 20KHz, and the power is 150W; placing the plant material into a sterile mortar, adding 2g of sterile quartz sand and 10mL of sterile phosphate buffer (pH7.2), grinding and crushing to homogenate, taking 0.5mL of supernatant, inoculating into 100mL of inorganic salt liquid culture medium containing DBP as a unique carbon source, carrying out shake culture at 30 ℃, 150rpm and in a dark place, gradually increasing the initial concentration of DBP by taking a period every 7 days, and carrying out gradient acclimation from 100mg/L to 800 mg/L; after acclimatization is finished, the culture solution is diluted to 10 degrees in gradient^-6Spreading on a DBP inorganic salt solid culture medium plate containing 1000mg/L, culturing at constant temperature of 30 deg.C, after bacterial growth on the plate, purifying by marking to obtain target strain YJB3, transferring to LB test tube inclined plane, and storing in refrigerator at 4 deg.C.

Example 3

(1) Identifying morphological characteristics of strains: the strain YJB3 is inoculated in an LB solid culture medium in a streak manner, a flat plate inversion constant temperature incubator is used for carrying out constant temperature culture at 30 ℃ for 12-18 h, the colony morphology is observed, the colony is smooth and light yellow, the edge is neat, and the colony is easy to pick up; gram staining is carried out on the strain, gram positive bacteria are observed by using a scanning electron microscope, the strain is a long rod bacterium, the width is 1.5-2.0 micrometers, and the length is 5.2-7.8 micrometers, and the figure is 1.

(2) Physiological and biochemical test related to strain

Respectively carrying out methyl red experiment, urease experiment, catalase experiment, sugar fermentation experiment, starch hydrolysis experiment, citrate experiment and H on the culture of the strain YJB3₂S experiment, Voges-Proskauer experiment, indole experiment, gelatin hydrolysis experiment and other related physiological and biochemical experiments, and the detailed results are shown in Table 1.

TABLE 1 results of physiological and biochemical tests related to the strains

Physiological and biochemical experiment	Results
		Methyl Red test	+
Aerobic growth	+
		Catalytic reaction	+
Sugar fermentation experiments	+
		Starch hydrolysis test	+
Urease test	+
		Citrate test	-
H₂S experiment	-
		Voges-Proskauer experiment	-
Indole experiments	-
		Gelatin hydrolysis test	-

(3) Strain 16S rDNA analysis

Extracting strain genome DNA by using a bacterial genome DNA extraction kit, amplifying a 16S rDNA fragment of a strain by using bacterial 16S rDNA universal primers (27F, 1492R) as a template, sending the amplified fragment to Shanghai biological engineering for sequencing, and finding a specific band at about 1100bp of a product by 1% agarose gel electrophoresis, wherein the result is shown in figure 2, and the sequence is shown as SEQ ID NO: 1 is shown. The obtained 16S rDNA sequence of the bacterium is subjected to Blast (www.ncbi.nlm.nih.gov/Blast) homology comparison with an NCBI database, the similarity of the obtained 16S rDNA sequence and the 16S rDNA sequence of the known bacterium Bacillus megaterium in the database reaches 99 percent, and the constructed phylogenetic tree is shown in figure 3, and the strain is identified as the bacterium Bacillus megaterium by combining morphological and physiological and biochemical characteristics. The strain is named as bacillus megaterium (B.megaterium) YJB 3.

The preservation information of the Bacillus megaterium (Bacillus megaterium) YJB 3: the preservation unit: china Center for Type Culture Collection (CCTCC), preservation date: 28/06/2017, deposit address: wuhan university, the preservation number: CCTCC NO: m2017389.

Example 4

The concentration of DBP in the soil was set to 100 mg/kg^–1Adding DBP acetone solution into partial soil (about 5kg), uniformly stirring to obtain contaminated mother soil, mixing with the rest soil, uniformly stirring, loading into a root box after the acetone solvent is volatilized, slowly dripping tap water, keeping the water holding capacity of the field at 60%, shading and aging for 14 d. Inoculating slant preserved B.megaterium YJB3 strain into 100mL LB liquid medium, shake culturing at 30 deg.C and 120rpm for 7h, centrifuging at 3000rpm for 3min, collecting thallus, washing with PBS for 2-3 times, resuspending to obtain thallus suspension, adjusting thallus concentration to 10⁸CFU/mL, and supplemented with 0.5g/L sodium acetate as the starting carbon source. After the growth condition of the seedlings of the cabbage heart is stable and new leaves grow out, inoculating the bacterial suspension to the root of the cabbage heart by a root irrigation method according to the inoculation amount of 10 mL. The result shows that the DBP reduction rate in the rhizosphere soil of the cabbage green plant (LB) is averagely improved by 54.2% (fig. 4), the DBP content of the aerial parts was reduced by 45.2%, the DBP content of the roots was reduced by 40.6% (fig. 5), the DBP reduction rate in the rhizosphere soil of flowering cabbage (HG) was improved by 50.6% on average (fig. 4), the DBP content of the aerial parts was reduced by 43.6%, and the DBP content of the roots was reduced by 32.7% (fig. 5).

Example 5

The DEHP concentration in the soil was set at 100 mg/kg^–1In the soil control without DEHP addition. Adding DEHP acetone solution into partial soil (about 5kg), stirring to obtain contaminated mother soil, mixing with the rest soil, stirring, loading into root box after acetone solvent is volatilized, slowly dripping into tap water, keeping field water holding capacity 60%, shading, and aging for 14 d. Inoculating the slant preserved B.megaterium YJB3 strain into 100mL LB liquid medium, shake culturing at 30 deg.C and 120rpm for 7h, centrifuging at 3000rpm for 3min, collecting thallus, washing with PBS for 2-3 times, resuspending to obtain thallus suspension, adjusting thallus concentration to 10⁷CFU/mL, and supplemented with 1.0g/L sodium acetate as the starting carbon source. After the tomato seedlings grow stably and new leaves grow out, spraying with 10mL inoculation amount, and inoculating on the overground part of the tomato. Compared with the treatment without inoculation, the inoculation strain B.megateriumYJB3 improves the DEHP reduction rate in tomato rhizosphere soil by 24.1 percent on average.

Example 6

The DEP concentration in the soil was set to 100 mg/kg^–1To a soil control without addition of DEP. Adding DEP acetone solution into partial soil (about 5kg), stirring to obtain contaminated mother soil, mixing with the rest soil, stirring, loading into root box after acetone solvent is volatilized, slowly dripping into tap water, keeping field water holding capacity 60%, shading, and aging for 14 days. Inoculating the slant preserved B.megaterium YJB3 strain into 100mL LB liquid medium, shake culturing at 30 deg.C and 120rpm for 8h, centrifuging at 3000rpm for 3min, collecting thallus, washing with PBS for 2-3 times, resuspending to obtain thallus suspension, adjusting thallus concentration to 10⁸CFU/mL, and supplemented with 1.5g/L sodium acetate as the starting carbon source. Taking plump plant seeds, soaking and sterilizing with 5% sodium hypochlorite for 20min, washing with sterile deionized water for 3 times, and soaking in the solution containing the above componentsAt a concentration of 10⁸CFU/mL endophyte culture solution for 180 min. The seedlings are cultivated in a greenhouse for 55 days, and compared with the non-inoculated strain treatment, the inoculated strain B.megateriumYJB3 improves the DEP reduction rate in the rhizosphere soil of ryegrass by 50.4 percent on average.

Example 7

The concentration of DMP in the soil was set to 100 mg/kg^–1Taking the soil without adding DMP as a reference, taking part of the soil (about 5kg) to add DMP acetone solution, uniformly stirring the mixture to obtain polluted mother soil, then mixing the polluted mother soil with the rest of the soil, uniformly stirring the polluted mother soil, putting the polluted mother soil into a root box after the acetone solvent is volatilized, slowly dripping and adding tap water, keeping the water capacity of the field to be 60 percent, and shading and aging the polluted mother soil for 14 days. Inoculating the slant preserved B.megaterium YJB3 strain into 100mL LB liquid medium, shake culturing at 30 deg.C and 120rpm for 8h, centrifuging at 3000rpm for 3min, collecting thallus, washing with PBS for 2-3 times, resuspending to obtain thallus suspension, adjusting thallus concentration to 10⁶CFU/mL, and supplemented with 0.8g/L sodium acetate as the starting carbon source. And (3) immersing the root system of the rice seedling into the bacterial liquid suspension for 60min, then transplanting the rice seedling into DMP polluted soil, and cultivating the rice seedling in a greenhouse for 50d, wherein compared with the condition that the rice seedling is not inoculated with bacteria, the degradation rate of DMP in the rhizosphere soil is averagely improved by 43.3% by inoculating a strain B.

Example 8

The concentration of DBP in the soil was set to 100 mg/kg^–1Taking soil without DBP as a reference, taking part of the soil (about 5kg) to add DBP acetone solution, uniformly stirring the mixture to obtain polluted mother soil, then mixing the polluted mother soil with the rest of the soil, uniformly stirring, slowly dripping and adding tap water after the acetone solvent is volatilized, keeping the water capacity of the field to be 60%, shading and aging for 14 d. Inoculating slant preserved B.megaterium YJB3 strain into 100mL LB liquid medium, shake culturing at 30 deg.C and 120rpm for 8 hr, centrifuging at 3000rpm for 3min, collecting thallus, washing with PBS for 3 times, resuspending to obtain thallus suspension, adjusting thallus concentration to 10⁸CFU/mL, and supplementing 0.8g/L of sodium acetate as an initial carbon source, directly stirring the bacterial suspension into soil, uniformly stirring and aerating. The degradation rate of DBP in soil is 35.2%, and the degradation rate of DBP in soil without added bacteria is only 11.3%. The strain B.megaterium YJB3 is directly added into the soil, so that DBP pollution in the soil can be effectively removedAnd (6) dyeing.

Example 9

The concentration of DnOP in the soil was set to 100 mg/kg^–1Taking the soil without adding DnOP as a reference, taking part of the soil (about 5kg) to add a DnOP acetone solution, uniformly stirring the mixture to obtain polluted mother soil, then mixing the polluted mother soil with the rest of the soil, uniformly stirring the polluted mother soil, putting the polluted mother soil into a root box after the acetone solvent is volatilized, slowly dripping and adding tap water, keeping the water capacity of the field to be 60 percent, and shading and aging the polluted mother soil for 14 days. Inoculating slant preserved B.megaterium YJB3 strain into 100mL LB liquid medium, shake culturing at 30 deg.C and 120rpm for 8h, centrifuging at 3000rpm for 3min, collecting thallus, washing with PBS for 2-3 times, resuspending to obtain thallus suspension, adjusting thallus concentration to 10⁸CFU/mL, and supplemented with 0.8g/L sodium acetate as the starting carbon source. The bacterial suspension is directly inoculated into ryegrass rhizosphere soil with 3-4 true leaves, the ryegrass rhizosphere soil is cultivated in a greenhouse for 55 days, and compared with the ryegrass rhizosphere soil which is not inoculated with bacteria, the degradation rate of DnOP in the plant rhizosphere soil is improved by 23.5% by inoculating a strain B.

Example 10

The BBP concentration in the soil is set to be 100 mg/kg^–1In a soil control without added BBP. Adding BBP acetone solution into partial soil (about 5kg), stirring to obtain contaminated mother soil, mixing with the rest soil, stirring, loading into root box after acetone solvent is volatilized, slowly dripping into tap water, keeping field water holding capacity 60%, shading, and aging for 14 days. Inoculating the slant preserved B.megaterium YJB3 strain into 100mL LB liquid medium, shake culturing at 30 deg.C and 120rpm for 7h, centrifuging at 3000rpm for 3min, collecting thallus, washing with PBS for 2-3 times, resuspending to obtain thallus suspension, adjusting thallus concentration to 10⁹CFU/mL, and supplemented with 1.0g/L sodium acetate as the starting carbon source. After the corn seedlings are stable in growth condition and 3-4 leaves grow out, spraying treatment is adopted according to the inoculation amount of 10mL, and the corn seedlings are inoculated on the leaves. The strain B.megaterium YJB3 improves the reduction rate of DEHP in the rhizosphere soil of corn by 14.1% on average compared with the non-strain treatment after being cultivated in a greenhouse for 45 days.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> river-south university

<120> plant endophyte for degrading PAEs and application of plant endophyte in repairing PAEs contaminated soil

<130>1

<160>1

<170>PatentIn version 3.5

<210>1

<211>1096

<212>DNA

<213>Artificial Sequence

<220>

<223> 16S rDNA nucleotide sequence of Bacillus megaterium (B.megaterium) YJB3

<400>1

gggcatgtgc gcggcgtgct atacatgcca agtcgagcga tactgataga agcttgcaac 60

tatgacgtta gcggcggacg ggtgagtaac acgtccgcaa cgctgcctgt aagactggga 120

taacttcggg ataccgaagc taataccgga taggatcttc tccttcatgg gagatgattg 180

aaagatggaa tcggctatca cttacagatc gcgccgcggt gcattagcta gttggtgagg 240

ttacggctca cctaggcaac gatgcatagc cgacctgaga gggtgatcgg cgacactggg 300

actgagacac ggcccagact cctacgggag gcagcagtag ggaatcttcc gcaatggacg 360

aaagtctgac ggagcaacgc cgcgtgagtg atgaaggctt tcgcgtcgta taactctgtt 420

gttagggaag aacaagtacg agagtaactg cttgtacctt gacggtacct aaccagaaag 480

ccacggctaa ctacgtgcca gcagccgcgg taatacgtaggtggcaagcg ttatccggaa 540

ttattgggcg taaagcgcgc gcaggcggtt tcataagtct gatgtgaaag cgcacggctc 600

aaccgtggag ggtcaatgga aactggggaa cttgagtgct gaagagaaaa gcggaattcc 660

acgtgtagcg gtgaattgcg tagagatgtg gaggaacacc agtggcgaag gcggctttta 720

ggtctgtaac tgacgctgag gcgcgtaagc gtggggagca aacacgatta gataccctgg 780

tagtccacgc cgttaacgat gagtgctaag tgttagaggg tttccgccct atagtgctgc 840

agctaacgca ttaagcactc cgcctgggga gtacggtcgc aagactgaaa ctcaaaggaa 900

ttgacggggg ccggcacaag cggtggagca tgtggattaa ttcgaagcaa cgcgaagaac 960

cataccaggt cttgacatcc tctgacactc tagagataga gcgttcggct tcgggggaca 1020

gagtgacagg tggtgcatgg ttgtcgtcag ctcgtgtcgt ggagatgaag ggttaagtcc 1080

cgctacgagc cccgaa 1096

Claims

1. A plant endophyte for degrading PAEs is characterized in that: is named as bacillus megaterium (Bacillus megaterium) YJB3, and is preserved in China center for type culture Collection of Wuhan university in Wuhan City in 2017 at 28.06 months, with the preservation number: CCTCC NO: m2017389.

2. The use of the plant endophyte of claim 1 for phytoremediation of PAEs contaminated soil, alone or in combination.

3. Use according to claim 2, characterized in that:

the PAEs are diethyl phthalate or/and dimethyl phthalate or/and dibutyl phthalate and/or di-n-octyl phthalate and/or di-2-ethylhexyl phthalate and/or butyl benzyl phthalate.

4. Use according to claim 2, characterized in that:

the method of claim 1The inoculation concentration of the bacillus megaterium YJB3 is 10⁶～10⁹And (3) directly adding the bacterial suspension of CFU/mL into a soil medium polluted by PAEs, and ventilating after uniformly stirring.

5. Use according to claim 2, characterized in that:

the Bacillus megaterium YJB3 of claim 1 at a concentration of 10⁶～10⁹The inoculation amount of CFU/mL is 1-10 mL, and the CFU/mL is inoculated in plant rhizosphere soil or inoculated in a plant body to repair PAEs pollution in combination with plants.

6. Use according to claim 5, characterized in that:

the method for inoculating in the plant body comprises the following steps: taking full plant seeds, soaking the seeds in 5% sodium hypochlorite for sterilization for 15-20 min, washing the seeds with sterile deionized water for 2-3 times, and soaking the seeds with the concentration of 10⁶～10⁹And (3) suspending the bacillus megaterium YJB3 in a suspension of CFU/mL for 30-180 min.

7. Use according to claim 5, characterized in that:

the method for inoculating in the plant body comprises the following steps: spraying or smearing to give a concentration of 10⁶～10⁹And (3) inoculating the CFU/mL bacillus megaterium YJB3 bacterial suspension on plant leaf surfaces.

8. Use according to claim 5, characterized in that:

the method for inoculating in the plant body comprises the following steps: immersing the root system of the plant seedling into the solution with the concentration of 10⁶～10⁹And (3) suspending the bacillus megaterium YJB3 in a suspension of CFU/mL for 30-90 min.

9. Use according to any one of claims 2 or 5 to 8, wherein:

the plants in the combined phytoremediation are Sedum alfredii Hance, alfalfa, ryegrass, black nightshade, rice, corn, cabbage heart and tomato.