CN107345227A - A kind of the ketone isomerase gene of Δ 53, the carrier comprising the gene and its application - Google Patents

A kind of the ketone isomerase gene of Δ 53, the carrier comprising the gene and its application Download PDF

Info

Publication number
CN107345227A
CN107345227A CN201710564918.2A CN201710564918A CN107345227A CN 107345227 A CN107345227 A CN 107345227A CN 201710564918 A CN201710564918 A CN 201710564918A CN 107345227 A CN107345227 A CN 107345227A
Authority
CN
China
Prior art keywords
ksi228
ketone
gene
bacillus coli
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710564918.2A
Other languages
Chinese (zh)
Other versions
CN107345227B (en
Inventor
阳飞
彭飞
苏正定
贺君
贺一君
系祖斌
卢方欣
张华山
成细瑶
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hubei Gongtong Biotechnology Co ltd
Original Assignee
HUBEI GONGTONG BIOLOGICAL SCIENCE & TECHNOLOGY Co Ltd
Hubei University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by HUBEI GONGTONG BIOLOGICAL SCIENCE & TECHNOLOGY Co Ltd, Hubei University of Technology filed Critical HUBEI GONGTONG BIOLOGICAL SCIENCE & TECHNOLOGY Co Ltd
Priority to CN201710564918.2A priority Critical patent/CN107345227B/en
Publication of CN107345227A publication Critical patent/CN107345227A/en
Application granted granted Critical
Publication of CN107345227B publication Critical patent/CN107345227B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90Isomerases (5.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00Preparation of steroids

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention provides a kind of method of isomerase transformation phytosterin.A kind of ketone isomerase of Δ 53 and the recombinant microorganism for encoding the gene of the enzyme, the expression vector of the ketone isomerase of Δ 53 and utilization carrier conversion, such as engineering strain, and the application of the engineering strain of the ketone isomerase of Δ 53 is provided.

Description

A kind of Δ 5-3- ketones isomerase gene, the carrier comprising the gene and its application
Technical field
The present invention relates to genetic engineering and enzyme engineering field, and in particular to Δ 5-3- ketones isomerase gene, its expression carry Body, the Δ 5-3- ketones isomerase of its expression and its application.
Background technology
Steroid hormone class medicine is the second major class medicine for being only second to antibiotic in the world, has and body is carried out to weigh very much The adjustment effect wanted, be described as the key of life, turn into clinically indispensable medicine, be widely used in anti-inflammatory, Contraception, treatment angiocardiopathy, antitumor, human organ transplant, endocrinopathy and geriatric disease etc..Androstane-4-alkene-3, 17- diketone, abbreviation androstenedione (Androstenedione) (4-AD), molecular formula C19H26O2, it is production steroid hormone class medicine The irreplaceable key intermediate of thing.
Research shows that 4-AD is like the nutritious supplementary pharmaceutical of steroid hormone class compound in vivo, can be used as androgen With the precursor of estrogen, the normal operation of body is maintained by being metabolized generation estrogen and androgen, as in human body to exercise performance very Important testosterone, the half of its content are exactly to be transformed by the outer 4-AD of gland.
In addition, it has been found that 4-AD also has the characteristic of protein anabolic hormone.And in vitro, by largely studying hair It is existing, it can almost produce the steroids such as all cortex hormone of aadrenaline, sex hormone and protein anabolic hormone using 4-AD as initiation material Body hormone medicine, such as it is used to treat canrenone, Puli's ketone and the spirolactone of angiocardiopathy and the property as contraceptive swashs Plain class medicine norethindrone etc., can be produced by 4-AD, industrially have more than 100 to plant with the 4-AD medicines produced at present, 4-AD Turn into the base stock for producing these steroid hormone class medicines, and its application field is also constantly expanding, and not only closes Into conventional steroid hormone class medicine, the research and development and production of new drug are also applied to.
At present, it is that mycobacterium converts production by raw material of phytosterol industrially to prepare steroid drugs 4-AD main paths 4-AD.Because conversion bacterial strain is difficult to screen, target product yield is relatively low and conversion process has middle androstane -1,4- diene -3,17- The generation of diketone (ADD), both chemical constitutions are similar, separate difficulty.Therefore financial cost is higher.
The content of the invention
Because Δ 5-3- ketones isomerase (KSI) can be catalyzed the C5 of Δ 5-3- ketone group steroidal compounds, the transfer of C6 positions double bond To C4, C5 positions, as shown in response diagram 1.Therefore, another method is construction expression Δ 5-3- ketones isomerase (KSI) gene Engineering bacteria.
It is an object of the invention to provide a kind of Δ 5-3- ketone isomerase genes, the Δ 5-3- ketone isomerase genes Expression product, expression vector and KSI are in androstane -5- alkene -3,17- diketone (5-AD) is the efficiently single-minded conversion production 4-AD of substrate Application.
A kind of Δ 5-3- ketone isomerase genes, its nucleotide sequence is as shown in SEQ ID NO.1.
The Δ 5-3- ketone isomerase gene sequences of the present invention are to come from mycobacteria HGMS2GL.By to mycobacteria HGMS2GL genome sequencing, with PCR method extraction Δ 5-3- ketone isomerase gene SEQ ID from genome NO.1.Due to the degeneracy of genetic codon, Δ 5-3- ketone isomerase genes of the invention can also be coding by SEQ ID Other nucleotide sequences of the protein of amino acid sequence composition shown in NO.2.
A kind of encoding proteins matter of said gene, its amino acid sequence is as shown in SEQ ID NO.2.
The Δ 5-3- ketone isomerases of the present invention are not limited only to have the amino acid sequence in sequence table shown in SEQ ID NO.2 The protein of composition is arranged, can also be the amino acid sequence in SEQ ID NO.2 by one or more amino acid residues Substitution, missing or addition and the protein as derived from SEQ ID NO.2 with identical enzymatic activity, such as in N-terminal or C-terminal One or several amino acid are added, such as merged with the amino acid of vector encoded, influence difference on the modified forms of sequence Situation.
A kind of expression vector, include above-mentioned Δ 5-3- ketone isomerase genes.
The expression vector of nucleotide sequence provided by the invention including Δ 5-3- ketone isomerase genes is to use routine side The nucleotide sequence of the Δ 5-3- ketone isomerase genes of the present invention is connected to built-up on various carriers by method, and the carrier can To be commercially available plasmid, clay, bacteriophage or viral vector etc., such as pUC, pET and pGEX, but these carriers are not limited to.
The expression vector is pRSV-KSI228.The present invention is the Δ 5-3- ketone isomerase gene products for expanding PCR KSI228 is connected to obtain recombinant plasmid with expression vector pRSV.The nucleic acid molecules of its ketone isomerase of 5-3- containing coded delta it is complete Encode reading frame sequence.
A kind of Bacillus coli cells, include above-mentioned Δ 5-3- ketone isomerase genes.
Further, the Bacillus coli cells are the E.coli DH5 α for including recombinant plasmid pRSV-KSI228.
Further, the Bacillus coli cells are the E.coliBL21 for including recombinant plasmid pRSV-KSI228.
Recombinant cell provided by the invention, it is the Δ 5-3- ketone isomerase gene nucleotide sequences that will include the present invention Expression vector be transformed into host microorganism, as obtained genetic engineering bacterium in competence e. coli bl21.Wherein, the host is thin Born of the same parents can be protokaryon, eukaryotic microorganisms or insect etc..Preferably Escherichia coli, it is above-mentioned base to obtain corresponding recombinant cell Because of engineered strain.
A kind of method using gene described in above-mentioned recombination bacillus coli high efficient expression, step are:Recombination bacillus coli is thin Born of the same parents are inoculated in the LB liquid medium that 5mL contains kalamycin resistance with 1-2% (V/V) inoculum concentration and cultivated, 37 DEG C, 180- 240rpm, determine OD600Value, until OD600For 0.6-0.8;Then IPTG (isopropylthiogalactoside), the IPTG are added Final concentration of 0.4-1mM, 18 DEG C of Fiber differentiation 12-24h.
Preferred steps are:Recombinant Bacillus coli cells, which with 1% (V/V) inoculum concentration are inoculated in 5mL and contain kanamycins, to be resisted Property LB liquid medium in cultivate, 37 DEG C, 200rpm, determine OD600Value, until OD600For 0.8;Then IPTG is added, it is described IPTG final concentration of 0.4Mm, 18 DEG C of Fiber differentiation 12h.
In methods described, the concentration of the LB liquid medium kanamycins is 30 μ g/mL.
Contain above-mentioned recombinant vector, the nucleotides sequence of coded delta 5-3- ketone isomerases in host cell of the present invention Row, which are operably connected in host cell, causes Δ 5-3- ketone isomerases to give full expression to, so as to impart host born of the same parents by 5- Alkene -3- ketone group steroidal compounds are converted into the ability of 4- alkene -3- ketone group steroidal compounds.
Application of the Δ 5-3- ketone isomerases obtained using recombination bacillus coli in transformation phytosterin.
In the present invention, 4- alkene -3- ketone groups steroidal compounds 5- alkene -3- ketone group steroidal compounds be not limited in 4-AD with 5-AD, in addition to the corresponding derivative of other compounds.In the present invention, we express the albumen by substrate androstane -5- alkene -3, 17- diketone (5-AD) is converted into 4-AD (4-AD), and reaction is as shown in Figure 1.
The beneficial effects of the present invention are:Recombinant bacterial strain provided by the invention is produced by express express target protein Efficient Conversion 4-AD, solve the problems, such as to be difficult to accumulation and separating-purifying in industrial production 4-AD, in industrialized production In it is significant.It can realize that the conversion of a variety of steroidal compounds produces using recombinant bacterial strain provided by the invention expression enzyme, Reach the high purpose of product yield high, purity, and help to reduce the energy consumption in steroid drugs production process, improve medicine premise Utilization rate, simplify production stage, reduce production cost, and reaction condition is gentle, environment-friendly, and being suitable for wideling popularize should With having higher economic benefit and social benefit.
Brief description of the drawings
Fig. 1 is that 5-AD is converted into 4-AD schematic diagrames under Δ 5-3- ketone isomery enzyme effects.
Fig. 2 is Δ 5-3- ketones isomerase (KSI228) gene cloning, and M is that DNA Marker, KSI228 sizes are about 400bp。
Fig. 3 identifies that M is DNA Marker for carrier construction pRSV-KSI228 bacterium solutions PCR, and identification stripe size is about 750bp。
Fig. 4 is e. coli bl21-KSI228 protein expression electrophoresis results, and M is that albumen Marker, KSI228-S are supernatant Sample, KSI228-Crt S are control Supernatant samples, and KSI228-P is deposit sample, and KSI228-Crt P are control precipitation sample Product, destination protein KSI228 sizes are about 16.8KDa.
Fig. 5 is that by His-Tag, electrophoresis result, M are that albumen Marker, KSI228-S are to purpose albumen KSI228 after purification Supernatant samples, KSI228-P are deposit sample, and identified KSI228 is soluble protein.
Embodiment
With reference to embodiment, the present invention is further illustrated.
The acquisition of the mycobacteria HGMS2GL Δ 5-3- ketone isomerase genes of embodiment 1
1.1 extract mycobacteria HGMS2GL genomes
Using genome extracts kit, mycobacteria HGMS2GL genomes are extracted.
1.2 design of primers
Specificity according to Δ 5-3- ketone isomerase genes are designed mycobacteria HGMS2GL genome sequencings is drawn Thing, primer sequence is as shown in following sequences.
1.3PCR methods extract Δ 5-3- ketone isomerase genes
Using the mycobacteria HGMS2GL genomic DNAs extracted as template, using specific primer KSI-F and KSI-R to draw Thing, enter performing PCR amplification, obtain fragment (result as shown in Figure 2) of the size for 400bp or so, fragment is named as KSI228, fragment Sequence is as shown in SEQ ID NO.1.
Primer KSI-F:CGCCGCAGATCTGTGACCGCACCGGTGACG (dashed part is restriction enzyme site BglII).
Primer KSI-R:CGCCGCCAATTGTCACACCCGTTGTGCGCTG (dashed part is restriction enzyme site MfeI).
50 μ LPCR reaction systems are as follows:
PCR response procedures are as follows:
Embodiment 2 builds coli expression carrier pRSV-KSI228
2.1 structure coli expression carrier pRSV-KSI228
PCR primer in embodiment 1 is reclaimed with DNA purification kits, recovery fragment is obtained using MfeI and BglII digestions To KSI genetic fragments;Plasmid pRSV after BamHI and EcoRI digestions with reclaiming large fragment;KSI228 genetic fragments and pRSV is big Fragment is connected by T4DNA ligases, is transferred to E. coli competent DH5 α, and then coating contains kalamycin resistance (30 μ g/ ML LB flat boards).
2.2. coli expression carrier pRSV-KSI228 is screened
Containing the single bacterium colony on kalamycin resistance LB flat boards in picking step 2.1, bacterium colony PCR identifications are carried out, use spy Specific primer KSI-F and vector primer T7-R, is detected (result is as shown in Figure 3) to transformant.
Primer T7-R:TGCTAGTTATTGCTCAGCGG.
25 μ LPCR reaction systems are as follows:
PCR response procedures are as follows:
2.3 extraction coli expression carrier pRSV-KSI228
The positives transformant of step 2.2 is cultivated in the LB liquid medium containing kalamycin resistance, contains structure The transformant of successful coli expression carrier, in 37 DEG C, 200rpm, can cultivate 16h in the conditioned growth.Use plasmid Extracts kit extraction coli expression carrier pRSV-KSI228.
2.4 sequencing
The coli expression carrier pRSV-KSI228 extracted in step 2.3 is sequenced, the results showed that target gene Sequence SEQ ID NO.1 are consistent with known array, and protein expression reading frame is consistent with expression vector, i.e. recombinant expression carrier table The amino acid sequence reached is purpose amino acid sequence SEQ ID NO.2.
Embodiment 3 builds e. coli protein expression bacterium BL21-KSI228
3.1 expression vector pRSV-KSI228 convert e. coli bl21
The coli expression carrier pRSV-KSI that success is sequenced in step 2.4 is transferred to e. coli bl21 competence In.Then LB flat board of the coating containing kalamycin resistance (30 μ g/mL).
3.2 screening e. coli bl21-KSI228
Containing the single bacterium colony on kalamycin resistance LB flat boards in picking step 3.1, in the liquid containing kalamycin resistance The e. coli bl21 containing pRSV-KSI228 is cultivated in body LB culture mediums, can in the conditioned growth, in 37 DEG C, 200rpm, Cultivate 16h.
Embodiment 4 expresses bacterial strain BL21-KSI228 protein expressions and identification
4.1 expression bacterial strain BL21-KSI228 cultures
E. coli bl21-KSI228 the bacterial strains obtained in step 3.2 are inoculated in into 5mL with 1% (V/V) inoculum concentration to contain Have in kalamycin resistance (30 μ g/mL) LB liquid medium and cultivate, 37 DEG C, 200rpm, determine OD600Value, until OD600For 0.8.Then IPTG (final concentration 0.4mM), 18 DEG C of Fiber differentiation 12h are added, and using the empty host without KSI228 as blank pair According to.
4.2 destination protein electroresis appraisals
Thalline to be collected, somatic cells are crushed using sonicator, supernatant is collected in centrifugation (5000rpm, 5mim, 4 DEG C), Then the expression of destination protein (result is as shown in Figure 4) is determined using SDS-PAGE.
The protein purification of embodiment 5 and enzyme activity determination
5.1 destination proteins purify
The albumen that step 4.2 is expressed purifies by His-Tag-Beads, then determines protein purification using SDS-PAGE Situation (result is as shown in Figure 5).
5.2 destination protein Rate activities determine
Determination of activity is carried out to the Δ 5-3- ketones isomerase of step 5.1 after purification, substrate 5-AD is added and contains 34mM In the buffer solution of potassium phosphate, pH7.0,2.5mMEDTA and 3.3% methanol, final concentration of 100 μm of ol/L.Take step 5.1 after purification Albumen diluted with buffer solution, diluted protein solution and substrate carry out catalytic reaction, at 25 DEG C of measure at 248nm absorbance value. The albumen Rate activity is 46742U/mgmin after measured.
The enzyme that KSI228 enzyme activity is defined as 1 μm of ol5-AD of conversion in 1min is defined as an enzyme-activity unit.Rate activity defines The enzyme that 1 μm of ol5-AD is converted for 1mg albumen in 1min is defined as a Rate activity unit.
Embodiment described above is only that the preferred embodiment of the present invention is described, but is not limited to this, this The technical staff in field is easy to understand according to above-described embodiment the spirit of the present invention, and makes different amplification and change, but Without departing from the spirit of the present invention, all within protection scope of the present invention.
SEQ ID NO.1
SEQ ID NO.2
Val Thr Ala Pro Val Thr Leu Ala Gly Arg Arg Ser Arg Glu Ala Ala Val Ala Arg Asp Lys Ala Ala Trp Leu Ala Val Phe Ala Asp Asp Ala Ile Val Glu Asp Pro Ile Gly Pro Ser His Phe Asp Pro Glu Gly Lys Gly His Arg Gly Lys Glu Ala Ile Ala Ala Phe Phe Asp Lys Ala Ile Ala Pro Ser Gln Leu Glu Phe Arg Phe Glu Lys Thr Tyr Val Cys Gly Pro Glu Glu Arg Asn Val Gly His Ile Val Ile Val Ala Gly Gly Tyr Arg Val Val Ala Glu Gly Val Phe Thr Tyr Arg Val Asn Ala Glu Gly Lys Ile Ala Ala Leu Arg Ala Tyr Trp Glu Val Asp Lys Ala Thr Ala Ser Ala Gln Arg Val
SEQUENCE LISTING
<110>Hubei Hubei University Of Technology of common biological Science and Technology Ltd.
<120>A kind of Δ 5-3- ketones isomerase gene, the carrier comprising the gene and its application
<130> 2017
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 402
<212> DNA
<213>Mycobacteria HGMS2GL
<400> 1
GTGACCGCAC CGGTGACGCT GGCGGGTCGA CGGTCGCGGG AGGCGGCCGT CGCCCGCGAC 60
AAGGCGGCCT GGCTGGCGGT GTTCGCCGAC GACGCGATCG TCGAGGATCC GATCGGACCG 120
TCGCATTTCG ACCCCGAGGG TAAGGGCCAT CGCGGCAAGG AGGCCATCGC CGCCTTCTTC 180
GACAAGGCGA TCGCCCCGAG TCAGCTCGAA TTCCGCTTCG AGAAGACCTA TGTCTGCGGC 240
CCCGAAGAGG CCAACGTCGG GCATATCGTG ATCGTCGCCG GCGGCTACCG CGTGGTGGCA 300
GAGGGCGTGT TCACCTACCG CGTGAACGCC GAGGGCAAGA TTGCTGCGCT GCGCGCCTAC 360
TGGGAAGTGG ACAAGGCGAC CGCCAGCGCA CAACGGGTGT GA 402
<210> 2
<211> 133
<212> PRT
<213>Artificial sequence
<400> 2
Val Thr Ala Pro Val Thr Leu Ala Gly Arg Arg Ser Arg Glu Ala Ala
1 5 10 15
Val Ala Arg Asp Lys Ala Ala Trp Leu Ala Val Phe Ala Asp Asp Ala
20 25 30
Ile Val Glu Asp Pro Ile Gly Pro Ser His Phe Asp Pro Glu Gly Lys
35 40 45
Gly His Arg Gly Lys Glu Ala Ile Ala Ala Phe Phe Asp Lys Ala Ile
50 55 60
Ala Pro Ser Gln Leu Glu Phe Arg Phe Glu Lys Thr Tyr Val Cys Gly
65 70 75 80
Pro Glu Glu Arg Asn Val Gly His Ile Val Ile Val Ala Gly Gly Tyr
85 90 95
Arg Val Val Ala Glu Gly Val Phe Thr Tyr Arg Val Asn Ala Glu Gly
100 105 110
Lys Ile Ala Ala Leu Arg Ala Tyr Trp Glu Val Asp Lys Ala Thr Ala
115 120 125
Ser Ala Gln Arg Val
130

Claims (10)

1. a kind of Δ 5-3- ketone isomerase genes, it is characterised in that its nucleotide sequence is as shown in SEQ ID NO.1.
A kind of 2. encoding proteins matter of gene described in claim 1, it is characterised in that its amino acid sequence such as SEQ ID NO.2 It is shown.
3. a kind of expression vector, it is characterised in that include the Δ 5-3- ketone isomerase genes described in claim 1.
4. expression vector according to claim 3, it is characterised in that the expression vector is pRSV-KSI228.
5. a kind of Bacillus coli cells, it is characterised in that include the Δ 5-3- ketone isomerase genes described in claim 1.
6. Bacillus coli cells according to claim 5, it is characterised in that the Bacillus coli cells are to include restructuring Plasmid pRSV-KSI228 E.coliDH5 α.
7. Bacillus coli cells according to claim 5, it is characterised in that the Bacillus coli cells are to include restructuring Plasmid pRSV-KSI228 E.coli BL21.
8. the method for gene, its feature exist described in a kind of escherichia coli high-level expression claim 1 using described in claim 7 The liquid LB that 5mL contains kalamycin resistance is inoculated in, recombinant Bacillus coli cells with 1~2% (V/V) inoculum concentration to cultivate Cultivated in base, 37 DEG C, 180~240rpm, determine OD600Value, until OD600For 0.6~0.8;Then IPTG, the IPTG are added Final concentration of 0.4~1mM, 18 DEG C of 12~24h of Fiber differentiation.
9. according to the method for claim 8, it is characterised in that the concentration of the LB liquid medium kanamycins is 30 μ g/mL。
10. the Δ 5-3- ketone isomerases obtained using the recombination bacillus coli described in claim 7 are in transformation phytosterin Application.
CN201710564918.2A 2017-07-12 2017-07-12 Delta 5-3-ketone isomerase gene, vector containing gene and application thereof Active CN107345227B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710564918.2A CN107345227B (en) 2017-07-12 2017-07-12 Delta 5-3-ketone isomerase gene, vector containing gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710564918.2A CN107345227B (en) 2017-07-12 2017-07-12 Delta 5-3-ketone isomerase gene, vector containing gene and application thereof

Publications (2)

Publication Number Publication Date
CN107345227A true CN107345227A (en) 2017-11-14
CN107345227B CN107345227B (en) 2020-12-04

Family

ID=60256909

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710564918.2A Active CN107345227B (en) 2017-07-12 2017-07-12 Delta 5-3-ketone isomerase gene, vector containing gene and application thereof

Country Status (1)

Country Link
CN (1) CN107345227B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1362518A (en) * 2000-07-07 2002-08-07 味之素株式会社 Hexulose phosphate isomerase and gene coding said isomerase

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1362518A (en) * 2000-07-07 2002-08-07 味之素株式会社 Hexulose phosphate isomerase and gene coding said isomerase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
XIAO-YAN ZHANG.ET AL: "Optimization of biotransformation from phytosterol to androstenedione by a mutant Mycobacterium neoaurum ZJUVN-08", 《 JOURNAL OF ZHEJIANG UNIVERSITY-SCIENCE B(BIOMEDICINE & BIOTECHNOLOGY)》 *

Also Published As

Publication number Publication date
CN107345227B (en) 2020-12-04

Similar Documents

Publication Publication Date Title
CN109666658B (en) Nicotinamide phosphoribosyl transferase for preparing NMN, coding gene, recombinant vector and application
CN108456666B (en) 3-sterone-delta1Dehydrogenase and coding gene and application thereof
CN107574173B (en) Recombinant plasmid and method for constructing monascus pigment high-yield strain by using same
CN115011616B (en) Acetaldehyde dehydrogenase gene RKALDH and application thereof
CN104789539B (en) A kind of mutant of trehalose synthase and its preparation method and application
CN112899177B (en) Recombinant yarrowia lipolytica expressing myrosinase TGG4 and application thereof
CN108034667B (en) Monascus ruber alpha-amylase gene, and preparation method and application thereof
CN113234699A (en) Alpha-1, 2-fucosyltransferase and application thereof
CN112725319A (en) Alginate lyase FaAly7 with polyG substrate specificity and application thereof
CN113801240B (en) D-psicose-3-epimerase activity aggregate and preparation method and application thereof
CN108865962A (en) It is a kind of can solution expression with high efficiency 4- alpha-glycosyl transferase colibacillus engineering
CN109097342B (en) Steroid 11 beta-hydroxylase in Absidia coerulea, coding gene and application thereof
CN112980815B (en) alpha-L-fucosidase OUCJdch-16 and application thereof
CN110117582A (en) Fusion protein, its encoding gene and the application in biosynthesis
CN111748535A (en) Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine
CN113736763A (en) Myrosinase Rmryr and application thereof in preparation of sulforaphane and sulforaphane
CN114736918B (en) Recombinant escherichia coli for producing salidroside by integrated expression and application thereof
CN111394410A (en) High-catalytic-activity neuraminic acid synthase and application thereof
CN114934062B (en) Engineering bacterium for efficiently expressing D-psicose 3-epimerase and application
CN110305855A (en) Rhizoma Gastrodiae GeCPR gene and its application
CN111808836B (en) Heat-resistant mutant enzyme of pullulanase I and preparation method and application thereof
CN107345227A (en) A kind of the ketone isomerase gene of Δ 53, the carrier comprising the gene and its application
CN110004099A (en) A kind of fermentation method for producing of rhodioside
CN109371053B (en) Construction method of monascus pigment producing strain
CN109097315B (en) Genetically engineered bacterium for high-yield lipopeptide and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20181205

Address after: 442700 Baiguoshu Lute No. 1, Shuidu Industrial Park, Danjiangkou Economic Development Zone, Shiyan City, Hubei Province

Applicant after: HUBEI GONGTONG BIOTECHNOLOGY CO.,LTD.

Address before: 442700 Baiguoshu Lute No. 1, Shuidu Industrial Park, Danjiangkou Economic Development Zone, Shiyan City, Hubei Province

Applicant before: HUBEI GONGTONG BIOTECHNOLOGY CO.,LTD.

Applicant before: HUBEI University OF TECHNOLOGY

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant
PE01 Entry into force of the registration of the contract for pledge of patent right

Denomination of invention: one kind D 5-3-Ketone Isomerase Gene, Vector Containing the Gene and Its Applications

Effective date of registration: 20231127

Granted publication date: 20201204

Pledgee: Hubei Danjiangkou Rural Commercial Bank Co.,Ltd.

Pledgor: HUBEI GONGTONG BIOTECHNOLOGY CO.,LTD.

Registration number: Y2023980067680

PE01 Entry into force of the registration of the contract for pledge of patent right