CN107354197A - A kind of kit for detecting mankind's NRAS gene mutations - Google Patents
A kind of kit for detecting mankind's NRAS gene mutations Download PDFInfo
- Publication number
- CN107354197A CN107354197A CN201710304254.6A CN201710304254A CN107354197A CN 107354197 A CN107354197 A CN 107354197A CN 201710304254 A CN201710304254 A CN 201710304254A CN 107354197 A CN107354197 A CN 107354197A
- Authority
- CN
- China
- Prior art keywords
- sequence
- closing
- sense primer
- primer
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of kit for detecting mankind's NRAS gene mutations.The kit includes component first and/or component second；Component first includes closing sequence first and primer pair first；Component second includes closing sequence second and primer pair B；It is single strand dna to close sequence first and closing sequence second, wherein there occurs lock nucleic acid modification for some nucleotides；Primer pair first is made up of sense primer F1 and anti-sense primer R1；Primer pair B is made up of sense primer F2 and anti-sense primer R2；Sequence first, sense primer F1, anti-sense primer R1, closing sequence second, sense primer F2 and anti-sense primer R2 nucleotide sequence is closed successively as shown in the sequence 2 in sequence table, sequence 3, sequence 4, sequence 6, sequence 7 and sequence 8.Experiment shows, detects mankind's NRAS gene mutations using kit provided by the invention, accuracy rate is high, and sensitivity is also higher, so as to which the false negative rate of detection greatly reduce, has important application value.
Description
Technical field
The present invention relates to biology field, and in particular to a kind of kit for detecting mankind's NRAS gene mutations.
Background technology
RAS genes are a kind of proto-oncogenes, are the key regulators in cell growth, propagation and differentiation.Normal RAS
Albumen is positioned at intercellular membrane, has high affinity, and the activity with GTP enzymes to GTP and GDP.RAS albumen plays molecule
The effect of switch, being capable of regulating cell growth when normal expression；When point mutation occurs, overexpression or group translocation etc.
Abnormal conditions can cause abnormal cell proliferation, and finally trigger tumour to be formed.RAS genes be present in the human tumor more than 30%
Mutation.RAS gene families include KRAS genes, NRAS genes and HRAS genes.In recent years, in carcinoma of urinary bladder, breast cancer, knot
The exception of RAS genes is detected in intestinal cancer, kidney, liver cancer, cancer of pancreas, stomach cancer and hematopoietic system cancer：KRAS genes are dashed forward
Change is typically occurred in cancer of pancreas, lung cancer and colorectal cancer solid tumor cell, and HRAS gene mutations are typically in bladder tumor
In it is relatively conventional, and NRAS gene mutations are occurred frequently in neoplastic hematologic disorder, melanoma cells and thyroid carcinoma cell.
The NRAS albumen of NRAS gene codes has up to 85% homology with the other albumen of RAS families, so functionally
NRAS albumen also has the common feature of many RAS family proteins.NRAS albumen is located on the inside of cell membrane, belongs to a kind of low molecule
G-protein is measured, to guanylic acid with very strong compatibility and with GTPASe vigor；It is inactivation when NRAS albumen is combined with GDP
State；It is the state of activation when being combined with GTP, activates downstream signaling pathway, therefore particularly important open is played in signal transduction
Pass acts on.When NRAS albumen is undergone mutation, the abnormal activations such as downstream RAF and MAPK can be caused so as to be risen in malignant proliferation of tumor
Important function.The main codon 12 and codon 13 that exon 2 occurs of mutation of NRAS albumen, and show outside the 3rd
On the codon 61 of son, the wherein frequency of mutation highest of the codon 61 of the extron of codon 12 and the 3rd of exon 2.
Research shows, if occurred on the exon 2 and the 3rd extron of the NRAS genes of metastatic colorectal cancer patients
Mutation, then can not benefit, 2017 editions from anti-EGFR targeted therapies《NCCN colorectal cancer clinical practice guidelines》Point out only have
NRAS gene wild types patient just suggests receiving EGFR inhibitor (such as Cetuximab and Victibix) treatment.Douillard
JY (2013) et al. research shows, the other RAS catastrophes for receiving the patient of Victibix joint FOLFOX4 treatments can be with
Predicted treatment curative effect, the metastatic colorectal cancer patients of no RAS mutation can be changed using Victibix joint FOLFOX4 treatments
Kind patient's overall survival and Progression free survival rate.
In recent years, NRAS genes have been confirmed to be the driving gene of lung cancer generation, in NRAS gene mutations and lung cancer therapy
TKI resistances are relevant.Compared with the PC-9 cells (C-9/WT) of gefitinib, the PC-9 cells of Gefitinib resistance are being produced
In and be not detected by the EGFR-TKIs drug resistant genes such as NRAS genes, HER2 genes, and be found that 61 bit codons of NRAS genes
Mutation.Also, in the case where Gefitinib or AZD6244/CI1040 independent medications can not promote Apoptosis, Liang Zhelian
Apoptosis can be then effectively facilitated when sharing medicine.Therefore, NRAS gene mutations may play in the TKI resistances of lung cancer therapy
Important function, this provides new foundation with treatment for lung cancer detection and may.
Melanoma turns into the fastest-rising malignant tumour of the incidence of disease in recent years, and annual growth is about 3% to 5%.
NRAS gene mutation frequencies are generally 20-30% in melanoma.Anderson Cancer center result of study shows within 2012, a kind of
New drug regimen, i.e., NRAS genes can be treated by, which being used in combination using CDK4 as the inhibitor of drug targets with mek inhibitor, dashes forward
The melanoma patients of change.The oncogene analysis display of PRIME research of the same year from ESMO：NRAS genes, NRAS genes
The biology prediction index of Victibix+FOLFOX first-line treatments can be received as metastatic colon cancer with BRAF gene mutation.
According to another Lancet Oncology in 2013 an II clinical trial phase studies have shown that for NRAS genetic mutations melanin
Knurl patient, MEK162 are first effective target therapeutic agents, and may be the cancer trouble almost without effective treatment method
Person provides a kind of new therapeutic choice.Therefore, doctor can be instructed to melanin by carrying out detection to mankind's NRAS gene mutations situation
The cancer patients such as knurl are treated and prognosis.
In a word, NRAS gene mutations have in the occurrence and development of many tumours such as human melanoma, colorectal cancer, lung cancer
It is significant.It is mutated detection can Accurate Prediction correspond to targeted drug treat validity, be easy to clinical application to select,
Therapeutic effect is significantly improved, patient is at utmost benefited；Patient medical expense caused by the same time it can also avoid Irrational Use of Drugs
Wasted with burden and social medical resource, reduce unnecessary aging loss and economic loss.
Method currently used for detection in Gene Mutation have Sanger PCR sequencing PCRs, high-resolution solubility curve detection method, efficiently
Liquid chromatography, ARMS-PCR methods etc..More commonly used at present is ARMS-PCR methods, i.e. amplification refractory mutation system
(amplification refractory mutation system ARMS) established in 1989, this method high sensitivity, special
The opposite sex is good, but is only available for detecting known mutations gene.Sanger PCR sequencing PCRs are the goldstandards of abrupt climatic change, are passed through
The continuous development of 30 years now the DNA fragmentation up to 1000bp can be sequenced with perfect, and to each
The reading accuracy rate of base is up to 99.999%.Due to being dashed forward with very high reading accuracy rate, Sanger PCR sequencing PCRs as gene
The goldstandard of the genetic analysis such as change, SNP, unknown mutation site also can effectively be detected.In tumor tissues,
NRAS wild-type cells mix with mutant cell, and the sensitivity of Sanger PCR sequencing PCRs is only 10~20%, that is, work as saltant type
Cell could detect when accounting for the 10~20% of whole detection cell, therefore and significantly limit the application of Sanger PCR sequencing PCRs.
Therefore, it is necessary to establish a kind of sensitive, fast and effective, the multiple mutational sites of energy one-time detection NRAS detection method of gene mutation.
The content of the invention
The technical problems to be solved by the invention are how to detect whether mankind NRAS genes are mutated.
In order to solve the above technical problems, present invention firstly provides a kind of kit for detecting mankind's NRAS gene mutations.
The kit of detection mankind's NRAS gene mutations provided by the present invention, it may include component first and/or component second.
The component first may include to close sequence first and primer pair first；
The closing sequence first can be single strand dna, wherein there occurs lock nucleic acid modification for some nucleotides；
The primer pair first can be made up of two primers for amplifying specific DNA fragmentation first；The specific DNA fragment first
In there is target sequence first；The primer pair that the target sequence first can be human genome middle and upper reaches primers F 1 and anti-sense primer R1 is formed
The target sequence of first；
The sense primer F1 can be following a1) or a2)：
A1) the single strand dna shown in the sequence 3 of sequence table；
A2 sequence 3 by the substitution of one or several nucleotides and/or missing and/or addition and) had into phase with sequence 3
The DNA molecular of congenerous；
The anti-sense primer R1 can be following a3) or a4)：
A3) the single strand dna shown in the sequence 4 of sequence table；
A4 sequence 4 by the substitution of one or several nucleotides and/or missing and/or addition and) had into phase with sequence 4
The DNA molecular of congenerous；
It is described closing sequence first and the target sequence first can meet following relation (c1) or (c2) or (c3) or (c4) or
Or (c6) (c5)：
(c1) the closing sequence first is identical with more than 50 continuous nucleotides in a chain of the target sequence first；
(c2) the closing sequence first is identical with more than 50 continuous nucleotides in the positive-sense strand of the target sequence first；
(c3) the closing sequence first is identical with more than 50 continuous nucleotides in the antisense strand of the target sequence first；
(c4) the closing sequence first is identical with a chain of the target sequence first；
(c5) the closing sequence first is identical with the positive-sense strand of the target sequence first；
(c6) the closing sequence first is identical with the antisense strand of the target sequence first.
The component second may include to close sequence second and primer pair B；
The closing sequence second can be single strand dna, wherein there occurs lock nucleic acid modification for some nucleotides；
The primer pair B can be made up of two primers for amplifying specific DNA fragmentation second；The specific DNA fragment second
In there is target sequence second；The primer pair that the target sequence second can be human genome middle and upper reaches primers F 2 and anti-sense primer R2 is formed
The target sequence of second；
The sense primer F2 can be following a5) or a6)：
A5) the single strand dna shown in the sequence 7 of sequence table；
A6 sequence 7 by the substitution of one or several nucleotides and/or missing and/or addition and) had into phase with sequence 7
The DNA molecular of congenerous；
The anti-sense primer R2 can be following a7) or a8)：
A7) the single strand dna shown in the sequence 8 of sequence table；
A8 sequence 8 by the substitution of one or several nucleotides and/or missing and/or addition and) had into phase with sequence 8
The DNA molecular of congenerous；
It is described closing sequence second and the target sequence second can meet following relation (d1) or (d2) or (d3) or (d4) or
Or (d6) (d5)：
(d1) the closing sequence second is identical with more than 50 continuous nucleotides in a chain of the target sequence second；
(d2) the closing sequence second is identical with more than 50 continuous nucleotides in the positive-sense strand of the target sequence second；
(d3) the closing sequence second is identical with more than 50 continuous nucleotides in the antisense strand of the target sequence second；
(d4) the closing sequence second is identical with a chain of the target sequence second；
(d5) the closing sequence second is identical with the positive-sense strand of the target sequence second；
(d6) the closing sequence second is identical with the antisense strand of the target sequence second.
In mentioned reagent box, " there occurs lock nucleic acid modification for some nucleotides " can refer to has one every 2-5 base
Locate lock nucleic acid modification (i.e. lock nucleic acid modify substantially uniform distribution), such as being distributed as every 2,3,4 or 5 not of modifying of lock nucleic acid
A modified base be present in modified base.
In mentioned reagent box, the length about 20-40 base shorter than the target sequence first of the closing sequence first, and it is described
Close the both ends of sequence first and the sense primer F1 and the anti-sense primer R1 has the overlapping of about 3-5 base respectively.Institute
State closing sequence second length about 20-40 base shorter than the target sequence second, and it is described close sequence second both ends with it is described
The sense primer F2 and anti-sense primer R2 has the overlapping of about 3-5 base respectively.
In mentioned reagent box, the closing sequence first or the closing sequence second can be chemically modified.The closing
Sequence first is repaiied at 3 ' ends comprising the chemical modification for preventing that the closing sequence first from being extended in PCR reactions, such as phosphorylation
Decorations, the modification of C3- introns, the modification of C6- introns.The closing sequence second includes at 3 ' ends prevents the closing sequence second from existing
The chemical modification extended in PCR reactions, such as the modification of phosphorylation modification, C3- introns, the modification of C6- introns.
In mentioned reagent box, the closing sequence first and the target sequence first can specifically meet following relation：The closing
Sequence first is identical with 69 continuous nucleotides in a chain of the target sequence first.The closing sequence second and the target sequence
Second can specifically meet following relation：69 continuous nucleotide phases in one chain of the closing sequence second and the target sequence second
Together.
In mentioned reagent box, the nucleotide sequence of the closing sequence first can be as shown in the sequence 2 in sequence table.
In mentioned reagent box, the primer pair first can be made up of the sense primer F1 and the anti-sense primer R1.
In mentioned reagent box, the nucleotide sequence of the closing sequence second can be as shown in the sequence 6 in sequence table.
In mentioned reagent box, the primer pair B can be made up of the sense primer F2 and the anti-sense primer R2.
The preparation method of any of the above-described kit falls within protection scope of the present invention.Any of the above-described kit
Preparation method may include the closing sequence first, the sense primer F1, the anti-sense primer R1, the closing sequence
The step of second, the sense primer F2, the anti-sense primer R2 are individually packed.
Application of any of the above-described kit in product is prepared falls within protection scope of the present invention；The product
Function can be following b1) or b2)：
B1) identify or aid in identify whether test serum is tumor tissues；
B2) identify or aid in identify whether patient to be measured is cancer patient.
In order to solve the above technical problems, present invention also offers a kind of method for detecting mankind's NRAS gene mutations.
The method of detection mankind's NRAS gene mutations provided by the present invention, it may include following steps：Using any of the above-described
Described kit carries out deviation amplification to mankind NRAS genes, obtains amplified production；Identify the mutation in the amplified production.
In the above method, the reaction system (being hereinafter referred to as inclined to amplification system) of the deviation amplification may include the upstream
Primers F 1, the anti-sense primer R1 and the closing sequence first.The reaction system of the deviation amplification may include that the upstream is drawn
Thing F2, the anti-sense primer R2 and the closing sequence second.The reaction system concretely 20 μ L of the deviation amplification, by 10 μ L
Premix Ex Taq (2 ×), 0.5 μ L concentration are the 10 μm of ol/L sense primer F1,0.5 μ L concentration is 10 μm of ol/L
The anti-sense primer R1, closing sequence first, the 1 μ L human genome DNAs to be measured (about 50ng) that 0.5 μ L concentration is 2.5nM
Formed with 7.5 μ L nuclease-free waters.The reaction system concretely 20 μ L of the deviation amplification, by 10 μ L Premix Ex Taq
The anti-sense primer that (2 ×), 0.5 μ L concentration are the 10 μm of ol/L sense primer F2,0.5 μ L concentration is 10 μm of ol/L
R2, the closing sequence second, 1 μ L human genome DNAs to be measured (about 50ng) and the 7.5 μ L free nucleic acids that 0.5 μ L concentration is 2.5nM
Enzyme water forms.The Premix Ex Taq (2 ×) can be the product of TAKARA companies, catalog number RR390A.
In the above method, the reaction condition of the deviation amplification system is concretely：95 DEG C of pre-degeneration 5min, 1 circulation；
95 DEG C of denaturation 15s, 70.5 DEG C of annealing 90s, are denatured 20s under 84 DEG C of key temperatures, 56 DEG C of annealing 15s, 72 DEG C of extension 30s, 35
Circulation；72 DEG C of extension 3min.
The present invention also protect it is a kind of identify or aid in identify test serum whether be or method that candidate is tumor tissues, can
Comprise the following steps：Deviation amplification is carried out to test serum and normal structure using any of the above-described described kit respectively, so
After make the following judgment：
If the amplified production of the test serum is consistent with the nucleotide sequence of the amplified production of normal structure, described
Test serum is not or candidate is not tumor tissues；
If the nucleotide sequence of the amplified production of the test serum and the amplified production of normal structure is inconsistent, institute
State that test serum is or candidate is tumor tissues.
The present invention also protect it is a kind of identify or aid in identify patient to be measured whether be cancer patient method, it may include it is as follows
Step：Using any of the above-described described kit, the tissue to patient to be measured and the tissue of normal person carry out deviation amplification respectively,
Then make the following judgment：
If the nucleotides of the amplified production of the tissue of the patient to be measured and the amplified production of the tissue of the normal person
Sequence is consistent, then the patient to be measured is not or candidate is not cancer patient；
If the nucleotides of the amplified production of the tissue of the patient to be measured and the amplified production of the tissue of the normal person
Sequence is inconsistent, then the patient to be measured is or candidate is cancer patient.
Any of the above-described tumor tissues concretely human thyroid cancerous tissue.
Any of the above-described cancer in particular concretely human thyroid carcinomas.
Experiment shows, detects mankind's NRAS gene mutations using kit provided by the invention, accuracy rate is high, sensitivity
It is higher (sensitivity can as little as 0.5%-1%, and the sensitivity of conventional Sanger PCR sequencing PCRs is only 10%-20%), so as to significantly
The false negative rate for reducing detection.Therefore, there is important application value using kit provided by the present invention.
Brief description of the drawings
Fig. 1 is the experimental result of the deviation amplification of cell line 1.
Fig. 2 is the experimental result of the deviation amplification of cell line 2.
Fig. 3 is the experimental result of the deviation amplification of cell line 3.
Fig. 4 is the experimental result of the deviation amplification of cell line 4.
Fig. 5 is the experimental result of the deviation amplification of cell line 5.
Fig. 6 is the experimental result of the deviation amplification of cell line 6.
Fig. 7 is the experimental result of the deviation amplification of cell line 7.
Fig. 8 is the experimental result of the deviation amplification of cell line 8.
Fig. 9 is the experimental result of the deviation amplification of cell line 9.
Figure 10 is the part of test results of embodiment 4.
Embodiment
The present invention is further described in detail with reference to embodiment, the embodiment provided is only for explaining
The bright present invention, the scope being not intended to be limiting of the invention.Experimental method in following embodiments, unless otherwise specified, it is
Conventional method.Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.Following reality
The quantitative test in example is applied, is respectively provided with and repeats to test three times, results averaged.
The quantitative real time PCR Instruments of Light Cycler 480 are the product of Roche companies.SYBR Premix Ex Taq(2
×) and Premix Ex Taq (2 ×) be the product of TAKARA companies, catalog number is followed successively by RR820A and RR390A.
The design and synthesis of embodiment 1, closing sequence and primer
First, the design and synthesis of the closing sequence of NRAS Exon 2s and primer
The exon 2 and its peripheral sequence of normal human subject NRAS genes are as shown in sequence 1 in sequence table.
5’-TGATTATAGAAAGCTTTAAAGTACTGTAGATGTGGCTCGCCAATTAACCCTGATTACTGGTTTCCA
ACAGGTTCTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTTGGGAAAAGCGCACT GACAATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGATCCCACCATAGAGGTGAGGCCCAGTGGTAGCCCGC
TGACCTGATCCTGTCTCTCACTTGTCGGATCATCTTTACCC-3 ' (sequence 1 in sequence table)
According to mutated site (codon 12 and codon 13 that are located at exon 2), NRAS genes the 2nd are designed and synthesized
The closing sequence (single strand dna) of extron.The closing sequence of NRAS Exon 2s is as shown in sequence 2 in sequence table
(base of the italic with asterisk represents the base and modified as lock nucleic acid).
5’-AAT*GACT*GAG*TACAAAC*TG*GTGGT*GGTT*GGAGC*AGGTGG*TGT*TGGG*AAAAGC*GCACT*
GACAA*TCC*AGCT-3 ' (sequence 2 in sequence table)
According to mutated site (codon 12 and codon 13 that are located at exon 2), design and synthesize for detecting
The primer pair first of NRAS Exon 2s.Primer pair first is made up of sense primer F1 and anti-sense primer R1.
Sense primer F1：5 '-TTCTTGCTGGTGTGAAATGA-3 ' (sequence 3 in sequence table).
Anti-sense primer R1：5 '-CAAAGTGGTTCTGGATTAGCT-3 ' (sequence 4 in sequence table).
The target sequence of primer pair first be sequence table in DNA molecular of the sequence 1 from 5 ' ends shown in the 72nd to 172 (i.e.
Underscore part) (101bp).
2nd, the design and synthesis of the closing sequence of the extron of NRAS genes the 3rd and primer
The 3rd extron and its peripheral sequence of normal human subject NRAS genes are as shown in sequence 5 in sequence table.
5’-GGTTTTTAATAAAAATTGAACTTCCCTCCCTCCCTGCCCCCTTACCCTCCACACCCCCAGGATTCT
TACAGAAAACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGACAAGAAGAGTACAG TGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTCTGTGTATTTGCCATCAATAATAGCAAGTCATTTG
CGGATATTAACCTCTACAGGTACTAGGAGCA-3 ' (sequence 5 in sequence table).
According to the mutated site codon 61 of the 3rd extron (be located at), the envelope of the extron of NRAS genes the 3rd is designed and synthesized
Close sequence (single strand dna).The closing sequence of the extron of NRAS genes the 3rd (italic band asterisk as shown in sequence 6 in sequence table
Base represent the base as lock nucleic acid modify).
5’-TGGT*GAAA*CCTGT*TTGT*TGGA*CATA*CTG*GATAC*AGCTG*GACAA*GAAGA*GTACA*
GTGCC*ATGA*GAG*ACCA-3 ' (sequence 6 in sequence table)
According to mutated site (codon 61 for being located at the 3rd extron), design and synthesize for detecting outside NRAS genes the 3rd
Show the primer pair B of son.Primer pair B is made up of sense primer F2 and anti-sense primer R2.
Sense primer F2：5 '-AACAAGTGGTTATAGATGGTG-3 ' (sequence 7 in sequence table).
Anti-sense primer R2：5 '-GCCTTCGCCTGTCCTCATGTA-3 ' (sequence 8 in sequence table).
The target sequence of primer pair B be sequence table in DNA molecular of the sequence 5 from 5 ' ends shown in the 74th to 180 (i.e.
Underscore part) (107bp).
Embodiment 2, the method for detecting mankind's NRAS gene mutations
Relative to crude oligonucleotides sequence, lock nucleic acid has stronger affinity to the DNA sequence dna of its reverse complemental.Through
Cross the lock nucleic acid verified repeatedly in the closing sequence of NRAS Exon 2s and the closing sequence of the extron of NRAS genes the 3rd
Quantity and position so that crucial denaturation temperature Tc is slightly above PCR amplifications (less than the Tm values between closing sequence and target DNA) and produced
The Tm values of thing.
1st, product melting temperature (Tm) is determined
Using the genomic DNA of Normal human cells as template, respectively with primer pair first and primer pair B in Light
Expanded on the quantitative real time PCR Instruments of Cycler 480, reaction system is shown in Table 1, and reaction condition is as follows：95℃2min；95℃
15s, 56 DEG C of 30s, 40 circulations；95 DEG C of 15s, 60 DEG C of 1min, 95 DEG C of 15s, 1 circulation.PCR final steps are that product melts song
Line analysis：95 DEG C of 1min, 40 DEG C of 1min, 65~85 DEG C.
Table 1
| Component | Volume |
| SYBR Premix Ex Taq(2×) | 10μL |
| Sense primer (concentration is 10 μm of ol/L) | 0.5μL |
| Anti-sense primer (concentration is 10 μm of ol/L) | 0.5μL |
| Template | 1μL(50ng) |
| Nuclease-free water | 8μL |
As a result show, the wild type product melting temperature (Tm) of NRAS Exon 2s is 82.5 DEG C；NRAS genes
The wild type product melting temperature (Tm) of 3 extrons is 82 DEG C.
2nd, the measure of crucial denaturation temperature (Tc values)
Using the closing sequence of NRAS Exon 2s as template, with upstream primers F 1 and anti-sense primer R1 in Light
Expanded on the quantitative real time PCR Instruments of Cycler 480, reaction system is shown in Table 1, and reaction condition is as follows：95 DEG C of 5min, 1 is followed
Ring；95 DEG C of 15s, 70.5 DEG C of 90s, Tx DEG C of 20s, 56 DEG C of annealing 15s, 72 DEG C of extension 30s, 35 circulate；72 DEG C of extension 3min.Its
Middle Tx (to be changed and grope temperature), typically starts to determine, is determined partially by changing Tx value observation experiments result from high to low
Crucial denaturation temperature (Tc values) into amplification system：Initial Tx values are advisable with 1~2 DEG C higher than Tm values, if PCR expansions can be amplified
Increase production thing, then further reduce Tx values, 0.5~l DEG C is reduced every time, untill Tx values are reduced to and can not detect fluorescence signal
(can not amplify pcr amplification product), then 1 thermograde in this Tx value be then inclined to amplification system or pcr amplification product
Tc values.
The Tx values of this experiment are since 86 DEG C.When Tx values are set to 86 DEG C, pcr amplification product can be amplified；Further drop
When low Tx values are 85.5 DEG C, 85 DEG C, 84.5 DEG C, 84 DEG C, remain to amplify pcr amplification product；But when Tx values are reduced to 83.5 DEG C
When, then it can not amplify pcr amplification product.Therefore, the crucial denaturation temperature of the deviation amplification system of NRAS Exon 2s
For 84 DEG C.
According to the method described above, the closing sequence of NRAS Exon 2s is replaced with into the envelope of the extron of NRAS genes the 3rd
Sequence is closed, sense primer F1 replaces with sense primer F2, and anti-sense primer R1 replaces with sense primer R2, and other steps are constant,
The crucial denaturation temperature for obtaining the deviation amplification system of the extron of NRAS genes the 3rd is 84 DEG C.
In summary, comprising the following steps that for mankind's NRAS gene mutations is detected：Using the genomic DNA of patient to be measured as mould
Plate, deviation amplification is carried out using primer pair first or primer pair B and (2 are shown in Table using the PCR reaction systems of primer pair first, using primer
3) the PCR reaction systems of second are shown in Table, obtain pcr amplification product；Then pcr amplification product is sequenced, so as to judge to treat
Survey whether patient NRAS genes undergo mutation.
It is inclined to the reaction condition of amplification system：95 DEG C of pre-degeneration 5min, 1 circulation；95 DEG C of denaturation 15s, 70.5 DEG C of annealing
90s, is denatured 20s under 84 DEG C of key temperatures, 56 DEG C of annealing 15s, 72 DEG C of extension 30s, 35 circulations；72 DEG C of extension 3min.
Table 2
Table 3
Embodiment 3, sensitivity experiment
Point mutation is carried out to the NRAS genes of human thyroid carcinomas WRO cell lines, obtained respectively containing aobvious outside NRAS genes the 2nd
9 plants of cell lines of the different constitutive mutations of son and the 3rd extron.The details of 9 plants of cell lines are shown in Table 4.
Table 4
Sensitivity experiment is carried out using above-mentioned 9 plants of cell line, comprised the following steps that：
1st, the cultural method of above-mentioned 9 plants of cell line is established, and extracts the complete genome DNA of 8 plants of cell line.
2nd, using gradient dilution method, by the complete genome DNA of 8 plants of cell line respectively according to a certain percentage (1：5、1:10、1:
20、1:100 or 1:200) mixed with the complete genome DNA of Normal human cells, obtain hybrid dna.
3rd, using hybrid dna as template, use primer pair first or primer pair B carries out deviation amplification (sudden change region is outside the 2
The PCR reaction systems for showing son are shown in Table 5,6) sudden change region is shown in Table for the PCR reaction systems of the 3rd extron, obtain PCR amplification productions
Thing；Then Sanger sequencings, meter sensitivity are carried out to pcr amplification product by the prosperous biological Co., Ltd in Beijing Chinese catalpa.
It is inclined to the reaction condition of amplification system：95 DEG C of pre-degeneration 5min, 1 circulation；95 DEG C of denaturation 15s, 70.5 DEG C of annealing
90s, is denatured 20s under 84 DEG C of key temperatures, 56 DEG C of annealing 15s, 72 DEG C of extension 30s, 35 circulations；72 DEG C of extension 3min.
Table 5
Table 6
Experimental result is shown in Fig. 1 to Fig. 9.As a result show, method provided by the invention detects cell line 1, cell line 2, cell
The minimum mutant DNA ratio for being 3, cell line 4, cell line 6 and cell line 7 is 1:200 (0.5%), surveyed than traditional sanger
The method of sequence improves 20 times；Method provided by the invention detects the minimum mutant DNA of cell line 5, cell line 8 and cell line 9
Ratio is 1:100 (1%), the method than traditional sanger sequencings improve 10 times.
Embodiment 4, clinical sample checking
1st, prepared by template
The paraffin-embedded tissue section sample of 112 thyroid cancer patients (the equal informed consent of thyroid cancer patients) is taken, so
Genomic DNA (the concentration and purity of measure genomic DNA, it is desirable to which concentration is more than 10ng/ μ L is extracted afterwards；OD260nm/OD280nm
Between 1.8-2.0).
2nd, the genomic DNA extracted respectively using step 1 carries out deviation amplification as template using primer pair first or primer pair B
(2 are shown in Table using the PCR reaction systems of primer pair first, is shown in Table 3) using the PCR reaction systems of primer pair B, obtains PCR amplification productions
Thing；Then pcr amplification product is sequenced, so as to judge whether patient NRAS genes to be measured undergo mutation.
It is inclined to the reaction condition of amplification system：95 DEG C of pre-degeneration 5min, 1 circulation；95 DEG C of denaturation 15s, 70.5 DEG C of annealing
90s, is denatured 20s under 84 DEG C of key temperatures, 56 DEG C of annealing 15s, 72 DEG C of extension 30s, 35 circulations；72 DEG C of extension 3min.
Part of test results is shown in that (A is the testing result that mutation type is Q61K to Figure 10, and B is the inspection that mutation type is Q61R
Result is surveyed, C is the testing result that mutation type is G12D, and D is the testing result that mutation type is G13D) and table 7.As a result table
Bright, in 112 thyroid cancer patients, the NRAS Exon 2s of 3 patients are mutated, and wherein sudden change region is close
2 of numeral 12, sudden change region are 1 of codon 13, and the extron of NRAS genes the 3rd of 6 patients is mutated, total inspection
Extracting rate 8%.
Table 7
The NRAS genes of 112 thyroid cancer patients are detected using ARMS-PCR methods.ARMS-PCR methods are examined
The experimental result of the experimental result of survey and method provided by the invention is completely the same.
Therefore, detecting whether patient NRAS genes to be measured undergo mutation using method provided by the present invention, accuracy rate is high,
With important application value.
<110>Beijing Fuan bio tech ltd of China
<120>A kind of kit for detecting mankind's NRAS gene mutations
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 261
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 1
tgattataga aagctttaaa gtactgtaga tgtggctcgc caattaaccc tgattactgg 60
tttccaacag gttcttgctg gtgtgaaatg actgagtaca aactggtggt ggttggagca 120
ggtggtgttg ggaaaagcgc actgacaatc cagctaatcc agaaccactt tgtagatgaa 180
tatgatccca ccatagaggt gaggcccagt ggtagcccgc tgacctgatc ctgtctctca 240
cttgtcggat catctttacc c 261
<210> 2
<211> 69
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 2
aatgactgag tacaaactgg tggtggttgg agcaggtggt gttgggaaaa gcgcactgac 60
aatccagct 69
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 3
ttcttgctgg tgtgaaatga 20
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 4
caaagtggtt ctggattagc t 21
<210> 5
<211> 251
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 5
ggtttttaat aaaaattgaa cttccctccc tccctgcccc cttaccctcc acacccccag 60
gattcttaca gaaaacaagt ggttatagat ggtgaaacct gtttgttgga catactggat 120
acagctggac aagaagagta cagtgccatg agagaccaat acatgaggac aggcgaaggc 180
ttcctctgtg tatttgccat caataatagc aagtcatttg cggatattaa cctctacagg 240
tactaggagc a 251
<210> 6
<211> 69
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 6
tggtgaaacc tgtttgttgg acatactgga tacagctgga caagaagagt acagtgccat 60
gagagacca 69
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 7
aacaagtggt tatagatggt g 21
<210> 8
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 8
gccttcgcct gtcctcatgt a 21
Claims (10)
1. a kind of kit for detecting mankind's NRAS gene mutations, including component first and/or component second；
The component first includes closing sequence first and primer pair first；
The closing sequence first is single strand dna, wherein there occurs lock nucleic acid modification for some nucleotides；
The primer pair first is made up of two primers for amplifying specific DNA fragmentation first；Have in the specific DNA fragment first
Target sequence first；The target sequence first is the target sequence of human genome middle and upper reaches primers F 1 and the primer pair first of anti-sense primer R1 compositions
Row；
The sense primer F1 is following a1) or a2)：
A1) the single strand dna shown in the sequence 3 of sequence table；
A2 sequence 3 by the substitution of one or several nucleotides and/or missing and/or addition and) had into identical work(with sequence 3
The DNA molecular of energy；
The anti-sense primer R1 is following a3) or a4)：
A3) the single strand dna shown in the sequence 4 of sequence table；
A4 sequence 4 by the substitution of one or several nucleotides and/or missing and/or addition and) had into identical work(with sequence 4
The DNA molecular of energy；
It is described closing sequence first and the target sequence first meet following relation (c1) or (c2) or (c3) or (c4) or (c5) or
(c6)：
(c1) the closing sequence first is identical with more than 50 continuous nucleotides in a chain of the target sequence first；
(c2) the closing sequence first is identical with more than 50 continuous nucleotides in the positive-sense strand of the target sequence first；
(c3) the closing sequence first is identical with more than 50 continuous nucleotides in the antisense strand of the target sequence first；
(c4) the closing sequence first is identical with a chain of the target sequence first；
(c5) the closing sequence first is identical with the positive-sense strand of the target sequence first；
(c6) the closing sequence first is identical with the antisense strand of the target sequence first；
The component second includes closing sequence second and primer pair B；
The closing sequence second is single strand dna, wherein there occurs lock nucleic acid modification for some nucleotides；
The primer pair B is made up of two primers for amplifying specific DNA fragmentation second；Have in the specific DNA fragment second
Target sequence second；The target sequence second is the target sequence of human genome middle and upper reaches primers F 2 and the primer pair B of anti-sense primer R2 compositions
Row；
The sense primer F2 is following a5) or a6)：
A5) the single strand dna shown in the sequence 7 of sequence table；
A6 sequence 7 by the substitution of one or several nucleotides and/or missing and/or addition and) had into identical work(with sequence 7
The DNA molecular of energy；
The anti-sense primer R2 is following a7) or a8)：
A7) the single strand dna shown in the sequence 8 of sequence table；
A8 sequence 8 by the substitution of one or several nucleotides and/or missing and/or addition and) had into identical work(with sequence 8
The DNA molecular of energy；
It is described closing sequence second and the target sequence second meet following relation (d1) or (d2) or (d3) or (d4) or (d5) or
(d6)：
(d1) the closing sequence second is identical with more than 50 continuous nucleotides in a chain of the target sequence second；
(d2) the closing sequence second is identical with more than 50 continuous nucleotides in the positive-sense strand of the target sequence second；
(d3) the closing sequence second is identical with more than 50 continuous nucleotides in the antisense strand of the target sequence second；
(d4) the closing sequence second is identical with a chain of the target sequence second；
(d5) the closing sequence second is identical with the positive-sense strand of the target sequence second；
(d6) the closing sequence second is identical with the antisense strand of the target sequence second.
2. kit as claimed in claim 1, it is characterised in that：The nucleotide sequence of the closing sequence first is as in sequence table
Shown in sequence 2.
3. kit as claimed in claim 1, it is characterised in that：The primer pair first is by the sense primer F1 and the downstream
Primer R1 is formed.
4. kit as claimed in claim 1, it is characterised in that：The nucleotide sequence of the closing sequence second is as in sequence table
Shown in sequence 6.
5. kit as claimed in claim 1, it is characterised in that：The primer pair B is by the sense primer F2 and the downstream
Primer R2 is formed.
6. the preparation method of any kit of claim 1 to 5, including sequence will be closed described in claim 1 to 5
First, the sense primer F1, the anti-sense primer R1, the closing sequence second, the sense primer F2, the anti-sense primer R2
The step of individually packing.
7. application of any kit of claim 1 to 5 in product is prepared；The function of the product is following b1) or
b2)：
B1) identify or aid in identify whether test serum is tumor tissues；
B2) identify or aid in identify whether patient to be measured is cancer patient.
8. a kind of method for detecting mankind's NRAS gene mutations, comprises the following steps：Using any described in claim 1 to 5
Kit deviation amplification is carried out to mankind NRAS genes, obtain amplified production；Identify the mutation in the amplified production.
Identify or aid in identify whether test serum is or method that candidate is tumor tissues to comprise the following steps 9. a kind of：Adopt
Deviation amplification is carried out to test serum and normal structure respectively with any described kit in claim 1 to 5, then carried out
It is following to judge：
If the amplified production of the test serum is consistent with the nucleotide sequence of the amplified production of normal structure, described to be measured
Tissue is not or candidate is not tumor tissues；
If the nucleotide sequence of the amplified production of the test serum and the amplified production of normal structure is inconsistent, described to treat
Survey is organized as or candidate is tumor tissues.
10. it is a kind of identify or aid in identify patient to be measured whether be cancer patient method, comprise the following steps：Will using right
The tissue to patient to be measured and the tissue of normal person carry out deviation amplification, Ran Houjin to kit described in asking any in 1 to 5 respectively
Row is following to be judged：
If the nucleotide sequence of the amplified production of the tissue of the patient to be measured and the amplified production of the tissue of the normal person
Unanimously, then the patient to be measured is not or candidate is not cancer patient；
If the nucleotide sequence of the amplified production of the tissue of the patient to be measured and the amplified production of the tissue of the normal person
Inconsistent, then the patient to be measured is or candidate is cancer patient.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510834275.XA CN107338240B (en) | 2015-11-25 | 2015-11-25 | Method and kit for biased amplification of target nucleic acid sequence in sample |
| PCT/CN2016/106872 WO2017088750A1 (en) | 2015-11-25 | 2016-11-23 | Method and kit for deviation amplification of target nucleic acid sequence in sample |
| CNPCT/CN2016/106872 | 2016-11-23 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107354197A true CN107354197A (en) | 2017-11-17 |
| CN107354197B CN107354197B (en) | 2020-10-27 |
Family
ID=58763762
Family Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510834275.XA Active CN107338240B (en) | 2015-11-25 | 2015-11-25 | Method and kit for biased amplification of target nucleic acid sequence in sample |
| CN201710304209.0A Active CN107354195B (en) | 2015-11-25 | 2017-05-03 | Kit for detecting human ESR1 gene mutation |
| CN201710304254.6A Active CN107354197B (en) | 2015-11-25 | 2017-05-03 | Kit for detecting human NRAS gene mutation |
| CN201710304210.3A Active CN107354196B (en) | 2015-11-25 | 2017-05-03 | Kit for detecting human KRAS gene mutation |
Family Applications Before (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510834275.XA Active CN107338240B (en) | 2015-11-25 | 2015-11-25 | Method and kit for biased amplification of target nucleic acid sequence in sample |
| CN201710304209.0A Active CN107354195B (en) | 2015-11-25 | 2017-05-03 | Kit for detecting human ESR1 gene mutation |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710304210.3A Active CN107354196B (en) | 2015-11-25 | 2017-05-03 | Kit for detecting human KRAS gene mutation |
Country Status (2)
| Country | Link |
|---|---|
| CN (4) | CN107338240B (en) |
| WO (1) | WO2017088750A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500688A (en) * | 2020-04-30 | 2020-08-07 | 北京和合医学诊断技术股份有限公司 | Method for synchronously detecting mutation of No.2, 3 and 4 exon genes of NRAS gene |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164519A (en) * | 2017-06-26 | 2017-09-15 | 深圳优圣康医学检验所有限公司 | A kind of primer and probe that ESR1 gene mutations are detected based on fluorescent PCR |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102859003A (en) * | 2010-03-08 | 2013-01-02 | 达纳-法伯癌症研究院有限公司 | Full COLD-PCR enrichment with reference blocking sequence |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AUPS076902A0 (en) * | 2002-02-26 | 2002-03-21 | Commonwealth Scientific And Industrial Research Organisation | Novel selective polymerase chain reaction |
| US20100009355A1 (en) * | 2006-03-14 | 2010-01-14 | Kolodney Michael S | Selective amplification of minority mutations using primer blocking high-affinity oligonucleotides |
| CN101434985B (en) * | 2007-11-15 | 2012-12-19 | 上海长海医院 | Quantitative determination method for K-ras gene mutation |
| JP2011030514A (en) * | 2009-08-03 | 2011-02-17 | Kirin Holdings Co Ltd | Method for detecting single nucleotide polymorphism |
| GB201100150D0 (en) * | 2011-01-06 | 2011-02-23 | Epistem Ltd | Mutational analysis |
| CN103937664B (en) * | 2013-09-16 | 2016-02-10 | 瑞希基因科技（北京）股份有限公司 | A kind of KRAS gene mutation detection kit |
| CN104762410A (en) * | 2015-04-29 | 2015-07-08 | 上海允英医疗科技有限公司 | Primer, probes and detection kit used for full RAS mutation detection |
-
2015
- 2015-11-25 CN CN201510834275.XA patent/CN107338240B/en active Active
-
2016
- 2016-11-23 WO PCT/CN2016/106872 patent/WO2017088750A1/en active Application Filing
-
2017
- 2017-05-03 CN CN201710304209.0A patent/CN107354195B/en active Active
- 2017-05-03 CN CN201710304254.6A patent/CN107354197B/en active Active
- 2017-05-03 CN CN201710304210.3A patent/CN107354196B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102859003A (en) * | 2010-03-08 | 2013-01-02 | 达纳-法伯癌症研究院有限公司 | Full COLD-PCR enrichment with reference blocking sequence |
Non-Patent Citations (1)
| Title |
|---|
| JÖRG TOST: "The clinical potential of Enhanced-ice-COLD-PCR，，", 《EXPERT REVIEW OF MOLECULAR DIAGNOSTICS》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500688A (en) * | 2020-04-30 | 2020-08-07 | 北京和合医学诊断技术股份有限公司 | Method for synchronously detecting mutation of No.2, 3 and 4 exon genes of NRAS gene |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2017088750A1 (en) | 2017-06-01 |
| CN107354196B (en) | 2020-10-27 |
| CN107354195B (en) | 2020-10-27 |
| CN107338240B (en) | 2020-11-24 |
| CN107354196A (en) | 2017-11-17 |
| CN107354197B (en) | 2020-10-27 |
| CN107354195A (en) | 2017-11-17 |
| CN107338240A (en) | 2017-11-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Skaro et al. | Prevalence of germline mutations associated with cancer risk in patients with intraductal papillary mucinous neoplasms | |
| Rachakonda et al. | Somatic mutations in exocrine pancreatic tumors: association with patient survival | |
| Abdel‐Fattah et al. | Differential expression of HOX genes in neoplastic and non‐neoplastic human astrocytes | |
| KR102453393B1 (en) | Detection of chromosomal interactions associated with breast cancer | |
| Beesley et al. | The gene expression signature of relapse in paediatric acute lymphoblastic leukaemia: implications for mechanisms of therapy failure | |
| EP3150719B1 (en) | Nras gene mutation detection kit | |
| Wang et al. | Effects of KRAS mutation and polymorphism on the risk and prognosis of oral squamous cell carcinoma | |
| Zenali et al. | Retrospective review of MET gene mutations | |
| CN107312822A (en) | A kind of construction method in oncogene variation library detected for high-flux sequence and its application | |
| CN109182521A (en) | Application of the circRNA as thyroid papillary carcinoma marker | |
| Liu et al. | Predicting novel salivary biomarkers for the detection of pancreatic cancer using biological feature-based classification | |
| US20150344964A1 (en) | Prediction of the treatment response to an anti-egfr molecule in colorectal cancer patients | |
| Datta et al. | Poor survival after resection of early gastric cancer: extremes of survivorship analysis reveal distinct genomic profile | |
| Thapa et al. | Exploring ncRNA-mediated regulation of EGFR signalling in glioblastoma: From mechanisms to therapeutics | |
| CN106148497A (en) | BRAF gene mutation detection kit and application thereof | |
| CN107354197A (en) | A kind of kit for detecting mankind's NRAS gene mutations | |
| CN110093423A (en) | Purposes of the gene marker in adenocarcinoma of lung diagnosis and treatment | |
| CN102796811B (en) | Reagent and method for detecting KRAS mutation | |
| CN110408703A (en) | Colorectal cancer miRNA marker and its application | |
| CN108624693A (en) | Applications of the miR-577 in preparing diagnosis of nephropathy marker | |
| Tarighi et al. | Long non-coding RNA (lncRNA) DSCAM-AS1 is upregulated in breast cancer | |
| CN104762399A (en) | Tumor circulating DNA KRAS mutation detection method | |
| Gagliardi et al. | The 8q24 region hosts miRNAs altered in biospecimens of colorectal and bladder cancer patients | |
| Zhenzhen et al. | Single nucleotide polymorphism of rs28416520 in Piwil1 gene promoter region is associated with an increased risk of gastric cancer | |
| Gleeson et al. | Molecular cytology genotyping of primary and metastatic GI stromal tumors by using a custom two-gene targeted next-generation sequencing panel with therapeutic intent |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210119 Address after: Floor 4, building 14, yard 156, Jinghai 4th Road, Daxing District, Beijing 100176 Patentee after: BEIJING GENOMEPRECISION TECHNOLOGY Co.,Ltd. Address before: 100071 3rd floor, Zhongjin global building, No.31, yard 6, Haiying Road, Fengtai District, Beijing Patentee before: BEIJING F.A.H BIOTECH Co.,Ltd. |