CN104762399A - Tumor circulating DNA KRAS mutation detection method - Google Patents
Tumor circulating DNA KRAS mutation detection method Download PDFInfo
- Publication number
- CN104762399A CN104762399A CN201510185937.5A CN201510185937A CN104762399A CN 104762399 A CN104762399 A CN 104762399A CN 201510185937 A CN201510185937 A CN 201510185937A CN 104762399 A CN104762399 A CN 104762399A
- Authority
- CN
- China
- Prior art keywords
- test kit
- ggt
- treatment
- sequence according
- sudden change
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention relates to a tumor circulating DNA KRAS mutation detection method. The invention specifically relates to primer sequences (SEQ ID NO: 3 and 4) used for the detection, a kit and compositions comprising the primer sequences, an application of the primer sequences, and the like. According to the invention, with a detection method for detecting KRAS second exon gene mutation through second-generation high-throughput sequencing aiming at the tumor circulating DNA, defects such as inadequate sensitivity of traditional sequencing methods can be overcome.
Description
Technical field
The present invention relates to cycling tumor DNA KRAS detection method.
Background technology
Mutation detection specific based on the high-flux sequence of Peripheral Circulation DNA is strong, highly sensitive.By the abrupt climatic change of Peripheral Circulation DNA KRAS, the impact of potential side effect over-treatment can avoided and bring, and other patients can carry out more positive treatment.Construction force evolution mathematical model can determine personalized cancer therapeutic regimen further.
K-ras is a kind of proto-oncogene, is about 35kb, is positioned at No. 12 karyomit(e)s, is one of RAS gene family member, encoded K-ras albumen, all has relation with the generation of tumour, propagation, migration, diffusion and vasculogenesis.The gene that K-ras gene (K-ras, p21) family is relevant to human tumor has three kinds---and H-ras, K-ras and N-ras, be positioned on 11,12 and No. 1 karyomit(e)s respectively.K-ras gene has another name called p21 gene because of the ras albumen of 21kD of encoding.In ras gene, KRAS has the greatest impact to human cancer, and it is as molecular switch: the path that can control regulating cell growth when normal; When occurring abnormal, then cause cell continued propagation, and stop cell self-destructive.It participates in intracellular signal transmission, and when KRAS gene mutation, this gene forever activates, and can not produce normal ras albumen, makes Cellular Signaling Transduction Mediated disorderly, uncontrolled cellular proliferation and canceration.Research shows that the human malignancies of about 30% is relevant with RAS transgenation, and the product after ras sudden change can be in active state always.In leukemia, lung cancer, the rectum cancer and carcinoma of the pancreas, KRAS is all very common, and wherein in the rectum cancer, 30%-35% patient has sudden change.The existence of itself and tumour cell, propagation, migration, diffusion and vasculogenesis all have relation.KRAS gene is divided into saltant type and wild-type, common mutations site is, on No. 12 codons of KRAS gene 2 exon and No. 13 codons, wherein have 7 mutantional hotspot: G12C (GGT>TGT), G12R (GGT>AGT), G12S (GGT>CGT), G12V (GGT>GTT), G12D (GGT>GAT), G12A (GGT>GCT), G13D (GGC>GAC).These 7 kinds of sudden changes have accounted for more than 90%.
Detect KRAS gene mutation be understand in depth oncogene situation, understand the development prognosis of various cancer, the important indicator of chemicotherapy curative effect.On July 20th, 2009, U.S. food Drug Administration (FDA) discloses the revision to EGF-R ELISA (EGFR) targeted drug working instructions, wherein clearly set forth the EGFR acceptor inhibitor drug effect for associated cancer treatment and KRAS gene Close relation, and carry out KRAS gene mutation detection before requiring to use such medicine to help doctor to judge applicable crowd.The dimension gram that FDA this time have updated the production of Amgen company is replaced than (Vectibix, Victibix Panitumumab) and ImClone company produce Erbitux (Erbitux, Cetuximab Cetuximab) package insert in " instruction manual " and " clinical study " part.If 12 or 13 codons indicating KRAS gene in patient tumors cell are undergone mutation, so this patient would not benefit from the treatment of EGFR inhibitor class medicine, so do not recommend the patient that KRAS gene mutation occurs to use this type of medicine.Meanwhile, Ministry of Health of the People's Republic of China has delivered " colorectal cancer diagnosis and treatment specification (2010 editions) " (defend do doctor political affairs send out (2010) No. 165) on October 14th, 2010.Specification is pointed out, carries out the diagnosis and treatment of early stage disease medication gene screening and occur for prevention colorectal cancer, prevent from playing an important role to advanced stages, treatment and reduction colorectal cancer mortality ratio in crowd.This specification explicitly points out when patient is defined as recurrence or metastatic colorectal carcinoma accepts Erbitux, Victibix, must detect the K-ras gene appearance of tumor tissues.Now in developed countries such as America and Europes, the routine inspection that K-RAS gene test must have been done before having become PATIENTS WITH LARGE BOWEL treatment, be current doctor understand colorectal cancer patients gene status the most directly, most effective means, and become the foundation can submitting an expense account relevant anti-EGFR medical expense.
Carry out generation order-checking for patient tissue sample, carrying out medication guide based on this result is current general scheme.But in actual clinical therapeutic process, observe after adopting Cetuximab to treat for some time to the patient of KRAS gene wild-type and occur resistance.How does this resistance produce? now there are some researches show that cancer may come from somatic mutation, cancer gene is constantly accumulated in mutant cells, and the latter also completes self evolution gradually.The genomics research of single cell is the emphasis of cancer Study on Evolution to have investigator to think, it can crack order and the time of cancer sudden change, and for people understand, cancer is suddenlyd change, the mechanism of resistance provides good thinking.But we think the complex system that unicellular order-checking can not help us to understand and the specific characteristic of resolving individual patient is formed.The qualification mode of conventional sequencing and typing cannot reach high-sensitivity detection to the low ratio sudden change mixing mutational site generation in sample, more accurate quantification cannot be reached, and under " natural pressure " of chemicotherapy, in this " adaptability situation ", some extremely low sudden change temporarily increases along with tumour progression, and this " convergent evolution " result in the generation of resistance just.There is investigator to think and determine personalized cancer therapeutic regimen by power mathematical model of evolving.Doctor repeatedly can not obtain tissue samples for same patient, therefore by peripheral blood carry out nothing wound or Wicresoft become inevitable choice.And the present invention will provide effective guidance program for this reason.
Summary of the invention
The invention discloses a kind of detection method by the two generations high-flux sequence detection KRAS Second Exon transgenation for cycling tumor DNA, to overcome traditional sequencing methods under-sensitive shortcoming.
Specifically, the present invention uses the primer shown in SEQ ID NO:3 and/or 4 to implement described detection method.
Therefore, the invention provides the primer sequence shown in SEQ ID NO:3 and 4.
The present invention also provides a kind of combined sequence, and this combination comprises SEQ ID NO:3 and 4.
The present invention also provides a kind of method detecting KRAS gene mutation in Peripheral Circulation DNA, the method comprises use SEQ ID NO:3 and/or 4 and increases, and check order to amplified production, thus whether 12 and/or 13 codons detecting this KRAS gene exist sudden change.
The present invention also provides a kind of and judges tumour patient, especially large bowel cancer (such as colorectal cancer) the patient method that can benefit from the treatment of EGFR inhibitor class medicine, the method comprises the KRAS gene used in SEQ ID NO:3 and/or 4 amplification peripheral blood in patients Circulating DNA, and check order to amplified production, thus whether 12 and/or 13 codons detecting this KRAS gene exist sudden change; Wherein, if 12 and/or 13 codons of KRAS gene exist sudden change in patient tumors cell, so this patient can not benefit from the treatment of EGFR inhibitor class medicine.
In a specific embodiment, described sudden change is selected from:
(1)G12C(GGT>TGT)；
(2)G12R(GGT>AGT)；
(3)G12S(GGT>CGT)；
(4)G12V(GGT>GTT)；
(5)G12D(GGT>GAT)；
(6) G12A (GGT>GCT); With
(7)G13D(GGC>GAC)。
The present invention also provides a kind of test kit, and this test kit contains the primer sequence shown in SEQ ID NO:3 and/or 4.
Test kit of the present invention can be used for implementing aforesaid method.
Also can containing being applicable to the reagent carrying out PCR in test kit, and primer described in guidance technology librarian use implements the specification sheets of aforesaid method.
The present invention also provides SEQ ID NO:3 and/or 4 preparing the purposes in test kit.Described test kit can be used for:
(1) whether 12 and/or 13 codons detecting KRAS gene in Peripheral Circulation DNA exist sudden change;
(2) judge tumour patient, especially can rectal cancer patient benefit from the treatment of EGFR inhibitor class medicine;
(3) avoid the over-treatment of tumour patient and the impact of potential side effect that brings thereof;
(4) for auxiliary diagnosis leukemia, lung cancer, large bowel cancer (such as colorectal cancer) and carcinoma of the pancreas; With
(5) for detecting the existence of tumour cell, propagation, migration, diffusion and vasculogenesis.
Embodiment
The present invention is based on the detection of KRAS gene mutation in Peripheral Circulation DNA, can judge tumour patient, especially can PATIENTS WITH LARGE BOWEL (as colorectal cancer patients) benefit from the treatment of EGFR inhibitor class medicine.
The present invention uses the primer shown in SEQ ID NO:3 and/or 4 to carry out the detection of KRAS gene mutation in described Peripheral Circulation DNA.Preferably, the present invention uses the primer shown in SEQ ID NO:3 and 4 to carry out described detection.
Detection generally includes and uses SEQ ID NO:3 and/or 4 to increase, and checks order to amplified production, thus whether 12 and/or 13 codons detecting this KRAS gene exist sudden change.
If 12 and/or 13 codons of KRAS gene exist sudden change in detected result display patient tumors cell, so this patient can not benefit from the treatment of EGFR inhibitor class medicine.
Described sudden change includes but not limited to following sudden change:
(1)G12C(GGT>TGT)；
(2)G12R(GGT>AGT)；
(3)G12S(GGT>CGT)；
(4)G12V(GGT>GTT)；
(5)G12D(GGT>GAT)；
(6) G12A (GGT>GCT); With
(7)G13D(GGC>GAC)。
EGFR inhibitor class medicine is that this area is known, includes but not limited to that people are in treatment tumour, especially conventional in colorectal cancer various EGFR inhibitor class medicines.This kind of medicine includes but not limited to that the dimension gram that Amgen company produces replaces the Erbitux (Erbitux, Cetuximab Cetuximab) produced than (Vectibix, Victibix Panitumumab) and ImClone company.
Except above-mentioned application, detected result also contributes to people and avoids the over-treatment of tumour patient and the impact of potential side effect that brings thereof; Auxiliary diagnosis leukemia, lung cancer, large bowel cancer and carcinoma of the pancreas; With detect the existence of tumour cell, propagation, migration, diffusion and vasculogenesis.
Sequence of the present invention can provide in various suitable mode, such as composition or test kit.Can containing the various carriers (such as water) for dissolving and/or stablize described sequence in composition.In some cases, sequence also can directly be present in the reaction mixture for carrying out PCR.
Usually, sequence of the present invention is provided in the mode of test kit.Primer sequence in test kit also can provide in the form of compositions.Also can comprise all ingredients carried out needed for PCR in test kit, include but not limited to various required enzyme, damping fluid, dNTP mixture etc.The specification sheets that primer described in guidance technology librarian use implements aforesaid method also can be comprised in test kit.
In the present invention, term " contains " or " comprising " represents that various composition can be applied in mixture of the present invention or composition together.Therefore, term " primarily of ... composition " and " by ... form " be included in term and " contain " or in " comprising ".
As no specific instructions, various raw material of the present invention all can be obtained by commercially available; Or prepare according to the ordinary method of this area.Unless otherwise defined or described herein, all specialties used herein and scientific words and those skilled in the art the same meaning be familiar with.In addition any method similar or impartial to described content and material all can be applicable in the inventive method.
Other aspects of the present invention, due to disclosure herein, are apparent to those skilled in the art.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, measures according to national standard usually.If there is no corresponding national standard, then according to general international standard, normal condition or carry out according to the condition that manufacturer advises.
Embodiment 1
SEQ ID NO:1-4 of the present invention is synthesized by Sangon Biotech (Shanghai) Co., Ltd..
Embodiment 2
The KRAS Second Exon of 18 routine Colonic Carcinoma tissues and pairing Circulating DNA checks order on ABI 3730 sequenator.We collect the colorectal cancer frozen tissue of 18 example operation in 2014, and tissue DNA is adopted in extracting; Extracting patient peripheral blood, separated plasma, and take out tumour and carry Circulating DNA.Obtain SEQ ID NO:5 by primer 1,2 and detect product (PCR reaction conditions 95 DEG C of 15min; 94 DEG C of 30s, 62 DEG C of 30s, 72 DEG C of 30s, 12 take turns, and often take turns-0.5 DEG C; 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 30s, 28 take turns; 72 DEG C of 7min, 4 DEG C of ∞).Purified pcr product, ABI 3730 sequenator checks order, and carries out sequencing result and compare.
We find in tumor tissues, have 8 routine samples to undergo mutation, and find 3 example sudden changes in Circulating DNA.The two overall concordance rate reaches 83.3%, positive sample concordance rate 37.5%, and relation conefficient is 0.5 (table 1).
Table 1: based on generation order-checking tumor tissues and Circulating DNA results contrast
* relation conefficient remarkable (two tail) in 0.05 level.R is Pearson correlation coefficient.Boldface type is designated sudden change.
Embodiment 3
Adopt with the identical sample of case study on implementation 2, obtain SEQ ID NO:5 by primer 3,4, electrophoresis detection product, adopt AMPure XP beads (magnetic bead) purifying, carry out DNA accurate quantification with PicoGreen fluorescence dye; Add index joint:
index Kit-PCR primers (FC-121-1012, FC-121-1011), carries out secondary PCR reaction, again adopt AMPure XP beads (magnetic bead) purifying, carry out DNA accurate quantification with PicoGreen fluorescence dye, be diluted to 0.015nM, 1ul sample loading.MiSeq sequenator carries out high depth order-checking to PCR primer; And carry out data results.
We find in tumor tissues, have 8 routine samples to undergo mutation, and in Circulating DNA, find 7 example sudden changes, the two overall concordance rate reaches 94.4%, positive sample concordance rate 87.5%, and relation conefficient is 0.892 (table 2).
Table 2: based on two generations order-checking tumor tissues and Circulating DNA results contrast
* relation conefficient is remarkable (two tail) in 0.01 level.R is Pearson correlation coefficient.Boldface type is designated sudden change.
Embodiment 4
18 routine Colonic Carcinomas organize KRAS Second Exon to compare at MiSeq sequencing result (experimental technique is with embodiment 3) with 18 routine Colonic Carcinoma tissues and Peripheral Circulation DNA at ABI 3730 sequencing result (experimental technique is with embodiment 2).
18 routine Colonic Carcinomas are organized in ABI 3730 sequencing result and MiSeq sequencing result concordance rate reaches 100%, 8 routine samples are had to undergo mutation in 18 routine Colonic Carcinoma tissues, 7 example sudden changes are found in Circulating DNA, the two overall concordance rate reaches 94.4%, positive sample concordance rate 87.5%, relation conefficient is 0.892 (table 3).
Table 3: tumor tissues generation sequencing result compares with Circulating DNA two generation sequencing result
* relation conefficient is remarkable (two tail) in 0.01 level.R is Pearson correlation coefficient.Boldface type is designated sudden change.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. be selected from following sequence:
(1) tcgtcggcagcgtcagatgtgtataagagacaggcctgctgaaaatgactgaa (SEQ IDNO:3); With
(2)gtctcgtgggctcggagatgtgtataagagacagagaatggtcctgcaccagtaa(SEQID NO:4)。
2. one group of sequence, it comprises:
(1) tcgtcggcagcgtcagatgtgtataagagacaggcctgctgaaaatgactgaa (SEQ IDNO:3); With
(2)gtctcgtgggctcggagatgtgtataagagacagagaatggtcctgcaccagtaa(SEQID NO:4)。
3. a test kit, is characterized in that, described test kit comprises sequence according to claim 1 or one group of sequence according to claim 2.
4. test kit as claimed in claim 3, is characterized in that, described test kit is also containing the reagent carried out needed for PCR, and primer described in guidance technology librarian use implements the specification sheets of aforesaid method.
5. the test kit as described in claim 3 or 4, is characterized in that, described test kit is used for:
(1) whether 12 and/or 13 codons detecting KRAS gene in Peripheral Circulation DNA exist sudden change;
(2) judge tumour patient, especially can PATIENTS WITH LARGE BOWEL benefit from the treatment of EGFR inhibitor class medicine;
(3) avoid the over-treatment of tumour patient and the impact of potential side effect that brings thereof;
(4) for auxiliary diagnosis leukemia, lung cancer, large bowel cancer and carcinoma of the pancreas; With
(5) for detecting the existence of tumour cell, propagation, migration, diffusion and vasculogenesis.
6. sequence according to claim 1 or one group of sequence according to claim 2 are preparing the purposes in test kit, and wherein, described test kit is used for:
(1) whether 12 and/or 13 codons detecting KRAS gene in Peripheral Circulation DNA exist sudden change;
(2) judge tumour patient, especially can PATIENTS WITH LARGE BOWEL benefit from the treatment of EGFR inhibitor class medicine;
(3) avoid the over-treatment of tumour patient and the impact of potential side effect that brings thereof;
(4) for auxiliary diagnosis leukemia, lung cancer, large bowel cancer and carcinoma of the pancreas; With
(5) for detecting the existence of tumour cell, propagation, migration, diffusion and vasculogenesis.
7. purposes as claimed in claim 6, is characterized in that, described test kit is also containing the reagent carried out needed for PCR, and primer described in guidance technology librarian use implements the specification sheets of aforesaid method.
8. sequence according to claim 1 or the purposes of one group of sequence according to claim 2 in the reagent for the preparation of following application, wherein, described application comprises:
(1) whether 12 and/or 13 codons detecting KRAS gene in Peripheral Circulation DNA exist sudden change;
(2) judge tumour patient, especially can PATIENTS WITH LARGE BOWEL benefit from the treatment of EGFR inhibitor class medicine;
(3) avoid the over-treatment of tumour patient and the impact of potential side effect that brings thereof;
(4) auxiliary diagnosis leukemia, lung cancer, large bowel cancer and carcinoma of the pancreas; With
(5) existence of tumour cell, propagation, migration, diffusion and vasculogenesis is detected.
9. test kit as claimed in claim 5 or the purposes according to any one of claim 6-8, it is characterized in that, described sudden change is selected from:
(1)G12C(GGT>TGT)；
(2)G12R(GGT>AGT)；
(3)G12S(GGT>CGT)；
(4)G12V(GGT>GTT)；
(5)G12D(GGT>GAT)；
(6) G12A (GGT>GCT); With
(7)G13D(GGC>GAC)。
10. the composition detected, is characterized in that, said composition contains sequence according to claim 1, or one group of sequence according to claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510185937.5A CN104762399A (en) | 2015-04-17 | 2015-04-17 | Tumor circulating DNA KRAS mutation detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510185937.5A CN104762399A (en) | 2015-04-17 | 2015-04-17 | Tumor circulating DNA KRAS mutation detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104762399A true CN104762399A (en) | 2015-07-08 |
Family
ID=53644489
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510185937.5A Pending CN104762399A (en) | 2015-04-17 | 2015-04-17 | Tumor circulating DNA KRAS mutation detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104762399A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520963A (en) * | 2016-11-18 | 2017-03-22 | 埃提斯生物技术（上海）有限公司 | Capturing probe and kit for high-throughput sequencing detection of human circulating tumor DNA KRAS gene |
| CN107151706A (en) * | 2017-06-27 | 2017-09-12 | 郴州市第人民医院 | The kit and method of KRAS gene mutation in a kind of detection plasma DNA |
| CN107164543A (en) * | 2017-06-16 | 2017-09-15 | 上海长海医院 | KRAS as biomarker in cancer of pancreas purposes |
| CN108137642A (en) * | 2015-09-25 | 2018-06-08 | 语境基因组学有限公司 | Application of the molecular mass ensuring method in sequencing |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010014920A1 (en) * | 2008-07-31 | 2010-02-04 | The Johns Hopkins University | Circulating mutant dna to assess tumor dynamics |
| EP2426217A1 (en) * | 2010-09-03 | 2012-03-07 | Centre National de la Recherche Scientifique (CNRS) | Analytical methods for cell free nucleic acids and applications |
| CN103160581A (en) * | 2013-03-07 | 2013-06-19 | 宋现让 | ctDNA content and integrity determination method by taking 18 SrRNA gene as determination object |
| WO2013138510A1 (en) * | 2012-03-13 | 2013-09-19 | Patel Abhijit Ajit | Measurement of nucleic acid variants using highly-multiplexed error-suppressed deep sequencing |
| WO2014201092A1 (en) * | 2013-06-11 | 2014-12-18 | Dana-Farber Cancer Institute, Inc. | Non-invasive blood based monitoring of genomic alterations in cancer |
-
2015
- 2015-04-17 CN CN201510185937.5A patent/CN104762399A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010014920A1 (en) * | 2008-07-31 | 2010-02-04 | The Johns Hopkins University | Circulating mutant dna to assess tumor dynamics |
| EP2426217A1 (en) * | 2010-09-03 | 2012-03-07 | Centre National de la Recherche Scientifique (CNRS) | Analytical methods for cell free nucleic acids and applications |
| WO2013138510A1 (en) * | 2012-03-13 | 2013-09-19 | Patel Abhijit Ajit | Measurement of nucleic acid variants using highly-multiplexed error-suppressed deep sequencing |
| CN103160581A (en) * | 2013-03-07 | 2013-06-19 | 宋现让 | ctDNA content and integrity determination method by taking 18 SrRNA gene as determination object |
| WO2014201092A1 (en) * | 2013-06-11 | 2014-12-18 | Dana-Farber Cancer Institute, Inc. | Non-invasive blood based monitoring of genomic alterations in cancer |
Non-Patent Citations (2)
| Title |
|---|
| NEWMAN AM，等: "《An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage》", 《NAT MED》 * |
| 蒋微琴: "《循环游离核酸在结直肠癌中的临床应用研究》", 《中国博士学位论文全文数据库(电子期刊)医药卫生科技辑》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108137642A (en) * | 2015-09-25 | 2018-06-08 | 语境基因组学有限公司 | Application of the molecular mass ensuring method in sequencing |
| EP3356382A4 (en) * | 2015-09-25 | 2019-04-03 | Contextual Genomics Inc. | Molecular quality assurance methods for use in sequencing |
| US10934580B2 (en) | 2015-09-25 | 2021-03-02 | Canexia Health Inc. | Molecular quality assurance methods for use in sequencing |
| CN106520963A (en) * | 2016-11-18 | 2017-03-22 | 埃提斯生物技术（上海）有限公司 | Capturing probe and kit for high-throughput sequencing detection of human circulating tumor DNA KRAS gene |
| CN107164543A (en) * | 2017-06-16 | 2017-09-15 | 上海长海医院 | KRAS as biomarker in cancer of pancreas purposes |
| CN107151706A (en) * | 2017-06-27 | 2017-09-12 | 郴州市第人民医院 | The kit and method of KRAS gene mutation in a kind of detection plasma DNA |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dinu et al. | Prognostic significance of KRAS gene mutations in colorectal cancer-preliminary study | |
| CN104099422B (en) | A kind of compoistion and method of use detecting intestinal cancer focus gene mutation site | |
| Chung et al. | Epidermal growth factor receptor mutation and pathologic-radiologic correlation between multiple lung nodules with ground-glass opacity differentiates multicentric origin from intrapulmonary spread | |
| Sefrioui et al. | Clinical value of chip-based digital-PCR platform for the detection of circulating DNA in metastatic colorectal cancer | |
| CN107419018A (en) | A kind of method and kit based on Blocker primers and ARMS primer detection gene mutations | |
| Frumovitz et al. | Sequencing of mutational hotspots in cancer-related genes in small cell neuroendocrine cervical cancer | |
| Dobre et al. | KRAS gene mutations prognostic factor in colorectal cancer | |
| CN104762399A (en) | Tumor circulating DNA KRAS mutation detection method | |
| Zhang et al. | A propensity score-matched case-control comparative study of laparoscopic and open gastrectomy for locally advanced gastric carcinoma | |
| Terada | Mutations and protein expression of KIT and PDGFRA genes in ipsilateral testicular seminomas: an immunohistochemical and molecular genetic study | |
| CN108220444A (en) | A kind of primer combination of probe of KRAS gene mutation detection and its application | |
| Yoon et al. | Comprehensive cancer panel sequencing defines genetic diversity and changes in the mutational characteristics of pancreatic cancer patients receiving neoadjuvant treatment | |
| CN105463111A (en) | Primers and probes and kit for detecting five mutation types of human PIK3CA gene | |
| CN107385066B (en) | Primer pair, kit, detection method and application for detecting EGFR gene mutation | |
| Nakagomi et al. | Rapid changes in circulating tumor DNA in serially sampled plasma during treatment of breast cancer: a case report | |
| CN107354197B (en) | Kit for detecting human NRAS gene mutation | |
| Korpanty et al. | Association of BRM promoter polymorphisms and esophageal adenocarcinoma outcome | |
| KR101720050B1 (en) | Lung Cancer Diagnotic kit comprising primer set and probe for mutation related to lung cancer | |
| Yan et al. | Comparative study of mutations in SNP loci of K-RAS, hMLH1 and hMSH2 genes in neoplastic intestinal polyps and colorectal cancer | |
| JP2023507796A (en) | Multiplex assay using different fragment sizes to identify cancer-specific cell-free DNA | |
| CN107385097B (en) | Detect the kit of SMAD4 gene V354L site mutations | |
| Wan et al. | Loss of heterozygosity of Kras2 gene on 12p12-13 in Chinese colon carcinoma patients | |
| Delsupehe et al. | Novel gene fusion discovery in Spitz tumours and its relevance in diagnostics | |
| Tian et al. | Microsatellite alteration in plasma DNA discriminates multiple primary lung cancer from metastatic lung cancer | |
| Miyasaka et al. | Pks‐positive Escherichia coli in tumor tissue and surrounding normal mucosal tissue of colorectal cancer patients |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150708 |
|
| RJ01 | Rejection of invention patent application after publication |