CN107353324B - Polypeptide combined with avian leukosis virus p27 protein and application thereof - Google Patents
Polypeptide combined with avian leukosis virus p27 protein and application thereof Download PDFInfo
- Publication number
- CN107353324B CN107353324B CN201710542510.5A CN201710542510A CN107353324B CN 107353324 B CN107353324 B CN 107353324B CN 201710542510 A CN201710542510 A CN 201710542510A CN 107353324 B CN107353324 B CN 107353324B
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- protein
- avian leukosis
- virus
- leukosis virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
Abstract
The invention discloses a polypeptide combined with avian leukosis virus p27 protein and application thereof, wherein the polypeptide is a linear combination polypeptide, and the amino acid sequence contained in the polypeptide is as follows: NNSVSMN. The polypeptide has simple structure, easy synthesis and preparation, can be combined with cell culture ALV, tissue separation ALV and artificial synthesis p27 protein, does not react with other viruses, has higher specificity, and has simpler and more convenient process and easier operation compared with a detection method based on the polypeptide for immunizing by target protein to obtain a protein antibody; by marking the polypeptide, the avian leukosis virus p27 protein can be rapidly detected qualitatively and quantitatively.
Description
Technical Field
The invention relates to the technical field of virus detection, in particular to a polypeptide combined with avian leukosis virus p27 protein and application thereof.
Background
Avian Leukemia Virus (ALV) is a tumorigenic virus that is transmitted vertically mainly through the hatching eggs of breeders. It mainly causes the slow growth of infected chickens, the reduction of production performances such as laying rate and fertilization rate, and tumorigenesis; and simultaneously can cause immunosuppression of infected chickens. The disease occurs all over the world, and local breeder chickens in China tend to spread, which can directly cause difficulty in operating breeder farms. ALV is a retrovirus whose genome is a single-stranded RNA and is divided into 10 subgroups, A to J. The p27 gene is a highly conserved gene between different subgroups of avian leukosis viruses. The p27 protein is the main component of the virus core shell, has high content, accounts for more than 30 percent of the total virus protein component, has a plurality of virus antigen sites which are easy to detect, and is the first choice antigen for preparing group specific antibodies.
However, the avian leukosis virus has high culture requirements and great purification difficulty, so that the preparation of the antibody of the virus is very difficult, and the detection method based on the virus is difficult to popularize and apply.
Disclosure of Invention
The technical problem to be solved by the invention is to provide a polypeptide capable of being specifically combined with avian leukosis virus p27 protein, which has the advantages of simple structure, good affinity with p27 protein, high specificity, easy artificial synthesis and preparation, low detection cost and capability of being used for quantitative and qualitative detection of avian leukosis virus antigen.
In order to solve the technical problems, the invention researches and utilizes a phage peptide library display technology, takes prokaryotic expression purified avian leukosis virus p27 protein as target protein, obtains a phage capable of specifically binding avian leukosis virus p27 protein through multiple rounds of screening, and performs sequence determination after amplification culture, wherein the polypeptide sequence is NNSVSMN; the result of ELISA combination experiment of artificially synthesized polypeptide shows that the artificially synthesized polypeptide has excellent binding capacity to fowl leukemia virus p27 protein.
The polypeptide sequence is a linear binding polypeptide.
The polypeptide sequence includes any extension and modification of the polypeptide sequence by using the polypeptide sequence as a core, and modified materials include but are not limited to fluorescent materials, biotin, enzymes, nano materials and specific proteins.
The polynucleotide for coding the polypeptide has the nucleotide sequence as follows:
(a) as shown in SEQ ID NO. 2; or is
(b) A sequence complementary to the nucleotide sequence (a).
Constructing a phage comprising the polypeptide or the polynucleotide.
Constructing a genetically engineered host cell comprising the selected phage.
The polypeptide sequence is used for p27 protein of avian leukosis virus, including but not limited to enzyme-linked immunosorbent assay.
The polypeptide sequence is applied to quantitative and qualitative detection of avian leukosis virus antigen. The polypeptide can also be used as a base to prepare a kit for detecting the avian leukosis virus.
The invention has the positive and beneficial technical effects that:
(1) the invention utilizes phage peptide library screening technology, and finally obtains polypeptide phage capable of specifically binding avian leukosis virus p27 protein through multiple rounds of combination screening with prokaryotic expression purified avian leukosis p27 protein; performing sequence determination after amplification culture, wherein the core sequence of the polypeptide is NNSVSMN; the polypeptide is artificially synthesized to carry out ELISA combination experiments, and the result shows that the artificially synthesized polypeptide can be well combined with the avian leukosis virus p27 protein; the affinity constant of the polypeptide of the invention and the p27 protein can reach 2.91 multiplied by 109L/mol, the affinity is better.
(2) The avian leukosis virus has high culture requirement and great purification difficulty, so that the antibody for preparing the virus is very difficult, the designed and synthesized polypeptide well avoids the problem, can be quickly obtained by a manual synthesis method, and has low detection cost.
(3) The artificially synthesized polypeptide can be combined with cell culture ALV, tissue separation ALV and artificially synthesized p27 protein, and has no reaction with other viruses and high specificity.
(4) Compared with the process of obtaining protein antibodies by immunizing target proteins, the detection method based on the polypeptide is simple and convenient and is easier to operate; by marking the polypeptide, the avian leukosis virus p27 protein can be rapidly detected qualitatively and quantitatively.
Drawings
FIG. 1 is a graph showing the comparison of the results of cell culture of avian leukosis virus and prokaryotic expression of p27 protein using the polypeptide assay.
On the abscissa of the graph, 1 is an avian leukemia virus inoculated DF-1 cell, 2 is prokaryotic expression avian leukemia p27 protein, and 3 is a DF-1 cell control; the ordinate represents the OD value.
FIG. 2 is a graph comparing the results of cross-reactivity with other viruses using the polypeptides of the present invention.
The abscissa in the figure is different viruses to be detected of various virus cell culture coated ELISA plates; the ordinate represents the OD value.
Detailed Description
The following examples are intended to illustrate the present invention in detail and should not be construed as limiting the scope of the present invention in any way.
The instruments and devices referred to in the following examples are conventional instruments and devices unless otherwise specified; the related biochemical reagents or raw materials are conventional commercial products if not specifically stated; the detection or test methods involved are conventional methods unless otherwise specified.
Example 1: screening of phage random peptide libraries
Phage random peptide libraries are an important branch of phage display technology. Peptide libraries are recombinant phage libraries consisting of a large number of individual phages with different peptide stretches. When the recombinant phage is subjected to progeny reassembly, the polypeptide sequence of the recombinant phage is displayed on the surface of the phage, and the displayed polypeptide has a certain spatial structure and biological activity and can be combined with a corresponding target protein. After the target protein is combined with the displayed peptide library, the bacteriophage which is not combined is eluted, then the bacteriophage which is combined with the target protein is eluted to infect host bacteria for amplification, and the specific recombinant bacteriophage which is combined with the target protein can be enriched through 3 to 6 rounds of 'adsorption-elution-amplification'; through sequencing analysis, a polypeptide structure and a sequence (shown as SEQ ID NO. 1) specifically combined with the target protein can be obtained.
In this case, polyethylene plates were coated with purified expressed ALV p27 protein at 100. mu.L per well (100. mu.g/mL) under sterile conditions, incubated overnight at 4 ℃ to remove the coating and blocked with 5% BSA for at least 8 hours at 4 ℃.
The blocking solution was removed and 100. mu.L (about 1X 10) of the solution was added11The amount of the phage peptide library (Ph.D. -7 phage display peptide library kit is a product of NEB company) is added into a corresponding hole, the temperature is kept at room temperature for 60 min by mild shaking, 250 mu L of TBST washing solution is added into each hole, and the washing is carried out for 5-8 times; mu.L of the eluate was added to the wells, gently shaken at room temperature for 10 min, the eluate was aspirated, and neutralized to neutrality with 15. mu.L of 1M Tris-HCl (pH 9.1).
The neutralized eluent is used for titer determination and amplification culture; the phage after LLB culture is precipitated, collected by centrifugation and used for the next round of screening.
The phage enrichment identification of different screening rounds is shown in table 1, and the titer determination result of the eluent is shown in table 2.
Example 2 identification of screening polypeptides
(1) The inoculated DF-1 cells of avian leukemia virus (purchased from Shanghai Jinnin Biotech Co., Ltd.) were subjected to ultrasonication and then coated with ELISA at 2. mu.g/mL (protein amount); prokaryotic expression of avian leukemia virus p27 protein and uninoculated DF-1 were coated in the same manner as controls. In specific assays, different viral proteins are coated.
(2) Adding the artificially synthesized polypeptide NNSVSMN coupled with horseradish peroxidase in an amount of 100 ng/mL into the ELISA plate, wherein each well is 50 mu L, uniformly mixing on an oscillator, and incubating for 30min at 37 ℃ in a dark place;
(3) washing with an ELISA plate washing machine for 3 times, filling each hole with diluted buffer solution, spin-drying, and repeating the washing for 3 times;
(4) adding TMB solution into corresponding holes according to the required dosage, wherein each hole is 100 μ L, oscillating on an oscillator for 30 s, and developing at room temperature for 10 min;
(5) the reaction was stopped by adding 50. mu.L of 3M sodium hydroxide to each well, followed by shaking on a shaker for 30 seconds, and then the absorbance at 450 nm of each well was read with a microplate reader to determine the result.
The result shows that the artificially synthesized polypeptide can be combined with cell inoculation ALV and prokaryotic expression ALV p27 protein (see figure 1), has no reaction with other viruses and has high specificity (see figure 2).
EXAMPLE 3 screening for polypeptide affinity identification
(1) The inoculated DF-1 cell culture solution of the avian leukosis virus is subjected to ultrasonic disruption and then ELISA coating is carried out at 2 mug/mL (protein amount); prokaryotic expression of avian leukemia virus p27 protein and uninoculated DF-1 were coated in the same manner as controls. In specific assays, different viral proteins are coated.
(2) Adding artificially synthesized polypeptide NNSVSMN coupled with horseradish peroxidase (coupled by adopting a commercial coupling kit) into the ELISA plate at the amount of 100 ng/mL, uniformly mixing on an oscillator at the volume of 50 mu L per hole, and incubating for 30min at 37 ℃ in a dark place;
(3) washing with an ELISA plate washing machine for 5 times, filling each hole with diluted buffer solution, spin-drying, and repeating the washing for 5 times;
(4) adding TMB solution into corresponding holes according to the required dosage, wherein each hole is 100 μ L, oscillating on an oscillator for 30 s, and developing at room temperature for 10 min;
(5) the reaction was stopped by adding 50. mu.L of 2M sulfuric acid to each well, followed by shaking on a shaker for 30 seconds, and then the absorbance at 450 nm of each well was read with a microplate reader to determine the result.
Finally, the affinity constant of the polypeptide and the virus is calculated by analyzing through a Scatchard equation and calculating the concentration of the enzyme-labeled polypeptide, wherein Ka = P1/AP2(wherein P is1Refers to the concentration of the polypeptide bound to the antigen, A refers to the antigen concentration, P2Refers to unbound polypeptide concentration). The affinity constant of the polypeptide obtained by the invention and the p27 protein can reach 3.26 multiplied by 10 through calculation9L/mol, indicating that the affinity is better.
SEQUENCE LISTING
<110> Henan animal husbandry economic school
<120> polypeptide combined with avian leukosis virus p27 protein and application thereof
<130>/
<160>2
<170>PatentIn version 3.2
<210>1
<211>7
<212>PRT
<213> birds
<400>1
Asn Asn Ser Val Ser Met Asn
1 5
<210>2
<211>21
<212>DNA
<213> birds
<400>2
aataatagtg tttcgatgaa t 21
Claims (5)
1. A polypeptide that binds to avian leukosis virus p27 protein, wherein the polypeptide consists of the amino acid sequence:
NNSVSMN。
2. a polynucleotide encoding the polypeptide of claim 1, wherein the nucleotide sequence is:
(a) AATAATAGTGTTTCGATGAAT, respectively; or is
(b) A nucleotide sequence complementary to (a).
3. A bacteriophage comprising the polypeptide of claim 1 or the polynucleotide of claim 2.
4. A genetically engineered host cell comprising the bacteriophage of claim 3.
5. A kit for detecting avian leukemia virus, comprising the polypeptide of claim 1 which binds to avian leukemia virus p27 protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710542510.5A CN107353324B (en) | 2017-07-05 | 2017-07-05 | Polypeptide combined with avian leukosis virus p27 protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710542510.5A CN107353324B (en) | 2017-07-05 | 2017-07-05 | Polypeptide combined with avian leukosis virus p27 protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107353324A CN107353324A (en) | 2017-11-17 |
| CN107353324B true CN107353324B (en) | 2020-05-15 |
Family
ID=60291797
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710542510.5A Active CN107353324B (en) | 2017-07-05 | 2017-07-05 | Polypeptide combined with avian leukosis virus p27 protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107353324B (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102876675A (en) * | 2012-06-20 | 2013-01-16 | 韩健宝 | Peptide nucleic acid for subgroup J avian leukosis viruses and application of peptide nucleic acid |
| CN104597256A (en) * | 2015-02-14 | 2015-05-06 | 河南省农业科学院 | Polypeptide sequence combined with bovine viral diarrhea E2 protein and application of polypeptide sequence |
| CN104650185A (en) * | 2015-02-14 | 2015-05-27 | 河南省农业科学院 | Polypeptide sequence bound with swine fever E0 protein and application thereof |
| CN105085621A (en) * | 2015-08-14 | 2015-11-25 | 郑州大学 | Polypeptide combined with Japanese encephalitis virus envelope protein and application of polypeptide |
| CN105085640A (en) * | 2015-07-03 | 2015-11-25 | 山东农业大学 | PEG (Polyethylene Glycol) modification based subgroup J avian leukemia virus (ALV-J) immunosuppressive polypeptide |
| CN106442982A (en) * | 2016-08-31 | 2017-02-22 | 扬州大学 | Fowl leucovirus subgroup J specific antigenic polypeptide and application thereof |
| CN106866797A (en) * | 2017-03-24 | 2017-06-20 | 中国农业大学 | J subgroup avian leucosis virus specific antigen epitope, fusion protein, specific antibody and its application |
| CN106866798A (en) * | 2017-03-24 | 2017-06-20 | 中国农业大学 | J subgroup avian leucosis virus specific antigen epitope, fusion protein, specific antibody and its application |
-
2017
- 2017-07-05 CN CN201710542510.5A patent/CN107353324B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102876675A (en) * | 2012-06-20 | 2013-01-16 | 韩健宝 | Peptide nucleic acid for subgroup J avian leukosis viruses and application of peptide nucleic acid |
| CN104597256A (en) * | 2015-02-14 | 2015-05-06 | 河南省农业科学院 | Polypeptide sequence combined with bovine viral diarrhea E2 protein and application of polypeptide sequence |
| CN104650185A (en) * | 2015-02-14 | 2015-05-27 | 河南省农业科学院 | Polypeptide sequence bound with swine fever E0 protein and application thereof |
| CN105085640A (en) * | 2015-07-03 | 2015-11-25 | 山东农业大学 | PEG (Polyethylene Glycol) modification based subgroup J avian leukemia virus (ALV-J) immunosuppressive polypeptide |
| CN105085621A (en) * | 2015-08-14 | 2015-11-25 | 郑州大学 | Polypeptide combined with Japanese encephalitis virus envelope protein and application of polypeptide |
| CN106442982A (en) * | 2016-08-31 | 2017-02-22 | 扬州大学 | Fowl leucovirus subgroup J specific antigenic polypeptide and application thereof |
| CN106866797A (en) * | 2017-03-24 | 2017-06-20 | 中国农业大学 | J subgroup avian leucosis virus specific antigen epitope, fusion protein, specific antibody and its application |
| CN106866798A (en) * | 2017-03-24 | 2017-06-20 | 中国农业大学 | J subgroup avian leucosis virus specific antigen epitope, fusion protein, specific antibody and its application |
Non-Patent Citations (3)
| Title |
|---|
| Application of monoclonal antibodies in the avian leukosis virus GS‐antigen ELISA;G.F. De Boer 等;《Avian Pathology》;19851231;第14卷;第39-55页 * |
| Identification of a linear B-cell epitope on the avian leukosis virus P27 protein using monoclonal antibodies;Xiaofei Li 等;《Archives of Virology》;20160720;第161卷;第2871-2877页 * |
| Identification of a novel linear B-cell epitope in the p27 of Avian leukosis virus;Wiaam O. A. Khairy 等;《Virus Research》;20170615;第238卷;第253-257页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107353324A (en) | 2017-11-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111995676A (en) | Monoclonal antibody aiming at non-RBD (radial basis function) region of new coronavirus spike protein and application thereof | |
| CN111537712B (en) | Inert carrier indirect agglutination test detection system and application thereof | |
| CN114736292B (en) | Nano antibody targeting norovirus protein and application thereof | |
| CN111269318A (en) | GAPDH (gamma-GAPDH) nano antibody and application thereof | |
| CN112457397A (en) | Nano antibody of PRRSV N protein and preparation method and application thereof | |
| CN110373393B (en) | Hybridoma cell strain 1H6 secreting monoclonal antibody against infectious bursal disease virus VP2 protein | |
| CN104991061B (en) | Peste des petits ruminant virus antibody detection kit based on IPMA | |
| CN110244039B (en) | ELISA kit for detecting J subgroup avian leukosis virus antibody and application thereof | |
| CN111596070B (en) | Application of portunus trituberculatus tropomyosin allergy detection reagent | |
| CN107353324B (en) | Polypeptide combined with avian leukosis virus p27 protein and application thereof | |
| CN112625133A (en) | CDK2 nano antibody and application thereof | |
| CN106243193B (en) | Polypeptide specifically combined with tuberculosis positive serum and diagnostic kit | |
| CN107219365A (en) | A kind of chemiluminescence detection kit based on foot and mouth disease virus 3B neoepitope Westerns | |
| CN107664694B (en) | A kind of ELISA kit based on E2 Protein Detection pig atypia pestivirus antibody | |
| CN106866797A (en) | J subgroup avian leucosis virus specific antigen epitope, fusion protein, specific antibody and its application | |
| CN108982847B (en) | Indirect ELISA (enzyme-linked immunosorbent assay) detection method for duck reovirus causing duck spleen necrosis | |
| CN114213532B (en) | Preparation and application of high-affinity anti-chicken infectious bursal disease virus scFv antibody | |
| CN112979768B (en) | Antigen composition and kit for detecting mycoplasma synoviae antibody and application thereof | |
| CN110261599B (en) | ELISA kit for detecting A, B subgroup avian leukosis virus antibody and application thereof | |
| CN110386986B (en) | Artificial modified protein and construction method and application thereof | |
| CN106866798A (en) | J subgroup avian leucosis virus specific antigen epitope, fusion protein, specific antibody and its application | |
| CN112979767B (en) | Antigen composition for detecting mycoplasma bovis antibody, kit and application thereof | |
| CN116987194B (en) | Anti-idiotype nano antibody of mimic epitope peptide of human ST2 antigen and application thereof | |
| CN112940081B (en) | Polypeptide molecule capable of specifically binding novel coronavirus nucleocapsid protein and preparation method thereof | |
| KR102266878B1 (en) | Potato leafroll virus Specific Antibody from Human Scfv Antibody Phage Display Library and Uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Ji Xiangbo Inventor after: Li Xinfeng Inventor after: Zhang Guizhi Inventor after: Guan Yanping Inventor after: Chen Zhongwei Inventor after: Xu Hongxia Inventor before: Ji Xiangbo Inventor before: Li Xinfeng Inventor before: Zhang Guizhi Inventor before: Chen Zhongwei Inventor before: Xu Hongxia Inventor before: Guan Yanping |
|
| CB03 | Change of inventor or designer information |