CN107354225A - A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions - Google Patents
A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions Download PDFInfo
- Publication number
- CN107354225A CN107354225A CN201710788318.4A CN201710788318A CN107354225A CN 107354225 A CN107354225 A CN 107354225A CN 201710788318 A CN201710788318 A CN 201710788318A CN 107354225 A CN107354225 A CN 107354225A
- Authority
- CN
- China
- Prior art keywords
- ros1
- group
- internal standard
- detection probe
- seconds
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions, including a forward primer group, a reverse primer group, a detection probe group, an internal standard forward primer, an internal standard reverse primer and an internal standard detection probe；5 ' ends of the detection probe in detection probe group are modified with the first fluorescent reporter group, and 3 ' ends are modified with the first fluorescent quenching group；Internal standard detection probe 5 ' it is terminal modified have second fluorescent reporter group different from the first fluorescent reporter group, 3 ' ends are modified with the second fluorescent quenching group.The present invention is using mankind ROS1 Gene Fusions as detection object, optimum organization and fluorescence probe by special primer, so as to realize it is accurate, simply and rapidly while detect ROS1 Gene Fusions, and the ability of detection fusion is up to 1%.
Description
Technical field
The invention belongs to biological technical field, and in particular to a kind of multi-fluorescence for being used to detect mankind's ROS1 Gene Fusions
PCR detection kit.
Background technology
ROS1 (c-ros oncogene 1 receptor tyrosine kinase, c-ros, the tyrosine of proto-oncogene 1
Kinases), in tumor patient, the primary mechanism of the rearrangement formula ROS1 activation of chromosome, and the ROS1 of proto-oncogene form is seen
It is that activation forms related downstream signaling pathway material to malignant tumour to do, and ROS1 genes may take part in the mistake of lung cancer generation
Journey.Crizotinib treats the preliminary efficacy of ROS1 positive NSCLC patients, result of study prompting：It is similar to the ALK-EML4 positives,
ROS1 rearrangements are another potential target spots of Crizotinib treatments.ROS1 fusions patient is carried to ALK inhibitor
Crizotinib is extremely sensitive, and remission rate is up to 57.1%.
ROS1 is a kind of receptor tyrosine kinase in gene code Insulin Receptor Family, the kinases and cell growth,
Propagation etc. is closely related., can sustained activation ROS1 tyrosine after ROS1 genes merge with genes such as SLC34A2, CD74
The signal path such as kinases area and downstream JAK/STAT, PI3K/AKT, RAS/MAPK, and then cause the generation of tumour.ROS1 kinases
Inhibitor, in ROS1 kinases area, has blocked the signal transduction pathway in ROS1 downstreams, so as to reach treatment effect by competitive binding
Fruit.Product ROS1 Gene Fusions suitable for qualitative detection paraffin-embedded tissue sample rna.The patented product is only used for non-small
Cell lung cancer ROS1 Gene Fusions are detected, and therapeutic scheme is set or change finally needs clinical attending doctor to combine clinical medical history, disease
Shape and other diagnostic result comprehensive descisions.
The content of the invention
It is an object of the invention to provide a kind of multiple fluorescence PCR detection reagent for being used to detect mankind's ROS1 Gene Fusions
Box.
Technical scheme is as follows：
A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions, including a forward primer group,
One reverse primer group, a detection probe group, an internal standard forward primer, an internal standard reverse primer and an internal standard detection probe；Detection
5 ' ends of the detection probe in probe groups are modified with the first fluorescent reporter group, and 3 ' ends are modified with the first fluorescent quenching base
Group；Internal standard detection probe 5 ' it is terminal modified have second fluorescent reporter group different from the first fluorescent reporter group, 3 ' ends are repaiied
It is decorated with the second fluorescent quenching group；Wherein
Forward primer group is made up of ROS1-32-F and ROS1-34/35-F, is included successively such as the institutes of SEQ ID NO 01 and 02
The sequence shown；
Reverse primer group by ROS1-32-R, ROS1-34/35-R, ROS1-35-R1, ROS1-35-R2, ROS1-32-R1,
ROS1-34-R1、ROS1-1139-R、ROS1-1202-R、ROS1-1265-R、ROS1-1200-R、ROS1-1278-R、ROS1-
1259-R, ROS1-1196-R, ROS1-1267-R, ROS1-1269-R and ROS1-1273-R are formed, and include such as SEQ ID successively
Sequence shown in NO 03 to 18；
Detection probe group is made up of ROS1-35-P, ROS1-34-P and ROS1-32-P, includes such as SEQ ID NO 19 respectively
To the sequence shown in 21；
The composition of each reaction system of the multiple fluorescence PCR detection reagent box is as follows：
An at least forward primer in forward primer group
An at least reverse primer in reverse primer group
A detection probe in detection probe group
Internal standard forward primer
Internal standard reverse primer
Internal standard detection probe
1 × PCR buffer solutions
MgCl2
dNTPs
Taq enzyme
Template
H2O；
The reaction condition of each reaction system of the multiple fluorescence PCR detection reagent box is：95 DEG C of pre-degenerations 5 minutes, 1
Individual circulation；95 DEG C are denatured 25 seconds, and 64 DEG C are annealed 20 seconds, and 72 DEG C extend 15 seconds, 15 circulations；95 DEG C are denatured 25 seconds, 60 DEG C of annealing
35 seconds, 72 DEG C extended 10 seconds, 30 circulations；Fluorescence signal is detected when 30 circulate in annealing afterwards.
In a preferred embodiment of the invention, the internal standard forward primer is β actin-F, including such as SEQ ID
Sequence shown in NO 22；The internal standard reverse primer is β actin-R, including the sequence as shown in SEQ ID NO 23；It is described
Internal standard detection probe is β actin-P, including the sequence as shown in SEQ ID NO 24.
In a preferred embodiment of the invention, first fluorescent reporter group is FAM, and first fluorescence is sudden
The group that goes out is BHQ1, and second fluorescent reporter group is HEX, ROX or VIC, and the second fluorescent quenching group is BHQ1.
Above-mentioned primer and probe particular sequence is as shown in the table：
| Primer and probe | Sequence (5-3) |
| ROS1-32-F | GGGTTGAGCTACAGAAGTGGA |
| ROS1-32-R | GACTTCCATGTGCAAACACTAC |
| ROS1-34/35-F | CACATGGAAGTCCAAAAACCT |
| ROS1-34/35-R | ATGTATTGCATAGCAGGCATTA |
| ROS1-35-R1 | ATTAGCCAGGCCTACTCCG |
| ROS1-35-R2 | TATGTATTGCATAGCAGGCAT |
| ROS1-32-R1 | CCACTGTATTGAATTTTTAC |
| ROS1-34-R1 | CCCTTCCTTGGCACTTT |
| ROS1-1139-R | GGGAAATCAAAGTATTACAA |
| ROS1-1202-R | TTAGAGCAAAAGCCCACTGA |
| ROS1-1265-R | GGCTCTGGAGATCTGGTTG |
| ROS1-1200-R | ACGCTCCACCGAAACAT |
| ROS1-1278-R | ACGGAGGTCCTGGCAGAT |
| ROS1-1259-R | TAGCAGAGAGGCTCAGGT |
| ROS1-1196-R | CTTCCAGCTGGTTGGATCT |
| ROS1-1267-R | GACAAAGAAGGCAGAGAGA |
| ROS1-1269-R | CCACAACATGACAGTAGTGC |
| ROS1-1273-R | ACAATTGATGACCTGGAAGA |
| ROS1-35-P | FAM-CTCGCAGCTCAGCCAACTCTTT-BHQ1 |
| ROS1-34-P | FAM-CCAGACAAAGGTCAGTGGGG-BHQ1 |
| ROS1-32-P | FAM-CCAAATAAACCAGGCATTCCAA-BHQ1 |
| βactin-F | GACTACCTCATGAAGATCCTCA |
| βactin-R | TCTCCTTAATGTCACGCACGATT |
| βactin-P | HEX-CGGCTACAGCTTCACCACCAC-BHQ1 |
Beneficial effects of the present invention：The present invention passes through the excellent of special primer using mankind ROS1 Gene Fusions as detection object
Change combination and fluorescence probe, so as to realize it is accurate, simply and rapidly while detect ROS1 Gene Fusions, and detection fusion
Ability be up to 1%.
Brief description of the drawings
Fig. 1 is that the negative sample detection curve map of ROS1 Gene Fusions is detected in the embodiment of the present invention 1.
Fig. 2 is that the positive sample detection curve map of ROS1 Gene Fusions is detected in the embodiment of the present invention 1.
Embodiment
Technical scheme is further detailed and described below by way of embodiment combination accompanying drawing.
A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions, including a forward primer group,
One reverse primer group, a detection probe group, an internal standard forward primer, an internal standard reverse primer and an internal standard detection probe；Detection
5 ' ends of the detection probe in probe groups are modified with the first fluorescent reporter group, and 3 ' ends are modified with the first fluorescent quenching base
Group；Internal standard detection probe 5 ' it is terminal modified have second fluorescent reporter group different from the first fluorescent reporter group, 3 ' ends are repaiied
The second fluorescent quenching group is decorated with, first fluorescent reporter group is FAM, and the first fluorescent quenching group is BHQ1, institute
It is HEX, ROX or VIC to state the second fluorescent reporter group, and the second fluorescent quenching group is BHQ1；Wherein
Forward primer group is made up of ROS1-32-F and ROS1-34/35-F, is included successively such as the institutes of SEQ ID NO 01 and 02
The sequence shown；
Reverse primer group by ROS1-32-R, ROS1-34/35-R, ROS1-35-R1, ROS1-35-R2, ROS1-32-R1,
ROS1-34-R1、ROS1-1139-R、ROS1-1202-R、ROS1-1265-R、ROS1-1200-R、ROS1-1278-R、ROS1-
1259-R, ROS1-1196-R, ROS1-1267-R, ROS1-1269-R and ROS1-1273-R are formed, and include such as SEQ ID successively
Sequence shown in NO 03 to 18；
Detection probe group is made up of ROS1-35-P, ROS1-34-P and ROS1-32-P, includes such as SEQ ID NO 19 respectively
To the sequence shown in 21；
Internal standard forward primer is β actin-F, including the sequence as shown in SEQ ID NO 22；
Internal standard reverse primer is β actin-R, including the sequence as shown in SEQ ID NO 23；
Internal standard detection probe is β actin-P, including the sequence as shown in SEQ ID NO 24.
The composition of each reaction system of the multiple fluorescence PCR detection reagent box is as follows：
An at least forward primer in forward primer group
An at least reverse primer in reverse primer group
A detection probe in detection probe group
Internal standard forward primer
Internal standard reverse primer
Internal standard detection probe
1 × PCR buffer solutions
MgCl2
dNTPs
Taq enzyme
Template
H2O；
The reaction condition of each reaction system of the multiple fluorescence PCR detection reagent box is：95 DEG C of pre-degenerations 5 minutes, 1
Individual circulation；95 DEG C are denatured 25 seconds, and 64 DEG C are annealed 20 seconds, and 72 DEG C extend 15 seconds, 15 circulations；95 DEG C are denatured 25 seconds, 60 DEG C of annealing
35 seconds, 72 DEG C extended 10 seconds, 30 circulations；Fluorescence signal is detected when 30 circulate in annealing afterwards.
Above-mentioned primer and probe particular sequence is as shown in the table：
Embodiment 1
The present invention is visited using mankind ROS1 Gene Fusions as detection object by the optimum organization of special primer and fluorescence
Pin, so as to realize it is accurate, simply and rapidly while detect ROS1 Gene Fusions, and the ability of detection fusion is up to 1%.
Wild-type cell system H460 RNA reverse transcriptions cDNA is wild-type template, with ROS1 fusion SDC4-ROS1 matter
Grain is positive control template, establishes the reaction system of multiple fluorescence PCR detection ROS1 genes SDC4-ROS1 mutation.The method master
Comprise the following steps：
(1) the ROS1 genes and the wild type cDNA gene orders of SDC4 genes and fusion announced according to Cosmic data are prominent
Become gene order, design high specific primer and detection probe.It is to be detected that to sport 10 kinds of patients with lung cancer ROS1 genes common
Mutation, specifically mutually see the table below：
(2) preparation of multiple fluorescence PCR amplification reaction system and upper machine testing.
(3) fluorescence signal is detected, required cycle-index Ct values judge as a result during reaching the threshold value of setting
Standard.
The ROS1 genes and SDC4 wildtype gene sequence and fusion announced in step (1) according to Cosmic data are mutated
Gene order, design primer and detection probe, the table of particular sequence detailed in Example 1.
One of multiple fluorescence PCR amplification reaction system of step (2) is：
| Sequence number | Material | Material concentration | Dosage (μ L) |
| 1 | 1 × PCR buffer solutions | 1× | 10 |
| 2 | MgCl2 | 25mM | 10 |
| 3 | dNTPs | 10mM | 5 |
| 4 | ROS1-32-F | 50μM | 0.8 |
| 5 | ROS1-32-R | 50mM | 0.8 |
| 6 | ROS1-32-P | 50mM | 0.8 |
| 7 | βacfin-F | 50mM | 0.5 |
| 8 | βactin-R | 50mM | 0.5 |
| 9 | βactin-P-HEX(VIC) | 50mM | 0.5 |
| 10 | Taq enzyme | 5U | 0.5 |
| 11 | H2O | Purified water | 17.1 |
| 12 | DNA profiling | 2ng/ul | 5 |
| 13 | Cumulative volume | 50 |
Above reagent component：1 × PCR buffer solutions, MgCl2, Taq enzyme, dNTP is purchased from DaLian, China treasured biotech firm.
The reaction condition of the fluorescent PCR is 95 DEG C of pre-degenerations 5 minutes, 1 circulation；95 DEG C are denatured 25 seconds, 64 DEG C of annealing
20 seconds, 72 DEG C extended 15 seconds, 15 circulations；95 DEG C are denatured 25 seconds, and 60 DEG C are annealed 35 seconds, and 72 DEG C extend 10 seconds, 30 circulations；Afterwards
30 are detected FAM and HEX or ROX fluorescence signals when circulating in annealing.
Step (3) detects the Ct values of FAM and HEX fluorescence signals, is to use Mx3000P fluorescent PCRs amplification instrument or Mx3005P
Fluorescent PCR amplification instrument or the fluorescent PCR amplification instruments of ABI 7500., once can detect 96 parts of samples (including yin and yang attribute control).According to
The Ct value judged results that fluorescent PCR amplification instrument is shown：FAM the and HEX fluorescence intensities of reaction system are detected, are reached with HEX signals
Show loading amount of DNA in allowed band during given threshold (Ct ＞ 18), FAM signal results are credible；Reach the threshold of setting with FAM
The standard that required cycle-index Ct values judge as yin and yang attribute during value, Ct values are 0 or 30：It is negative；Ct is less than 30：It is positive.
The result of the negative sample of ROS1 Gene Fusions is detected as shown in figure 1, detecting the result of the positive sample of ROS1 Gene Fusions such as
Shown in Fig. 2.
The foregoing is only a preferred embodiment of the present invention, therefore can not limit the scope that the present invention is implemented according to this, i.e.,
The equivalent changes and modifications made according to the scope of the claims of the present invention and description, all should still it belong in the range of the present invention covers.
Sequence table
<110>Xiamen Fei Shuo Bioisystech Co., Ltd
<120>A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>People (Homo sapiens)
<400> 1
gggttgagct acagaagtgg a 21
<210> 2
<211> 21
<212> DNA
<213>People (Homo sapiens)
<400> 2
cacatggaag tccaaaaacc t 21
<210> 3
<211> 22
<212> DNA
<213>People (Homo sapiens)
<400> 3
gacttccatg tgcaaacact ac 22
<210> 4
<211> 22
<212> DNA
<213>People (Homo sapiens)
<400> 4
atgtattgca tagcaggcat ta 22
<210> 5
<211> 19
<212> DNA
<213>People (Homo sapiens)
<400> 5
attagccagg cctactccg 19
<210> 6
<211> 21
<212> DNA
<213>People (Homo sapiens)
<400> 6
tatgtattgc atagcaggca t 21
<210> 7
<211> 20
<212> DNA
<213>People (Homo sapiens)
<400> 7
ccactgtatt gaatttttac 20
<210> 8
<211> 17
<212> DNA
<213>People (Homo sapiens)
<400> 8
cccttccttg gcacttt 17
<210> 9
<211> 20
<212> DNA
<213>People (Homo sapiens)
<400> 9
gggaaatcaa agtattacaa 20
<210> 10
<211> 20
<212> DNA
<213>People (Homo sapiens)
<400> 10
ttagagcaaa agcccactga 20
<210> 11
<211> 19
<212> DNA
<213>People (Homo sapiens)
<400> 11
ggctctggag atctggttg 19
<210> 12
<211> 17
<212> DNA
<213>People (Homo sapiens)
<400> 12
acgctccacc gaaacat 17
<210> 13
<211> 18
<212> DNA
<213>People (Homo sapiens)
<400> 13
acggaggtcc tggcagat 18
<210> 14
<211> 18
<212> DNA
<213>People (Homo sapiens)
<400> 14
tagcagagag gctcaggt 18
<210> 15
<211> 19
<212> DNA
<213>People (Homo sapiens)
<400> 15
cttccagctg gttggatct 19
<210> 16
<211> 19
<212> DNA
<213>People (Homo sapiens)
<400> 16
gacaaagaag gcagagaga 19
<210> 17
<211> 20
<212> DNA
<213>People (Homo sapiens)
<400> 17
ccacaacatg acagtagtgc 20
<210> 18
<211> 20
<212> DNA
<213>People (Homo sapiens)
<400> 18
acaattgatg acctggaaga 20
<210> 19
<211> 22
<212> DNA
<213>People (Homo sapiens)
<400> 19
ctcgcagctc agccaactct tt 22
<210> 20
<211> 20
<212> DNA
<213>People (Homo sapiens)
<400> 20
ccagacaaag gtcagtgggg 20
<210> 21
<211> 22
<212> DNA
<213>People (Homo sapiens)
<400> 21
ccaaataaac caggcattcc aa 22
<210> 22
<211> 22
<212> DNA
<213>People (Homo sapiens)
<400> 22
gactacctca tgaagatcct ca 22
<210> 23
<211> 23
<212> DNA
<213>People (Homo sapiens)
<400> 23
tctccttaat gtcacgcacg att 23
<210> 24
<211> 21
<212> DNA
<213>People (Homo sapiens)
<400> 24
cggctacagc ttcaccacca c 21
Claims (3)
- A kind of 1. multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions, it is characterised in that：Including one just Detected to primer sets, a reverse primer group, a detection probe group, an internal standard forward primer, an internal standard reverse primer and an internal standard Probe；5 ' ends of the detection probe in detection probe group are modified with the first fluorescent reporter group, and it is glimmering that 3 ' ends are modified with first Optical quenching group；Internal standard detection probe 5 ' it is terminal modified have second fluorescent reporter group different from the first fluorescent reporter group, 3 ' ends are modified with the second fluorescent quenching group；WhereinForward primer group is made up of ROS1-32-F and ROS1-34/35-F, is included successively as shown in SEQ ID NO 01 and 02 Sequence；Reverse primer group is by ROS1-32-R, ROS1-34/35-R, ROS1-35-R1, ROS1-35-R2, ROS1-32-R1, ROS1- 34-R1、ROS1-1139-R、ROS1-1202-R、ROS1-1265-R、ROS1-1200-R、ROS1-1278-R、ROS1-1259- R, ROS1-1196-R, ROS1-1267-R, ROS1-1269-R and ROS1-1273-R are formed, and include such as SEQ ID NO 03 successively To the sequence shown in 18；Detection probe group is made up of ROS1-35-P, ROS1-34-P and ROS1-32-P, includes such as SEQ ID NO 19 to 21 respectively Shown sequence；The composition of each reaction system of the multiple fluorescence PCR detection reagent box is as follows：An at least forward primer in forward primer groupAn at least reverse primer in reverse primer groupA detection probe in detection probe groupInternal standard forward primerInternal standard reverse primerInternal standard detection probe1 × PCR buffer solutionsMgCl2dNTPsTaq enzymeTemplateH2O；The reaction condition of each reaction system of the multiple fluorescence PCR detection reagent box is：95 DEG C of pre-degenerations 5 minutes, 1 is followed Ring；95 DEG C are denatured 25 seconds, and 64 DEG C are annealed 20 seconds, and 72 DEG C extend 15 seconds, 15 circulations；95 DEG C are denatured 25 seconds, and 60 DEG C are annealed 35 seconds, 72 DEG C extend 10 seconds, 30 circulations；Fluorescence signal is detected when 30 circulate in annealing afterwards.
- 2. multiple fluorescence PCR detection reagent box as claimed in claim 1, it is characterised in that：The internal standard forward primer is β Actin-F, including the sequence as shown in SEQ ID NO 22；The internal standard reverse primer is β actin-R, including such as SEQ ID Sequence shown in NO 23；The internal standard detection probe is β actin-P, including the sequence as shown in SEQ D NO 24.
- 3. multiple fluorescence PCR detection reagent box as claimed in claim 1, it is characterised in that：First fluorescent reporter group For FAM, the first fluorescent quenching group is BHQ1, and second fluorescent reporter group is HEX, ROX or VIC, the second fluorescence Quencher is BHQ1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710788318.4A CN107354225A (en) | 2017-09-04 | 2017-09-04 | A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710788318.4A CN107354225A (en) | 2017-09-04 | 2017-09-04 | A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107354225A true CN107354225A (en) | 2017-11-17 |
Family
ID=60291240
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710788318.4A Pending CN107354225A (en) | 2017-09-04 | 2017-09-04 | A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107354225A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108342479A (en) * | 2018-03-01 | 2018-07-31 | 成都亚联科科技有限公司 | A kind of kit of ROS1 genetic tests |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104619840A (en) * | 2012-07-05 | 2015-05-13 | 日本国立癌症研究中心 | Fgfr2 fusion gene |
| CN104818318A (en) * | 2014-07-02 | 2015-08-05 | 厦门艾德生物医药科技有限公司 | Primers, probes, detection system and kit for one time detection of lung cancer multiple genes |
| CN106636376A (en) * | 2016-12-05 | 2017-05-10 | 武汉海吉力生物科技有限公司 | Nucleic acid and kit for detecting human ROS1 fusion genes and application method of kit |
-
2017
- 2017-09-04 CN CN201710788318.4A patent/CN107354225A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104619840A (en) * | 2012-07-05 | 2015-05-13 | 日本国立癌症研究中心 | Fgfr2 fusion gene |
| CN104818318A (en) * | 2014-07-02 | 2015-08-05 | 厦门艾德生物医药科技有限公司 | Primers, probes, detection system and kit for one time detection of lung cancer multiple genes |
| CN106636376A (en) * | 2016-12-05 | 2017-05-10 | 武汉海吉力生物科技有限公司 | Nucleic acid and kit for detecting human ROS1 fusion genes and application method of kit |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108342479A (en) * | 2018-03-01 | 2018-07-31 | 成都亚联科科技有限公司 | A kind of kit of ROS1 genetic tests |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Michels et al. | ArrayCGH‐based classification of neuroblastoma into genomic subgroups | |
| Terrazzino et al. | Genetic determinants of chronic oxaliplatin‐induced peripheral neurotoxicity: a genome‐wide study replication and meta‐analysis | |
| Kolberg et al. | Protein expression of BIRC5, TK1, and TOP2A in malignant peripheral nerve sheath tumours–A prognostic test after surgical resection | |
| Bernardi et al. | Amplification and deletion of the ACHE and BCHE cholinesterase genes in sporadic breast cancer | |
| KR20190025814A (en) | Detection of chromosome interactions associated with breast cancer | |
| Rajkumar et al. | BRCA1, BRCA2 and CHEK2 (1100 del C) germline mutations in hereditary breast and ovarian cancer families in South India | |
| CN111363810A (en) | Detection agent composition and kit for detecting multiple mutation sites of EGFR (epidermal growth factor receptor) gene | |
| CN104774963A (en) | Kit for detecting PIK3CA gene mutation and detecting method thereof | |
| CN106148497A (en) | BRAF gene mutation detection kit and application thereof | |
| EP3150717A1 (en) | Pik3ca gene mutation detection kit | |
| CN107354225A (en) | A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ROS1 Gene Fusions | |
| Hur et al. | Gene expression profiling of human gastrointestinal stromal tumors according to its malignant potential | |
| Leone et al. | Integration of global spectral karyotyping, CGH arrays, and expression arrays reveals important genes in the pathogenesis of glioblastoma multiforme | |
| CN108004320A (en) | EGFR genetic mutation detection architecture and its kit | |
| CN107365866A (en) | A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's ALK EML4 Gene Fusions | |
| Su et al. | Cytochrome P450 2E1 RsaI/PstI and DraI polymorphisms are risk factors for lung cancer in Mongolian and Han population in inner Mongolia | |
| Othman et al. | Molecular study of Nucleophosmin 1 (NPM1) gene in acute myeloid leukemia in Kurdish population | |
| CN110205370A (en) | Primer combination, kit and method for instructing Pravastatin drug personalized medicine related gene to detect | |
| CN107385088A (en) | A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's RET Gene Fusions | |
| KR102205831B1 (en) | Markers for predicting concentration of statin in blood | |
| CN107354197A (en) | A kind of kit for detecting mankind's NRAS gene mutations | |
| EP3927848A1 (en) | Process for classification of glioma | |
| CN102146434A (en) | Gene combination for instructing individualized treatment by medicines such as geftinat and Tarceva | |
| CN104531889A (en) | Improved amplification refractory mutation detection system primer and application thereof | |
| CN103966343B (en) | FGFR1 gene real time PCR detection method and kit thereof and primer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171117 |
|
| RJ01 | Rejection of invention patent application after publication |