CN107326020B

CN107326020B - L-type amylase variant and application thereof

Info

Publication number: CN107326020B
Application number: CN201710377634.2A
Authority: CN
Inventors: 范岩; 杜秀贞; 郝名慧; 卢嫣红; 孙燕; 徐红
Original assignee: Nanjing Bestzyme Bio Engineering Co ltd
Current assignee: Nanjing Bestzyme Bio Engineering Co ltd
Priority date: 2017-05-25
Filing date: 2017-05-25
Publication date: 2020-06-16
Anticipated expiration: 2037-05-25
Also published as: CN107326020A; US20180340161A1; US10647970B2

Abstract

The α amylase variant is obtained by deleting the first amino acid residue V at the N-terminal of α amylase of B.licheniformis and replacing the first amino acid residue V with 3 other amino acid residues DGL, and the sequence is shown as SEQ ID NO. 4.

Description

L-type amylase variant and application thereof

Technical Field

The invention belongs to the field of enzyme engineering, and relates to an L-type amylase variant and application thereof.

Background

In the industry, starch hydrolysis is mainly started from α amylase, the synergistic application of α amylase derived from microorganisms and other enzyme species, such as pullulanase, saccharifying enzyme and glucose isomerase, can effectively decompose starch macromolecules, and the produced micromolecule polysaccharide or monosaccharide has a plurality of applications in the industries of food manufacturing, grain processing, beer processing, alcohol production and the like, and is very important, α amylase belongs to one of saccharifying hydrolytic enzymes, and the main structural characteristic of the saccharifying hydrolytic enzyme is (α/β)₈Folding, containing specific starch substrate binding sites, longThe degree is generally not more than 10 sugar monomers, but binding sites of many amylases act together to carry out multi-site binding, thereby successfully cleaving starch macromolecules.

α Amylase can effectively cleave α -1,4 glycosidic bonds in starch substrates, thereby rapidly reducing the molecular weight and viscosity of the starch substrates, and the products are mainly dextrins of different lengths α Amylase has different species, and the application conditions of these species in industry are very different according to the characteristics of the desired products.

α Amylase (α -1,4-glucan-4-glucanohydrolases, E.C.3.2.1.1) can effectively hydrolyze α -1,4 glycosidic bonds in starch and other polysaccharides, in view of the demand for improving enzyme efficiency and reducing production cost in the hydrolysis process of starch, the search for α amylase capable of supporting efficient starch liquefaction in different application fields has become an important research and development direction in academia and industry, and the focus of the improvement of the enzyme by utilizing the technology of enzyme engineering is mainly on heat resistance, acid-base resistance and liquefaction effect improvement.

Many α amylases have been found and defined commercially from plants and microorganisms, including mainly B.licheniformis α amylase, B.amyloliquefaciens α amylase and G.stearothermophilus α amylase, with the largest number of variants derived from B.licheniformis α -amylase (type L) as a template and the most widely used.

In the invention, in order to meet the requirement of industrial production, a series of novel α amylase variants are constructed by using B.licheniformis α -amylase (L type) as a template, the application efficiency of the amylase is improved, and the liquefaction efficiency is matched with that of a market mainstream product particularly under the conditions of low pH and reduced addition amount.

Disclosure of Invention

The invention aims to provide a B.licheniformis α -amylase (L-type) variant, which can improve liquefaction efficiency and can meet the requirement of industrial production, and particularly, under the conditions of temperature above 100 ℃ and pH value of 5.0-5.8, the enzyme activity and other properties of the α amylase variant can be matched with those of mainstream products in the market.

The invention aims to provide a gene for coding the α amylase variant.

It is a further object of the present invention to provide methods for the production and use of the α amylase variants.

The purpose of the invention can be realized by the following technical scheme:

an α amylase variant, said α amylase variant having been deleted of the first amino acid residue V from the N-terminus and replaced with 3 other amino acid residues DGL by b.licheniformis' α amylase.

The full-length coding gene sequence of the α amylase of B.licheniformis is shown in SEQ ID NO.1, and the corresponding amino acid sequence is shown in SEQ ID NO. 2.

The amino acid sequence of the α amylase variant is shown as SEQ ID NO. 4.

The nucleotide coding sequence of the α amylase variant is preferably as shown in SEQ ID NO. 3.

A gene encoding the α amylase variant of the invention.

The gene is preferably shown as SEQ ID NO. 3.

An expression vector for expressing the α amylase variant of the invention, comprising a gene encoding the α amylase variant of the invention.

The expression vector comprises an expression component which is mainly composed of a natural or synthetic promoter sequence, a natural or synthetic ribosome binding site, a natural or synthetic terminator sequence and the gene sequence which codes the α amylase variant.

A recombinant cell for expressing the α amylase variant of the invention comprising one or more genes encoding the α amylase variant of the invention.

The host cell of the recombinant cell is preferably a strain of Bacillus, further preferably b.licheniformis or a strain of Bacillus genetically engineered to inactivate some endogenous proteins; most preferred are b.licheniformis genetically engineered to inactivate AprE and/or Blase.

A method for producing an α amylase variant of the invention, comprising culturing a recombinant cell comprising a gene sequence encoding a α amylase variant under conditions suitable for expression of the α amylase variant, and obtaining the α amylase variant from the recombinant cell or a culture supernatant thereof.

The α amylase variant is applied to hydrolysis of α -1,4 glycosidic bonds of polysaccharide, preferably α -1,4 glycosidic bonds of polysaccharide under the conditions of high temperature and/or low pH, wherein the high temperature is preferably 80-110 ℃, further preferably 100-110 ℃, and the low pH is preferably 5.0-5.8.

Advantageous effects

The α amylase variants provided by the invention have high catalytic activity under the acidic condition of pH 5.0-5.8 and the high temperature condition of more than 100 ℃, and the α amylase variants have acid resistance and thermostability and are suitable for starch liquefaction.

Drawings

FIG. 1 is a pYF-tsDE vector comprising a temperature sensitive element (replication active at 30 ℃), an erythromycin determinant (ErmC) - -that tolerates 300. mu.g/mL erythromycin in E.coli and 5. mu.g/mL erythromycin in B.licheniformis.

FIG. 2 is a schematic diagram of pUC57-KS-erm vector from which the pYF-tsDE vector of the present invention can be obtained.

FIG. 3 is a schematic representation of the pYF-tsINT-amy vector.

FIG. 4 shows a comparison of amylase liquefaction applications at different injection temperatures

FIG. 5 is a comparison of amylase liquefaction applications at different starch slurry concentrations

FIG. 6 is a comparison of different enzyme dosages of amylase for liquefaction at pH5.0

FIG. 7 is a comparison of amylase liquefaction applications at different substrate concentrations

FIG. 8 is a comparison of amylase liquefaction applications at different pH conditions

FIG. 9 shows a comparison of the use of amylase liquefaction at different substrate concentrations

FIG. 10 is a comparison of amylase liquefaction applications at different pH conditions

FIG. 11 is a comparison of amylase application in alcohol liquefaction of corn

Detailed description of the invention

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In this application, certain terms are synonymous with the norm. It must be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

In the present invention, α amylase refers to an enzyme capable of hydrolyzing the α -1,4 glycosidic linkages of polysaccharides for example, α amylase hydrolyzes starch to dextrins.

In the present invention, the parent α amylase refers to the native α amylase the native α amylase is a bacterial α amylase, and sources include, but are not limited to, Bacillus subtilis, B.licheniformis, B.amyloliquefaciens, G.stearothermophilus, and Bacillus cereus.

According to a preferred embodiment of the invention the native α amylase is derived from a strain of Bacillus, in particular the full length coding sequence of B.licheniformis and G.stearothermophilus.B.licheniformis is shown in SEQ ID No.1 and the corresponding amino acid sequence is shown in SEQ ID No. 2.

In the present invention, the term "α amylase variant" refers to a α amylase that is not naturally occurring and that has one or more amino acid residues added, deleted, and/or substituted at the available sites in the amino acid sequence of the parent α amylase, while still maintaining the ability of the parent to hydrolyze α -1,4 glycosidic bonds.

"liquefaction" in the context of the present invention generally refers to the process of breaking down carbohydrates into small polysaccharides when α amylase or α amylase variants are added, and specifically refers to the hydrolysis of α -1,4 glycosidic bonds of carbohydrates.

As used herein, the term "α -1,4 glycosidic linkage" refers to a linkage that links the C1 of the preceding glucose to the C4 of the succeeding glucose, i.e., a α -1,4 glycosidic linkage.

The present invention relates to a "α amylase variant" obtained by sequence engineering a parent α amylase, the parent α amylase being a native α amylase, in particular a native α amylase of bacterial origin, the α amylase variant is, according to an embodiment of the present invention, a mutation or deletion of one or several amino acid residues from the available sites of the amino acid sequence of the parent α amylase.

The present invention includes a series of α amylase variants according to embodiments of the present invention, the series of α amylase variants have at least 95% homology in amino acid sequence, 95%, 96%, 97%, 98%, 99% or 100%, respectively.

As an illustrative and non-limiting example of the invention, the α amylase variant was obtained by deleting the first amino acid residue V from the N-terminus of α amylase from b.licheniformis and replacing it with 3 other amino acid residues DGL, the amino acid sequence of which is shown in SEQ ID No. 4.

The α amylase variants of the invention retain the ability to hydrolyze α -1,4 glycosidic linkages in addition, the α amylases are useful for performance in commercial processes, e.g., improved liquefaction efficiency, stable catalytic activity at acidic pH or high temperature.

According to an embodiment of the present invention, an α amylase variant is stable in catalytic activity under acidic conditions at pH5.0 or at temperatures above 100 deg.C (especially at temperatures between 100 deg.C and 108 deg.C.) these enhanced properties of α amylase variants are more suitable for liquefaction reactions in the starch industry because liquefaction processes are often performed at low pH and high temperature in the starch industry.

In a preferred embodiment, the α amylase variant is derived from a parent α amylase, and in particular from the parent b.

According to the present invention, any carbohydrate containing α -1,4 glycosidic linkages can be used in the liquefaction reaction carbohydrates containing one or more α -1,4 glycosidic linkages include, but are not limited to, starch, amylopectin, amylose and dextran.

Many carbohydrates contain α -1, 6-glycosidic and α -1, 4-glycosidic linkages, e.g., amylopectin, "α -1, 4-glycosidic linkage" refers to the linkage of C1 of the previous glucose to C4 of the next glucose, i.e., α -1,4 glycosidic linkages.

Thus, according to the present invention, pullulanase is used in combination with an example of a method for improving efficiency of a catalytic saccharification reaction, and in the present invention, "pullulanase" refers to a hydrolase capable of hydrolyzing α -1, 6-glycosidic bond.

In addition, the compound enzyme can effectively reduce the concentration of a substrate and improve the conversion efficiency in the saccharification reaction, has higher catalytic activity at an acidic pH or higher temperature, and is more suitable for the condition of industrially hydrolyzing starch.

The present invention provides a method for the hydrolysis α -1,4 glycosidic linkages of α amylase variants at any temperature and pH suitable for commercial manufacture to carry out saccharification reactions, according to the present invention, the liquefaction reaction can be carried out at a high temperature of 80 ℃ to 110 ℃, such as 80 ℃, 90 ℃, 100 ℃, 105 ℃ and 110 ℃, and the saccharification reaction can also be carried out at an acidic pH of 5.0 to 5.8, such as pH5.0, 5.2,5.4,5.6, and 5.8.

According to an embodiment of the present invention, the α amylase variant catalyzed liquefaction reaction is stable in catalytic activity under acidic pH and temperature conditions above 100 ℃.

In another aspect, the expression vector of the present invention comprises a synthetic nucleotide sequence encoding a α amylase variant, and the recombinant host cell comprises the expression vector described above.

The expression vector of the present invention preferably comprises a natural or synthetic promoter sequence, a natural or synthetic ribosome binding site, and a natural or synthetic terminator sequence, which together with the synthetic α amylase variant coding sequence form an expression module that forms an expression vector with the vector backbone.

According to a preferred embodiment of the invention, the expression vector is suitable for expression in bacteria, in particular in Bacillus strains, more preferably in B.licheniformis. In a particularly preferred embodiment, the expression vector is capable of integrating into the genome of Bacillus, in particular the genome of B.licheniformis. Expression vectors useful in host cells for integration of the polynucleotide sequences into the chromosome, and methods for constructing such expression vectors, are well known to those of ordinary skill in the contemporary biological arts.

Any technique may be used to genetically engineer host cells to contain one or more nucleic acid sequences encoding synthesis of α amylase variants of the invention, e.g., chromosomal integration.

According to the embodiment of the invention, the recombinant host cell is genetically engineered to inactivate some endogenous proteins, endogenous proteins capable of being inactivated include, but are not limited to, extracellular proteases, the recombinant host cell inactivates some endogenous proteins before or after transforming a nucleic acid sequence containing an α amylase variant expression gene.

In particular, B.licheniformis strains may inactivate extracellular proteases, such as subtilisin (AprE), glutaminic acid-specific protease (Blase), which have been engineered to make B.licheniformis strains more suitable for expression and secretion of the α amylase variant.

According to embodiments of the present invention, the method comprises culturing a recombinant host cell comprising a nucleotide sequence encoding a α amylase variant under conditions suitable for expression of the α amylase variant, and obtaining α amylase variant from the recombinant host cell or supernatant.

The recombinant host cells of the invention can produce α amylase variants, the recombinant host cells contain at least one copy of a nucleotide sequence encoding a α amylase variant, these nucleotide sequences encoding α amylase variants can express α amylase variants under suitable conditions the α amylase variants secreted from the recombinant host cells can be collected from the recombinant cells or supernatant.

According to an embodiment of the present invention, α amylase variant can be produced in high yield by fermentation of B.licheniformis, which has been genetically engineered to introduce a nucleotide sequence encoding α amylase variant, more preferably, B.licheniformis of the present invention, which has been eliminated resistance selection genes, is environmentally friendly and produces α amylase variant more suitable for use in the food industry.

The following examples of the present invention further illustrate the nature of the invention. It should be understood that the following examples are not intended to limit the invention, the scope of which is defined by the appended claims.

Detailed Description

EXAMPLE 1 construction of pYF-tsDE plasmid

pYF-tsDE (FIG. 1) is a thermo-sensitive E.coli/B.licheniformis shuttle plasmid. This plasmid consists of a temperature sensitive origin of replication (active at 30 ℃) and an erythromycin resistance gene (ErmC) with a resistance of 300ug/ml in e.coli and 5ug/ml in b.licheniformis. At 37 ℃, the origin of replication on the plasmid is inactivated and the plasmid is integrated into the host cell genome at the indicated site and screened with ErmC.

The construction process of the pYF-tsDE plasmid is as follows: plasmid pUC57-KS-erm (Genscript, assigned sequence: CN 104073458A, FIG. 2) was digested simultaneously with BglII, and the 3.8kbp fragment was recovered and purified, and self-ligated with T4 ligase (New England Biolabs) to yield pYF-tsDE. Coli TOP10 was propagated and served as a backbone for all gene manipulations below.

Example 2 construction of protease deficient B.licheniformis strains

Genetically engineered strains as host cells for recombinase products have been reported in the literature (Widner et al, Journal of Industrial Microbiology & Biotechnology,25,204-212, 2000). These recombinant host cells generally contain one or more nucleic acid constructs encoding the sequence of interest for expression of the enzyme. In the present invention, B.licheniformis is used as a recipient bacterium for genetic manipulation. Transformation of Bacillus can now be achieved by very sophisticated means, such as competent cell transformation, electrotransformation and protoplast transformation (Young et al, J Bacteriology,81,823-829, 1961; Shigekawa et al, Biotechniques,6,742-751, 1988; Chang et al, Molecular General Genetics,168,111-115, 1979).

In the present invention, a single α amylase variant expression cassette, containing a natural or synthetic promoter sequence, a signal peptide sequence selected from Bacillus, a synthetic ribosome binding site, a α amylase variant-encoding gene from B.licheniformis, and a transcription terminator, is designed to greatly enhance the expression level of the gene and the secretion amount of the α amylase variant in the host strain replacement of the α amylase variant-encoding gene for a specific site on the B.licheniformis cell genome is achieved by plasmid-mediated single cross-homologous recombination.

In b.licheniformis, the activity of extracellular proteases is detrimental to the secretion of heterologous enzymes. There are 2 major extracellular proteases that have been demonstrated: extracellular protease activity at great pace in b.licheniformis is derived from both proteases (subtisin (apre)), glutaminic acid-specific protease (Blase).

In the present invention, to obtain structural integrity for the expression of the α amylase variant gene, both genes were inactivated using a single cross Campbell type mechanism in a continuous manner.

2.1 pYF-tsDE inhibition of self-ligation by CIP treatment after BglII cleavage;

2.2 Gene knockout

(1) In order to obtain each gene deletion fragment, approximately 500bp of homologous sequence was amplified from both sides of the gene to be deleted by PCR using Bacillus licheniformis genomic DNA as a template. The monoclonal of Bacillus subtilis can be directly used in PCR reaction as a genome DNA template after being pre-denatured for 5 minutes at 98 ℃.

Primers for PCR reaction were synthesized by Genscript. The primer sequences are as follows:

the primers for amplifying the upstream sequence of the Apr gene are as follows:

lichApr_F1 TTATTGAGCGGCAGCTTCGACATTGATCAGACCTT

lichApr_R1 CCTTACGGCATTCCTCTCAACAGCGGATCTTCAG

the primers for amplifying the downstream sequence of the Apr gene are as follows:

lichApr_F2 CCTGAAGATCCGCTGTTGAGAGGAATGCCGTAAGG

lichApr_R2 ATGATGAGGAAAAAGAGTTTTTGGCTTGGGATGCTGAC

the primers for amplifying the upstream sequence of the Blase gene are as follows:

blalich_F1 TTATTGTGCGCTGTTTTTCCAGTTGGTCAAATTGTCG

blalich_cR1 CGGACAAGGGTCACCAACGGGACAACTGTTACCATC

the primers for amplifying the downstream sequence of the Blase gene are as follows:

blalich_cF2 GATGGTAACAGTTGTCCCGTTGGTGACCCTTGTCC

blalich_R2 CGGCGTTGGTTAGTAAAAAGAGTGTTAAACGAGGTTTGAT

the PCR amplification system is 50ul, and the reaction procedure is as follows:

(1) bacillus subtilis B.licheniformis 14580 monoclonal pre-denaturation at 98 ℃ for 8 min;

(2)96 ℃ for 15 seconds;

(3) 15 seconds at 58 ℃;

(4)72 ℃ for 30 seconds; repeating the steps 2-4 for 25-30 times;

(5) final extension 72 ℃ for 2 min.

The PCR product was detected by 0.8% agarose gel electrophoresis and purified using an Aisijin kit.

2.3 overlap PCR amplification of target Gene with internal deletion of approximately 400-500bp sequence

The internal deletion fragment of the gene is obtained by an overlap PCR (overlap extension PCR, SOE) method, and the specific operation is as follows:

(1) respectively recovering and purifying upstream and downstream PCR fragments of each gene in 2.2;

(2) mixing the upstream and downstream homologous sequence fragments of each target gene in a molar ratio of 1:1 to serve as a template, and carrying out PCR amplification by using primers XX-CZ-F1 and XX-CZ-R2 (wherein XX represents Apr or Blase) to obtain an AprE gene or Blase gene with an internal deletion fragment.

The above fragments were then recombined into a BglII linearized pYF-tsDE vector using the Clone-EZ cloning kit (supplied by Genscript Co.), and the resulting recombinant plasmids were designated as: pYF-tsDE-Apr and pYF-tsDE-Blase. These recombinant plasmids are temperature-sensitive plasmids, wherein the contained Apr gene or Blase gene lacks the internal sequence of about 400-500bp relative to the complete gene.

Replacement of different alleles can be achieved by homologous recombination. See CN102124112A for methods, other methods known in the art for homologous recombination can also be used.

2.4 plasmid transformation

The method for transforming the knockout plasmid into the lichen bacteria competent cell and the screening process are as follows:

(1) transforming the temperature-sensitive plasmid pYF-tsDE-Apr or pYF-tsDE-Blase into competent cells of the bacillus licheniformis (CICC 22794, purchased from Chinese microbial strain bank);

(2) screening positive clone strains with erythromycin (5ug/ml) resistance on LB medium (10 g peptone, 5g yeast extract, 10g sodium chloride per liter) at 30 ℃;

(2) then transferring the positive clone bacterial strain to the condition of 37 ℃ for culture, so that the temperature-sensitive plasmid can be fused on the host genome. In order to allow gene replacement at the desired site, several clones were picked and inoculated simultaneously into 2 XYT medium for 24 hours and then subcultured again, 4-5 times (generally 5-7 days) throughout the whole process.

(3) The erythromycin sensitive bacillus subtilis cells are screened for PCR identification, a transparent hydrolysis ring can be observed by using a 1% skim milk LB flat plate, and the strain after knockout should show a remarkably reduced hydrolysis ring.

Identification of the PCR primers used:

AprE：Apr-seqF1/Apr-seqR3

Blase：Blase-seqF1/Blase-seqR3

Apr-seqF1：GCCAGGTTGAAGCGGTCTATTCAT

Apr-seqR3：TACGGCCATCCGACCATAATGGAAC

Blase-seqF1：GAAGAGCCGGTCACAATTGC

Blase-seqR3：GGCCGTTAGATGTGACAGCC

example 3 Integrated construction of α Amylase variant strains

3.1 construction of an amylase expression framework

The integrated plasmid is constructed by the same method as the pYF-tsDE plasmid, in order to integrate the expression frame into the designed AmyE site on the genome, homologous regions of about 800bp are designed on the upstream and downstream of the AmyE site on the genome, and are connected to both sides of a α amylase variant expression frame, and a plurality of bacterial chromosomal DNA fragments and functional synthetic sequences which are naturally selected from the beginning to the end are assembled, and are necessary for controlling the expression of the α amylase variant gene.

A typical expression cassette for the α amylase variant consists of a natural or synthetic promoter sequence (SEQ ID NO.5), a synthetic ribosome binding site aaaggag, a α amylase variant-encoding gene from B.licheniformis (SEQ ID NO.3, respectively) and a synthetic termination sequence (SEQ ID NO. 6). A strong natural signal sequence (SEQ ID NO.7) selected from Bacillus subtilis was inserted upstream of the promoter for the α amylase variant-encoding gene to enhance the secretion efficiency of the expressed enzyme.A Clone-EZ cloning kit (Genscript) was used to insert the complete α amylase variant expression cassette into the linearized BglII site in pYF-tsDE, and the resulting temperature-sensitive integrative plasmid was named pYF-tsINT-amy (FIG. 3). the synthesis of the sequences was accomplished by Genscript, the sequence was in turn used to obtain a seamless expression cassette for the Bacillus subtilis strain which was selected from α.

3.2 plasmid transformation

The whole α amylase expression frame (containing upstream and downstream homologous fragments of amyE gene) is cyclized by recombination technology to obtain BglII linearized pYF-tsDE plasmid (a recombination kit is provided by Genscript company), a constructed temperature-sensitive plasmid is named as pYF-tsINT-amy, the plasmid is used for being transformed into AprE and Blase protease gene-deleted Bacillus licheniformis (CICC 22794 purchased from Chinese microbial pool), the α amylase variant expression frame without the resistance marker replaces AmyE, the strain successfully integrating α amylase variant encoding gene to B.licheniformis chromosome generates transparent circles on a blue starch plate by adopting the method, and PCR further verifies that the expression frame is integrated at the AmyE site of a receptor strain.

The B.licheniformis engineered strain producing the α amylase variant was stored at-80 ℃.

Example 4 Shake flask fermentation of α Amylase variant production

Get oneActivated bacterial monoclonal (containing α amylase variant expression cassette) was inoculated into 20ml of medium (containing maltose syrup 4.0%, peptone 2.0%, yeast powder 0.1% KH)₂PO₄0.6% and the corresponding antibiotic) to log phase. Inoculating 1.2ml of culture medium into 30ml of culture medium (containing maltose syrup 12.0%, peptone 1.0%, yeast powder 1% KH)₂PO₄0.2％，MnCl₂0.003%) in a shaking table with 120rpm for 3 days, 1ml was sampled at 24 hours, 48 hours and 72 hours respectively, centrifuged at 1000rpm for 1min, the supernatant was stored and analyzed by SDS-PAGE and the amylase variant of α had a molecular weight of about 53 kD.

α amylase variant activity was determined as in example 6.

Example 5 stepwise fed-batch fermentation Process for α Amylase variants

The genetically engineered B.licheniformis strain obtained in example 3, which was cryopreserved at-80 ℃ was streaked on an agar slant and returned to culture overnight at 37 ℃. The agar slant formula is as follows: peptone 1%, yeast extract 0.5%, NaCl 1%, and agar powder 2%.

First, several fresh clones were selected and cultured in seed shake flasks containing 50ml of medium at 37 ℃ for 16 hours. The seed shake flask formula is as follows: maltose syrup 4.0%, peptone 2.0%, yeast extract 0.1%, KH₂PO₄0.6 percent. After 16 hours, all the seed broth was transferred to a 7L stainless steel fermentor containing 4L of medium and the fermentation was continued for 12 hours at 37 ℃ with a stirring speed of 350rpm and an aeration rate of 650L/H. The fermentation tank comprises the following components in percentage by weight: 6.0% of maltose syrup, 1.0% of peptone, 1% of yeast extract and KH₂PO₄0.2％，MnCl₂0.003% and then using 5% phosphoric acid to control the fermentation pH at about 5.7. + -. 0.2, and feeding continuously to the fermentation tank at a rate of 0.5L/18hrs 110 hours after the first 18 hours at a rate of 1L/18hrs the feed formulation was 48% maltose syrup, 6% peptone, 8% yeast extract, the whole fermentation process continued for 140 and 150 hours, all the medium in the fermentation tank was collected and centrifuged at 4 ℃ and 1010krpm for 30 minutes, and the supernatant after centrifugation was used for α amylase variant enzyme activity analysis.

Example 6 determination of Amylase Activity

Amylase activity was measured using the Pasteur amylase activity (BAU). Definition of 1BAU Unit: the amount of enzyme required to liquefy 1mg of soluble starch in 1 minute at pH6.0 and 70 ℃.

Briefly, the enzyme activity assay was performed as follows: 20ml of 20g/L soluble starch solution is mixed with 5ml of phosphate buffer solution with the pH value of 6.0, the mixture is preheated for 8min at 70 ℃, 1.0ml of diluted enzyme solution is added for accurate reaction for 5 min, then 1ml of reaction solution is taken and added into a test tube which is previously filled with 0.5ml of 0.1mol/L hydrochloric acid solution and 5ml of diluted iodine solution, the mixture is shaken up, 0.5ml of 0.1mol/L hydrochloric acid solution and 5ml of diluted iodine solution are used as blanks, the light absorption value is rapidly measured at the wavelength of 660nm, and the enzyme activity of a test sample is obtained by looking up a table according to the light absorption.

Example 7 use of Amylase

Unless otherwise stated, 1BAU Amylase Activity is measured in terms of Pasteur amylase units (BAU). One BAU is defined as the amount of enzyme required to liquefy 1mg of soluble starch in 1 minute at pH6.0 at 70 ℃.

tDS per ton dry matter

The amylase variants expressed and isolated from the B.licheniformis cells were first subjected to a first round of liquefaction testing using corn starch. And (3) testing conditions are as follows: 18 Baume (° Be), thoroughly mixing, and adjusting pH to 5.2 with hydrochloric acid. Adding 0.4kg/tDS amylase, respectively spraying at 100, 105, 108, 112, 115 deg.C, maintaining for 5-8min, flashing, and maintaining at 95 deg.C for 120 min. After liquefaction, DE and iodine tests were performed with attention to observe protein flocculation and viscosity, as compared to Wild type, and the results are shown in Table 1 and FIG. 4.

TABLE 1 comparison of amylase liquefaction applications at different injection temperatures

Temperature (. degree.C.)	Wild type DE(％)	8008 mutant 5DE (%)
			100	18.02	19.77
105	17.79	19.47
			108	15.00	17.48
112	13.85	18.72
			115	7.05	13.91

The result shows that 8008 mutant 5 (i.e. the α amylase variant of the invention prepared above) is obviously superior to the wild type, 8008 mutant liquefies over head at 100, 105 and 108 ℃ under different injection temperatures, liquefies just right at 112 ℃, and protein flocculation is good, while at 115 ℃, the liquefaction effect is still good, and protein flocculation is normal, which indicates that the α amylase variant of the invention has very good heat resistance, while the wild type can not tolerate the high temperature of 115 ℃.

Secondly, we determined the amylase tolerance to high substrate concentrations by liquefaction experiments under different starch slurry concentration conditions. The liquefaction reaction conditions were as described above, the sparging temperature was 108 ℃ and Wild type was used as a control, and the results are shown in Table 2 and FIG. 5.

TABLE 2 comparison of amylase liquefaction applications at different starch slurry concentrations

As shown in Table 2, the 8008 mutant 5 is obviously superior to the wild type, and the α amylase variant can still be normally liquefied under the conditions of different starch slurry concentrations and the starch slurry concentration as high as 22 degrees Be under the 8008 mutant, which shows that the α amylase variant can be subjected to thick slurry liquefaction, and effectively saves the factory cost.

Then, we measured the acid resistance of amylase while performing liquefaction performance under different enzyme addition amounts. The liquefaction conditions were as described above, pH was 5.0, the amounts of enzyme added were 0.2, 0.3, 0.4, 0.5, 0.6kg/tDS, respectively, with the wild type as a control, and the results are shown in Table 3 and FIG. 6.

TABLE 3 comparison of the liquefaction applications of different enzyme dosages of amylase at pH5.0

Amount of enzyme added (kg/tDS)	Wild type DE(％)	8008 mutant 5DE (%)
			0.2	8.24	11.35
0.3	11.61	15.66
			0.4	14.98	18.29
0.5	15.16	18.47
			0.6	16.77	20.15

As shown in Table 3, 8008 mutant 5 is obviously superior to wild type, and L-type amylase variant can still be normally liquefied under the conditions of low pH and 0.2-0.3kg/tDS addition amount of 8008 mutant 5, which indicates that the L-type amylase variant has stronger tolerance to low pH, and meanwhile, α amylase variant can still be normally liquefied under the condition of low enzyme addition amount of 0.2kg/tDS, so that the cost of the plant enzyme can be effectively reduced.

In addition, we performed an amylase effect test on saccharification while comparing liquefaction liquids prepared by Wild type amylase, liqozymesupra (available from Novozymes), test conditions: 32% dry matter (DS), mixed well and pH adjusted to 4.3 with hydrochloric acid. 0.45kg/tDS glucoamylase complex was added thereto, and 200ml of the reaction was carried out at 60 ℃ for 24 hours and 48 hours, respectively. Samples were subjected to 0.22um membrane filtration and 100 ℃ inactivation for HPLC analysis. The results are shown in Table 4.

TABLE 4 Effect of Amylase on saccharification

As shown in Table 4, the saccharification effect of the α amylase variant of the invention is obviously better than that of Wild type by using the α amylase variant liquefied liquid and Wild type liquefied liquid, and the saccharification effect of both is completely the same by using the α amylase variant liquefied liquid and LiquozymeShuppara liquefied liquid, which indicates that the α amylase variant of the invention can be applied to the starch sugar industry.

In addition, we performed an amylase effect test on wheat starch, test conditions: 22. substrate concentrations of 25, 28, 30% (W/W), mixed well and pH adjusted to 5.6 with hydrochloric acid. 0.4kg/tDS of amylase was added and maintained at 91-95 deg.C for 120 min. After liquefaction, DE and iodine tests were performed with attention to observing protein flocculation and viscosity, as compared to the wild type, and the results are shown in Table 5 and FIG. 7.

TABLE 5 comparison of the use of amylase liquefaction at different substrate concentrations

Substrate concentration (%)	Wild type DE(％)	8008 mutant 5DE (%)
			22	20.85	21.61
25	20.21	20.29
			28	19.64	19.71
30	18.14	19.48

The result shows that 8008 mutant 5 is similar to the wild type result, under the condition of different substrate concentrations, 22-25% liquefaction is right and protein flocculation is good, and at 28 and 30%, the liquefaction effect is still good and the protein flocculation is normal, thus demonstrating that α amylase variant of the invention can be used for thick slurry liquefaction, and effectively saving the factory cost.

Second, we measured the acid resistance of the amylase while performing liquefaction at different pH conditions. The liquefaction conditions were as described above, the pH was 4.8, 5.2, 5.6, 6.0, the amount of enzyme added was 0.4kg/tDS, and the results are shown in Table 6 and FIG. 8, in comparison with the wild type.

TABLE 6 comparison of amylase liquefaction applications at different pH

pH	Wild type DE(％)	8008 mutant 5DE (%)
			4.8	8.11	14.45
5.2	20.43	19.76
			5.6	21.77	20.30
6.0	21.97	21.10

As shown in Table 6, the α amylase variant of the invention still liquefied normally at pH4.8, indicating that the α amylase variant of the invention has strong tolerance to low pH, while the wild type cannot tolerate low pH.

Subsequently, we performed an amylase effect test on rice, test conditions: 12. substrate concentrations of 15, 18, 20 Baume (° Be), thoroughly mixed, and pH adjusted to 5.2 with hydrochloric acid. Adding 0.4kg/tDS amylase, spraying at 108 deg.C, maintaining for 5-8min, flashing, and maintaining at 95 deg.C for 120 min. After liquefaction, DE and iodine tests were performed with attention to observing protein flocculation and viscosity, as compared to the wild type, and the results are shown in Table 7 and FIG. 9.

TABLE 7 comparison of the use of amylase liquefaction at different substrate concentrations

Substrate concentration (. degree. Be)	Wild type DE(％)	8008 mutant 5DE (%)
			12	19.53	22.93
15	18.87	21.75
			18	17.06	21.46
20	15.72	20.89

The result shows that 8008 mutant 5 is obviously superior to wild type, 8008 mutant 5 has proper 12-18 DEG Be liquefaction and good protein flocculation under different substrate concentrations, and still has good liquefaction effect and normal protein flocculation under 20 DEG Be, which shows that α amylase variant of the invention can be subjected to thick slurry liquefaction, thereby effectively saving the cost of a factory.

Secondly, we determined the resistance of the amylase to high substrate concentrations by liquefaction experiments under different starch pH conditions (4.8, 5.2,5.4,5.6, 5.8). The liquefaction reaction conditions were as described above, the injection temperature was 108 ℃ and the enzyme addition amount was 0.4kg/tDS, as compared with the wild type, and the results are shown in Table 8 and FIG. 10.

TABLE 8 comparison of amylase liquefaction applications at different pH

pH	Wild type DE(％)	8008 mutant 5DE (%)
			4.8	7.46	16.17
5.2	16.89	20.33
			5.4	17.42	20.79
5.6	17.96	21.35
			5.8	18.44	21.81

As shown in Table 8, the α amylase variant of the invention still liquefied normally at pH4.8-5.8, indicating that the α amylase variant of the invention has strong tolerance to low pH and poor wild type acid resistance.

Finally, because of the important use of amylase in the industrial production of alcohol, we also tested the liquefying effect of amylase in the production of alcohol, prepared corn flour (40 mesh) at various feed-water ratios, adjusted the pH to 5.8 with hydrochloric acid, and added 0.145kg/tDS amylase. Cooking and liquefying at 95 deg.C for 120 min. After the reaction was complete, the DE and viscosity of the sample were measured and compared with Liquozyme Supra (from Novozymes). The results are shown in Table 9 and FIG. 11.

TABLE 9 comparison of amylase application in corn alcohol liquefaction

Ratio of material to water	DE(％)	Viscosity (mPas)
			Amylase-1: 2	12.36	1529
Amylase-1: 2.3	12.95	1007
			Amylase-1: 2.5	13.24	498
Amylase-1: 2.7	13.64	381
			Liquozyme Supra-1:2	12.19	1702
Liquozyme Supra-1:2.3	12.78	1114
			Liquozyme Supra-1:2,5	12.88	506
Liquozyme Supra-1:2.7	13.32	352

As shown in Table 9, the α amylase variant of the invention and Liquzome Supra can achieve the same application effect, which shows that the invention can be applied to the corn alcohol industry.

In conclusion, according to the experimental results in the invention, the series of L-type amylase variants have better heat resistance and pH tolerance, can be applied to high-concentration starch slurry liquefaction, and can be applied to the starch sugar industry and the alcohol industry.

The embodiments of the present invention do not depart from the gist of the invention except for the application of technical means in the field. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed, but that the invention will include modifications within the spirit and scope of the appended claims.

<110> Nanjing Baismig bioengineering GmbH

<120> L-type amylase variant and application

<160>11

<210>1

<211>1446

<212>DNA

<213>B. licheniformis

<220>

<223> full-length coding gene sequence of α amylase of licheniformis

<400>1

gtaaatggca cgctcatgca gtattttgaa tggtatactc cgaacgacgg ccagcattgg 60

aaacggttgc agaatgatgc ggaacatttg tcggatatcg gtattactgc cgtctggatt 120

cccccggcat ataagggaac gagccaagcg gatgtgggct acggtgctta cgacctttat 180

gatttagggg agtttcatca aaaagggacg gttcggacaa agtacggcac aaaaggagag 240

ctgcaatctg cgatcaaaag tcttcattcc cgcgacatta acgtttacgg ggatgtggtc 300

atcaaccaca aaggcggcgc tgatgcgacc gaagatgtaa ccgcggttga agtcgatccc 360

gctgaccgca accgcgtaat ttcaggagaa cacctaatta aagcctggac acattttcat 420

tttccggggc gcggcagcac atacagcgat tttaaatggc attggtacca ttttgacgga 480

accgattggg acgagtcccg aaagctgaac cgcatctata agtttcaagg aaaggcttgg 540

gattgggaag tttccaatga aaacggcaac tatgattatt tgatgtatgc cgacatcgat 600

tatgaccatc ctgatgtcgc agcagaaatt aagagatggg gcacttggta tgccaatgaa 660

ctgcaattgg acggtttccg tcttgatgct gtcaaacaca ttaaattttc ttttttgcgg 720

gattgggtta atcatgtcag ggaaaaaacg gggaaggaaa tgtttacggt agctgaatat 780

tggcagaatg acttgggcgc gctggaaaac tatttgaaca aaacaaattt taatcattca 840

gtgtttgacg tgccgcttca ttatcagttc catgctgcat cgacacaggg aggcggctat 900

gatatgagga aattgctgaa cggtacggtc gtttccaagc atccgttgaa atcggttaca 960

tttgtcgata accatgatac acagccgggg caatcgcttg agtcgactgt ccaaacatgg 1020

tttaagccgc ttgcttacgc ttttattctc acaagggaat ctggataccc tcaggttttc 1080

tacggggata tgtacgggac gaaaggagac tcccagcgcg aaattcctgc cttgaaacac 1140

aaaattgaac cgatcttaaa agcgagaaaa cagtatgcgt acggagcaca gcatgattat 1200

ttcgaccacc atgacattgt cggctggaca agggaaggcg acagctcggt tgcaaattca 1260

ggtttggcgg cattaataac agacggaccc ggtggggcaa agcgaatgta tgtcggccgg 1320

caaaacgccg gtgagacatg gcatgacatt accggaaacc gttcggagcc ggttgtcatc 1380

aattcggaag gctggggaga gtttcacgta aacggcgggt cggtttcaat ttatgttcaa 1440

agataa 1446

<210>2

<211>481

<212>DNA

<213>B. licheniformis

<220>

<223> α Amylase amino acid sequence of licheniformis

<400>2

Val Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Tyr Thr Pro Asn Asp

1 510 15

Gly Gln His Trp Lys Arg Leu Gln Asn Asp Ala Glu His Leu Ser Asp

20 25 30

Ile Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Tyr Lys Gly Thr Ser

35 40 45

Gln Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu Gly Glu

50 55 60

Phe His Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys Gly Glu

65 70 75 80

Leu Gln Ser Ala Ile Lys Ser Leu His Ser Arg Asp Ile Asn Val Tyr

85 90 95

Gly Asp Val Val Ile Asn His Lys Gly Gly Ala Asp Ala Thr Glu Asp

100 105 110

Val Thr Ala Val Glu Val Asp Pro Ala Asp Arg Asn Arg Val Ile Ser

115 120 125

Gly Glu His Leu Ile Lys Ala Trp Thr His Phe His Phe Pro Gly Arg

130 135 140

Gly Ser Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe Asp Gly

145 150 155 160

Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg Ile Tyr Lys Phe Gln

165 170 175

Gly Lys Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn Tyr Asp

180 185 190

Tyr Leu Met Tyr Ala Asp Ile Asp Tyr Asp His Pro Asp Val Ala Ala

195 200 205

Glu Ile Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gln Leu Asp

210 215 220

Gly Phe Arg Leu Asp Ala Val Lys His Ile Lys Phe Ser Phe Leu Arg

225 230 235 240

Asp Trp Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met Phe Thr

245 250 255

Val Ala Glu Tyr Trp Gln Asn Asp Leu Gly Ala Leu Glu Asn Tyr Leu

260 265 270

Asn Lys Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu His Tyr

275 280 285

Gln Phe His Ala Ala Ser Thr Gln Gly Gly Gly Tyr Asp Met Arg Lys

290 295 300

Leu Leu Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser Val Thr

305 310 315 320

Phe Val Asp Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu Ser Thr

325 330335

Val Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe Ile Leu Thr Arg

340 345 350

Glu Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met Tyr Gly Thr Lys

355 360 365

Gly Asp Ser Gln Arg Glu Ile Pro Ala Leu Lys His Lys Ile Glu Pro

370 375 380

Ile Leu Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Ala Gln His Asp Tyr

385 390 395 400

Phe Asp His His Asp Ile Val Gly Trp Thr Arg Glu Gly Asp Ser Ser

405 410 415

Val Ala Asn Ser Gly Leu Ala Ala Leu Ile Thr Asp Gly Pro Gly Gly

420 425 430

Ala Lys Arg Met Tyr Val Gly Arg Gln Asn Ala Gly Glu Thr Trp His

435 440 445

Asp Ile Thr Gly Asn Arg Ser Glu Pro Val Val Ile Asn Ser Glu Gly

450 455 460

Trp Gly Glu Phe His Val Asn Gly Gly Ser Val Ser Ile Tyr Val Gln

465 470 475 480

Arg

<210>3

<211>1452

<212>DNA

<213> Artificial sequence

<220>

<223> α nucleotide coding sequence of amylase variant 1

<400>3

gatgggctga atggcacgct catgcagtat tttgaatggt atactccgaa cgacggccag 60

cattggaaac ggttgcagaa tgatgcggaa catttgtcgg atatcggtat tactgccgtc 120

tggattcccc cggcatataa gggaacgagc caagcggatg tgggctacgg tgcttacgac 180

ctttatgatt taggggagtt tcatcaaaaa gggacggttc ggacaaagta cggcacaaaa 240

ggagagctgc aatctgcgat caaaagtctt cattcccgcg acattaacgt ttacggggat 300

gtggtcatca accacaaagg cggcgctgat gcgaccgaag atgtaaccgc ggttgaagtc 360

gatcccgctg accgcaaccg cgtaatttca ggagaacacc taattaaagc ctggacacat 420

tttcattttc cggggcgcgg cagcacatac agcgatttta aatggcattg gtaccatttt 480

gacggaaccg attgggacga gtcccgaaag ctgaaccgca tctataagtt tcaaggaaag 540

gcttgggatt gggaagtttc caatgaaaac ggcaactatg attatttgat gtatgccgac 600

atcgattatg accatcctga tgtcgcagca gaaattaaga gatggggcac ttggtatgcc 660

aatgaactgc aattggacgg tttccgtctt gatgctgtca aacacattaa attttctttt 720

ttgcgggatt gggttaatca tgtcagggaa aaaacgggga aggaaatgtt tacggtagct 780

gaatattggc agaatgactt gggcgcgctg gaaaactatt tgaacaaaac aaattttaat 840

cattcagtgt ttgacgtgcc gcttcattat cagttccatg ctgcatcgac acagggaggc 900

ggctatgata tgaggaaatt gctgaacggt acggtcgttt ccaagcatcc gttgaaatcg 960

gttacatttg tcgataacca tgatacacag ccggggcaat cgcttgagtc gactgtccaa 1020

acatggttta agccgcttgc ttacgctttt attctcacaa gggaatctgg ataccctcag 1080

gttttctacg gggatatgta cgggacgaaa ggagactccc agcgcgaaat tcctgccttg 1140

aaacacaaaa ttgaaccgat cttaaaagcg agaaaacagt atgcgtacgg agcacagcat 1200

gattatttcg accaccatga cattgtcggc tggacaaggg aaggcgacag ctcggttgca 1260

aattcaggtt tggcggcatt aataacagac ggacccggtg gggcaaagcg aatgtatgtc 1320

ggccggcaaa acgccggtga gacatggcat gacattaccg gaaaccgttc ggagccggtt 1380

gtcatcaatt cggaaggctg gggagagttt cacgtaaacg gcgggtcggt ttcaatttat 1440

gttcaaagat aa 1452

<210>4

<211>483

<212>PRT

<213> Artificial sequence

<220>

<223> α amino acid sequence of amylase variant 1

<400>4

Asp Gly Leu Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Tyr Thr Pro

1 5 10 15

Asn Asp Gly Gln His Trp Lys Arg Leu Gln Asn Asp Ala Glu His Leu

20 25 30

Ser Asp Ile Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Tyr Lys Gly

35 40 45

Thr Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu

50 55 60

Gly Glu Phe His Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys

65 70 75 80

Gly Glu Leu Gln Ser Ala Ile Lys Ser Leu His Ser Arg Asp Ile Asn

85 90 95

Val Tyr Gly Asp Val Val Ile Asn His Lys Gly Gly Ala Asp Ala Thr

100 105 110

Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp Arg Asn Arg Val

115 120 125

Ile Ser Gly Glu His Leu Ile Lys Ala Trp Thr His Phe His Phe Pro

130 135 140

Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe

145 150 155 160

Asp Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg Ile Tyr Lys

165 170 175

Phe Gln Gly Lys Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn

180 185 190

Tyr Asp Tyr Leu Met Tyr Ala Asp Ile Asp Tyr Asp His Pro Asp Val

195200 205

Ala Ala Glu Ile Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gln

210 215 220

Leu Asp Gly Phe Arg Leu Asp Ala Val Lys His Ile Lys Phe Ser Phe

225 230 235 240

Leu Arg Asp Trp Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met

245 250 255

Phe Thr Val Ala Glu Tyr Trp Gln Asn Asp Leu Gly Ala Leu Glu Asn

260 265 270

Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu

275 280 285

His Tyr Gln Phe His Ala Ala Ser Thr Gln Gly Gly Gly Tyr Asp Met

290 295 300

Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser

305 310 315 320

Val Thr Phe Val Asp Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu

325 330 335

Ser Thr Val Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe Ile Leu

340 345 350

Thr Arg Glu Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met Tyr Gly

355360 365

Thr Lys Gly Asp Ser Gln Arg Glu Ile Pro Ala Leu Lys His Lys Ile

370 375 380

Glu Pro Ile Leu Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Ala Gln His

385 390 395 400

Asp Tyr Phe Asp His His Asp Ile Val Gly Trp Thr Arg Glu Gly Asp

405 410 415

Ser Ser Val Ala Asn Ser Gly Leu Ala Ala Leu Ile Thr Asp Gly Pro

420 425 430

Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gln Asn Ala Gly Glu Thr

435 440 445

Trp His Asp Ile Thr Gly Asn Arg Ser Glu Pro Val Val Ile Asn Ser

450 455 460

Glu Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser Val Ser Ile Tyr

465 470 475 480

Val Gln Arg

<210>5

<211>873

<212>DNA

<213> Artificial sequence

<220>

<223> synthetic promoter sequence

<400>5

ggtaccagct attgtaacat aatcggtacg ggggtgaaaa agctaacgga aaagggagcg 60

gaaaagaatg atgtaagcgt gaaaaatttt ttatcttatc acttgaaatt ggaagggaga 120

ttctttatta taagaaaacg gatgctgaag gaaggaaacg aagtcggcaa ccattcctgg 180

gaccatccgt tattgacaag gctgtcaaat gaaaaagcgt atcaggagat taacgacacg 240

caagaaatga tcgaaaaaat cagcggacac ctgcctgtac acttgcgtcc tccatacggc 300

gggatcaatg attccgtccg ctcgctttcc aatctgaagg tttcattgtg ggatgttgat 360

ccggaagatt ggaagtacaa aaataagcaa aagattgtca atcatgtcat gagccatgcg 420

ggagacggaa aaatcgtctt aatgcacgat atttatgcaa cgtccgcaga tgctgctgaa 480

gagattatta aaaagctgaa agcaaaaggc tatcaattgg taactgtatc tcagcttgaa 540

gaagtgaaga agcagagagg ctattgaata aatgagtaga aagcgccata tcggcgcttt 600

tcttttggaa gaaaatatag ggaaaatggt atttgttaaa aattctgaat atttatacaa 660

tatcatatgt ttcacaggga ggagaatcgg ccttaagggc ctgcaatcga ttgtttgaga 720

aaagaagaag accataaaaa taccttgtct gtcatcagac agggtatttt ttatgctgtc 780

cagactgtcc gctgtgtaaa aaaaaggaat aaaggggggt tgacattatt ttactgatat 840

gtataatata atttgtataa gaaaatggag ctc 873

<210>6

<211>98

<212>DNA

<213> Artificial sequence

<220>

<223> synthetic termination sequence

<400>6

tcaataataa taacgctgtg tgctttaagc acacagcgtt ttttagtgtg tatgaatcga 60

gatcctgagc gccggtcgct accattacca gttggtct 98

<210>7

<211>96

<212>DNA

<213> Artificial sequence

<220>

<223> Natural Signal sequence

<400>7

atgattcaaa aacgaaagcg gacagtttcg ttcagacttg tgcttatgtg cacgctgtta 60

tttgtcagtt tgccgattac aaaaacatca gccgca 96

Sequence listing

4

Claims

1. An α amylase variant, characterized in that the amino acid sequence of α amylase variant is shown as SEQ ID NO.4 in the sequence table.

2. The α amylase variant of claim 1, wherein the nucleotide coding sequence of the α amylase variant is set forth as SEQ ID No.3 of the sequence listing.

3. A gene encoding the α amylase variant of any one of claims 1-2.

4. The gene according to claim 3, characterized in that the nucleotide sequence is represented by SEQ ID No.3 of the sequence Listing.

5. An expression vector for expressing the α amylase variant of any one of claims 1-2, wherein the expression vector comprises an expression module consisting essentially of a promoter sequence shown in SEQ ID No.5, a natural or synthetic ribosome binding site aaaggag, a α amylase variant-encoding gene sequence shown in SEQ ID No.3, and a synthetic terminator sequence shown in SEQ ID No.6, and a natural signal sequence shown in SEQ ID No.7 inserted upstream of the α amylase variant-encoding gene promoter.

6. A recombinant cell for expressing the α amylase variant of any one of claims 1-2, comprising the expression vector of claim 5, wherein the host cell of the recombinant cell is selected from B.

7. A method for producing the α amylase variant of any one of claims 1-2, comprising culturing the recombinant cell of claim 6 under conditions suitable for expression of α amylase variant, and obtaining the α amylase variant from the recombinant cell or a culture supernatant thereof.

8. The α amylase variant of any one of claims 1-2, for use in hydrolyzing α -1,4 glycosidic linkages of a polysaccharide.

9. The use according to claim 8, wherein the α amylase variant is used for hydrolyzing α -1,4 glycosidic linkages of polysaccharides under conditions of high temperature and/or low pH.

10. The use according to claim 9, wherein the elevated temperature is from 80 ℃ to 110 ℃.

11. The use according to claim 10, wherein said elevated temperature is in the range of 100 ℃ to 110 ℃.

12. The use according to claim 9, wherein the low pH is from 5.0 to 5.8.