CN107312863A - The method that the Ig gene distributions of bone-marrow-derived lymphocyte are identified using digital pcr - Google Patents
The method that the Ig gene distributions of bone-marrow-derived lymphocyte are identified using digital pcr Download PDFInfo
- Publication number
- CN107312863A CN107312863A CN201710669647.7A CN201710669647A CN107312863A CN 107312863 A CN107312863 A CN 107312863A CN 201710669647 A CN201710669647 A CN 201710669647A CN 107312863 A CN107312863 A CN 107312863A
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- kinds
- gene
- copy number
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method of the Ig gene distributions of utilization digital pcr identification bone-marrow-derived lymphocyte.This method includes：1) five sets of primers are designed according to 5 kinds of Ig heavy chain C areas, often covers and reverse transcription primer, amplimer and/or taqman probes are included in primer；Reverse transcription primer is identical with increasing the anti-sense primer in primer；2) 5 parts of RNA of same sample to be tested equivalent, reverse transcription obtains the original copy number of corresponding Ig genes in 5 parts of cDNA into progress digital pcr detection after cDNA, calculates the copy number distribution of 5 kinds of Ig genes in sample to be tested.The inventive method can identify the expression of five kinds of Ig genes and in the absence of preference sex chromosome mosaicism, can react five kinds of Ig of original sample ratio.The present invention can verify that sequencing result whether there is Preference with digital pcr technical appraisement Ig gene distributions, and the correction of Preference is expanded beneficial to primer.The accuracy of Ig ratios contributes to the researchs such as disease immune reaction, vaccine assessment.
Description
Technical field
The invention belongs to biological technical field, it is related to a kind of Ig gene distributions of utilization digital pcr identification bone-marrow-derived lymphocyte
Method.
Background technology
Digital pcr (Digital PCR, dPCR) technology is a kind of new detection of nucleic acids and quantitative approach, using definitely fixed
Amount, independent of standard curve or reference gene, has higher sensitivity than traditional Realtime PCR.By the way that micro- sample is carried out
Multiple dilutes and point liquid, until testing molecule number contained in each sample is not over one, then by all samples in phase
Enter performing PCR amplification with the conditions of, the sample for comprising only a target molecule can be measured.It can be visited with dye method or Taqman
The skill of handling needles enters performing PCR amplification, and interpretation of result is carried out according to the fluorescence signal of reaction.Due to the Method And Principle and height of its absolute quantitation
Sensitive Detection characteristic, dPCR can be applied to different fields：Copy number variation, abrupt climatic change, gene relative expression research, two
For sequencing result checking, miRNA expression analysis, unicellular gene expression analysis etc..Its advantage is mainly manifested in：1st, for rare
Target molecule and the detection of mutation, accurately sensitive can be carried out.Noninvasive (in the autoblood, cast-off cells) in-vitro diagnosis of such as disease
Tumour nucleic acid markers high resolution detection in examination technology, body fluid (blood, urine, excrement etc.).Due to body fluid (blood, urine,
Excrement etc.) in or noninvasive sample (in autoblood, cast-off cells), contained target detection molecule is few, and is carried on the back in normal somatic cell
Scape signal is extremely strong, and dPCR technologies can effectively reduce the interference of background by milligram ammonia, while extremely Sensitive Detection is to low
The target molecule of content.Have at present using dPCR technology：Tumor-targeting drug genetic test, the inspection of cancerous swelling molecular labeling
Survey, the noninvasive technology such as antenatal.2nd, pathogenic microorganism is highly sensitive qualitative and quantitative detection.Under common detection methods, there is pole
Small part pathogenic microorganism result is rendered as " weakly positive ".Mainly due to these routine techniques when low-copy is detected, due to
Method limitation can not be detected.And high sensitivity and specific detection can be then carried out to the part sample by dPCR technologies,
Quantitative analysis can be carried out to pathogenic microorganism carrying capacity simultaneously.3rd, laboratory standard product absolute content is detected.Molecular biology is real
In testing, often need to quantify various intermediate products and other nucleic acid molecules.And the standard items used in these dosing process
Doubling dilution after content is surveyed typically by ultra-violet light-emitting or dye method, during operation understand extreme influence standard items
Accuracy and subsequent experimental.By dPCR high sensitivity absolute quantitation, accurately detection or right can be carried out to standard items content
Sample directly carries out absolute quantitation.
Ripe bone-marrow-derived lymphocyte antibody gene is constituted after VDJ gene rearrangements, as shown in figure 1, the VDJ genes after resetting
It is followed by constant region gene C.V genes are divided into five regions of FR1, CDR1, FR2, CDR2, FR3, V Gene Partials area according to function
Domain and D genes (light chain is without D genes), J Gene Partials region, radom insertion fragment (N) composition CDR3 regions.To genomic DNA
For, there is introne between J genes and C genes, for the ripe mRNA of expression, the introne of J genes and C genes
It is sheared, J genes and C genes such as Fig. 1 link together.The heavy chain embryonal system of human immunoglobulin(HIg) (immunoglobulin, Ig)
The assignment of genes gene mapping is made up of in No. 14 chromosome long arm tetra- kinds of genetic fragments of V, D, J, C, includes 40 VH genetic fragments, 25 D
Genetic fragment, 6 JH genetic fragments and 9 CH genetic fragments.B cell is contacted after different antigenic stimulus, the expression of IgC areas gene
Situation occurs specifically to sexually revise, and occurs producing Ig such as IgG, IgA or IgE beyond IgM in succession.Class switch will occur for Ig genes
Or isotype conversion produces a variety of different classes of Ig.Ig species is five kinds altogether, be respectively IgA, IgM, IgG, IgD,
IgE, C gene determine Ig classification.
At present, the VC regions in bone-marrow-derived lymphocyte Ig genes can be expanded using immune group storehouse technology.And for B lymphs
For cell Ig heavy chain genes, amplification VC regions are more more valuable than VJ region, and C areas can react five kinds of Ig ratio and change feelings
Condition.Generally have to design multipair V primers in the database technology of immune group storehouse and C primers carry out multiplex PCR or a plurality of C of design draws
Thing carries out that during 5 ' race build storehouse, such PCR Preference can be produced, and the accuracy of subsequent analysis is influenceed, particularly to five kinds
The analysis of Ig ratios.It can not determine whether to produce Preference, can not also obtain that specifically which primer produces Preference, it is impossible to pin
Primer ratio adjustment is carried out to property, it is impossible to verify whether Ig gene datas analysis result is reliable, lack a kind of evaluation PCR preferences
The technological means of property.
The content of the invention
It is an object of the invention to provide a kind of method of the Ig gene distributions of utilization digital pcr identification bone-marrow-derived lymphocyte.
The copy number distribution of 5 kinds of Ig of utilization digital pcr identification bone-marrow-derived lymphocyte provided by the present invention C areas gene
Method, it may include following steps：
(A1) five sets of primers are designed according to 5 kinds of Ig C areas gene order, often covers and reverse transcription primer is included in primer, is used for
Expand the amplimer and taqman probes of C areas gene.
Wherein, the sequence of the reverse transcription primer and the downstream primer sequence in the amplimer both can with identical,
Can be different.
(A2) 5 parts of RNA from same person under inspection's equivalent are fetched as sample to be tested, every part of a set of primer of RNA correspondences is adopted
With the reverse transcription primer by the RNA reverse transcriptions into cDNA；Using the amplimer and the taqman probes to described
CDNA does digital pcr detection, so as to obtain the original copy number of corresponding Ig C areas gene in 5 parts of cDNA samples, and then calculates institute
State the copy number distribution of 5 kinds of Ig of person under inspection's bone-marrow-derived lymphocyte C areas gene.
In one embodiment of the invention, five sets of primers are specific as follows：
(B1) it is directed to IgE C areas gene：The sequence of the reverse transcription primer is as shown in sequence 1 in sequence table；The amplification
The primer pair that primer constitutes for the sequence 1 in sequence table and two single strand dnas shown in sequence 6；The taqman probes
Sequence as shown in sequence 15 in sequence table；
(B2) it is directed to IgM C areas gene：The sequence of the reverse transcription primer is as shown in sequence 2 in sequence table；The amplification
The primer pair that primer constitutes for the sequence 2 in sequence table and two single strand dnas shown in sequence 7；The taqman probes
Sequence as shown in sequence 12 in sequence table；
(B3) it is directed to IgD C areas gene：The sequence of the reverse transcription primer is as shown in sequence 3 in sequence table；The amplification
The primer pair that primer constitutes for the sequence 3 in sequence table and two single strand dnas shown in sequence 8；The taqman probes
Sequence as shown in sequence 14 in sequence table；
(B4) it is directed to IgA C areas gene：The sequence of the reverse transcription primer is as shown in sequence 4 in sequence table；The amplification
The primer pair that primer constitutes for the sequence 4 in sequence table and two single strand dnas shown in sequence 9；The taqman probes
Sequence as shown in sequence 11 in sequence table；
(B5) it is directed to IgG C areas gene：The sequence of the reverse transcription primer is as shown in sequence 5 in sequence table；The amplification
The primer pair that primer constitutes for the sequence 5 in sequence table and two single strand dnas shown in sequence 10；The taqman probes
Sequence as shown in sequence 13 in sequence table.
The end of taqman probes 5 ' is marked with fluorophor, such as FAM.The end of taqman probes 3 ', which is marked with, is quenched base
Group, such as BQH1.
In the process, concretely extracted as the RNA of the sample to be tested from person under inspection's peripheral blood
RNA。
Application of the methods described in following falls within protection scope of the present invention：The PCR sequencing PCR inspection of identification and utilization immune group storehouse
The multiplexed PCR amplification primer used during the copy number distribution for the C areas gene for surveying 5 kinds of Ig of bone-marrow-derived lymphocyte is with the presence or absence of amplification
Preference.
Present invention also offers a kind of 5 kinds of Ig of identification and utilization immune group storehouse PCR sequencing PCR detection bone-marrow-derived lymphocyte C areas gene
Copy number distribution when the multiplexed PCR amplification primer that is used with the presence or absence of amplification Preference method.
Identification and utilization immune group storehouse PCR sequencing PCR provided by the present invention detects copying for 5 kinds of Ig of bone-marrow-derived lymphocyte C areas gene
Method of the multiplexed PCR amplification primer that shellfish number is used when being distributed with the presence or absence of amplification Preference, it may include following steps：
(C1) (copy number point of 5 kinds of Ig of bone-marrow-derived lymphocyte C areas gene is identified using digital pcr using the above method
The method of cloth) detection person under inspection's bone-marrow-derived lymphocyte 5 kinds of Ig C areas gene copy number distribution；
(C2) copy number of 5 kinds of Ig of person under inspection's bone-marrow-derived lymphocyte C areas gene is detected using immune group storehouse PCR sequencing PCR
Distribution；
(C3) it is thin using immune group storehouse PCR sequencing PCR detection B lymphs according to being identified below according to the testing result of (C1) and (C2)
The multiplexed PCR amplification primer used during the copy number distribution of 5 kinds of Ig of born of the same parents C areas gene is with the presence or absence of amplification Preference：If
(C1) the copy number distribution situation of 5 kinds of Ig of gained person under inspection's bone-marrow-derived lymphocyte C areas gene described in (C2) gained with being examined
The copy number distribution situation of 5 kinds of Ig of person's bone-marrow-derived lymphocyte C areas gene is consistent, then utilizes immune group storehouse PCR sequencing PCR detection B lymphs
Amplification Preference is not present in the multiplexed PCR amplification primer used during the copy number distribution of 5 kinds of Ig of cell C areas gene；Instead
It, then what is used when being distributed using the copy number of 5 kinds of Ig of immune group storehouse PCR sequencing PCR detection bone-marrow-derived lymphocyte C areas gene is more
There is amplification Preference in weight pcr amplification primer thing.
Application of the two methods described previously in following falls within protection scope of the present invention：To being surveyed using immune group storehouse
There are many of amplification Preference in the script used during the copy number distribution of 5 kinds of Ig of sequence method detection bone-marrow-derived lymphocyte C areas gene
The consumption and/or proportioning of weight pcr amplification primer thing are adjusted, and to correct the amplification Preference existed originally, reach Preference
Minimum, thus in accurate response original sample 5 kinds of Ig of bone-marrow-derived lymphocyte C areas gene expression distribution proportion.
Five sets of primers as described above are also claimed in the present invention, and this five sets of primers are drenched using digital pcr identification B
Application in the copy number distribution situation of 5 kinds of Ig of bar cell C areas gene.
When the present invention proposes that one kind can verify amplification C genes, using the PCR of multipair primer with the presence or absence of amplification Preference
Technology.This method does RNA reversions using a primer respectively, and pair of primers expands cDNA Ig genes, and process is not present many
The Preference interacted to primer amplification efficiency.And use sonde method dPCR accurate quantifications cDNA copy number, data knot
Fruit is reliable.The expression quantity of 5 kinds of Ig C areas gene in C genes can be accurately reacted, so as to verify that high flux immune group storehouse is multiple
The accuracy that C areas primer is expanded in PCR, makes the data results of sequencing more credible.It is high there is provided a kind of effective, degree of accuracy
Method validation sequencing data in 5 kinds of Ig C areas gene expression quantity whether there is Preference, be that the primer in multiplex PCR is
It is no that Preference offer strong evidence is present.The accuracy of Ig ratios contributes to the researchs such as disease immune reaction, vaccine assessment.
Brief description of the drawings
Fig. 1 is VDJ gene rearrangements.
Fig. 2 is the techniqueflow chart that dPCR identifies bone-marrow-derived lymphocyte Ig gene distributions.
Fig. 3 is the cDNA copy numbers of Ig genes in 5 after droplet analyzer is analyzed.Each figure be followed successively by IGHA, IGHM, IGHG,
IGHD、IGHE。
Fig. 4 is the copy number form that shows in droplet type analyzer.
Fig. 5 is the copy number distribution map of the C areas gene for the Ig that immune group storehouse PCR sequencing PCR is obtained.
Fig. 6 is the copy number distribution map of the C areas gene for the Ig that immune group storehouse PCR sequencing PCR is obtained.
Fig. 7 is the copy number distribution map for the C areas gene that digital pcr identifies Ig.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
Embodiment 1, the Ig gene distributions using digital pcr identification bone-marrow-derived lymphocyte
First, techniqueflow
As shown in Fig. 2 designing five sets of primers according to 5 kinds of Ig C areas gene order first, often cover and reverse transcription is included in primer
Primer, amplimer and taqman probes for expanding C areas gene；Wherein, the sequence of the reverse transcription primer expands with described
The downstream primer sequence increased in primer is identical.Primer sequence is as shown in table 1 to table 3.
The reverse transcription primer of 15 kinds of Ig of table C areas gene order
| IGHER | CCCACGCACCCGAGAC (sequence 1) |
| IGHMR | GTGAGGTGGCTGCGTACTTGC (sequence 2) |
| IGHDR | CCACGCATTTGTACTCGC (sequence 3) |
| IGHAR | GGGCAGGGCACAGTCACATCC (sequence 4) |
| IGHGR | GGAAGGTGTGCACGCCGCTGGTC (sequence 5) |
The amplimer of 25 kinds of Ig of table C areas gene order
| IGHEF | Gtcttccccttgacccgct (sequence 6) |
| IGHMF | Ctgtgagaattccccgtcgga (sequence 7) |
| IGHDF | Catcatatcagggtgcagacac (sequence 8) |
| IGHAF | Gtggtcrtcgcmtgcctggt (sequence 9) |
| IGHGF | Gtcttccccctggcrccct (sequence 10) |
| IGHER | CCCACGCACCCGAGAC (sequence 1) |
| IGHMR | GTGAGGTGGCTGCGTACTTGC (sequence 2) |
| IGHDR | CCACGCATTTGTACTCGC (sequence 3) |
| IGHAR | GGGCAGGGCACAGTCACATCC (sequence 4) |
| IGHGR | GGAAGGTGTGCACGCCGCTGGTC (sequence 5) |
The taqman probes of 35 kinds of Ig of table C areas gene order
| ddHA | CCGCTTTCGCTCCAGGTCACACT (sequence 11) | 5'-FAM；3'-BQH1 |
| ddHM | Aagccccgggtrctgctga (sequence 12) | 5'-FAM；3'-BQH1 |
| ddHG | Aggactacttcccmgaaccggtg (sequence 13) | 5'-FAM；3'-BQH1 |
| ddHD | TACCACCCAACGTCCGTGACT (sequence 14) | 5'-FAM；3'-BQH1 |
| ddHE | CCCTCCAATGCCACCTCCGTGACT (sequence 15) | 5'-FAM；3'-BQH1 |
Then the peripheral blood 1-2ml of people is extracted, RNA is extracted.Take respectively in the RNA samples of 5 parts of equivalent, embodiment with 0.5 μ
Exemplified by g.Respectively cDNA is reversed to the C areas specific reverse transcription primer in table 1.The cDNA of same volume is taken to be dPCR.
Utilize Bio-Rad models QX200TMDigital pcr instrument, instrument and droplet analyzer are generated by droplet and constituted.Using oil
Bag water droplet type emulsifying technology, in a reaction tube internal emulsification into up to ten thousand independent PCR reactors, so as to realize digital pcr
Technology.One sample produces 20000 droplets, and each droplet volume is 1nl, and instrument can once detect 96 samples, sensitivity
A ten thousandth.Use Bio-rad droplet types digital pcr (dPCR) sonde method kit Droplet PCR Supermix (article No.s
1863024), system such as table 4 below, is put into automation generation droplet on droplet generation instrument.PCR service conditions be 95 DEG C 10 minutes,
94 DEG C 30 seconds, 56 DEG C 1 minute, 98 DEG C 10 minutes, 4 DEG C of preservations, the 2nd and the 3rd step is circulated 40 times, and temperature raising and lowering gradient is
2℃/S.Sample is put on droplet analyzer, analyzed with QuantaSoft, cDNA points in each hole can be finally shown
Sub- copy number.
The sonde method dPCR systems of table 4
| Reagent component | Volume (μ l) |
| Mix | 11 |
| Primer (5 μM) | 2.2 |
| Probe (10 μM) | 1.1 |
| CDNA samples | 1-7.7 |
| Water | Mend to 22 μ l |
| Amount to | 22 |
2nd, result
Fig. 3 is the cDNA copy numbers of Ig genes in 5 after droplet analyzer is analyzed, it is illustrated that be followed successively by IGHA, IGHM, IGHG,
IGHD、IGHE.It is IGHA, IGHM, IGHG due to accounting for most immunoglobulin in human body, IGHD, IGHE content are seldom.In
It is to take in the cDNA of same volume, IGHA, IGHM, IGHG cDNA dilute 20 times, and IGHD, IGHE do not dilute.Sample is dense
Du Taigao may result in ddPCR failures, and possible droplet number is too many, as a result also can be inaccurate.Table 5 is the expression of 5 kinds of Ig genes
Measure, and the ratio for calculating 5 kinds of Ig gene expression amounts in respective copy number is distributed, blue point is the droplet for having fluorescence signal
Number.The visible Fig. 4 of copy number form shown in droplet type analyzer.
The cDNA copy numbers of 55 kinds of Ig heavy chain C areas genes of table
| Target area | 20 × cDNA concentration (copy number/μ l) | CDNA concentration (copy number/μ l) | Percentage |
| IGHA | 787 | 15740 | 70% |
| IGHM | 71.2 | 1424 | 6% |
| IGHG | 218 | 4360 | 20% |
| IGHD | Nothing | 825 | 4% |
| IGHE | Nothing | 14.9 | 0% |
In addition, the present inventor, which carries out immune group storehouse with above-mentioned DNA sample, builds storehouse sequencing, Fig. 5 and Fig. 6 are immune
The copy number distribution map of the C areas gene for the Ig that group storehouse PCR sequencing PCR is obtained, Fig. 7 is the copy number for the C areas gene that digital pcr identifies Ig
Distribution map.Fig. 5 and Fig. 6 are that this set primer used in two sets of different primers, Fig. 6 is document Lineage Structure of
the Human Antibody Repertoire in Response to Influenza VaccinationNing Jiang
Et al.Sci Transl Med 5,171ra19 (2013) report, to C gene distributions the drawing without obvious preference of Ig heavy chains
Thing.Fig. 5 is compared with Fig. 7, and the primer that Fig. 5 is used has obvious amplification preference, it is impossible to reflect the expression quantity of original Ig genes.
Fig. 6 is compared with Fig. 7, and the distribution results of the copy number of both Ig C areas gene are than more consistent.
<110>BGI-Shenzhen
<120>The method that the Ig gene distributions of bone-marrow-derived lymphocyte are identified using digital pcr
<130> GNCLN171539
<160> 15
<170> PatentIn version 3.5
<210> 1
<211> 16
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 1
cccacgcacc cgagac 16
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 2
gtgaggtggc tgcgtacttg c 21
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 3
ccacgcattt gtactcgc 18
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 4
gggcagggca cagtcacatc c 21
<210> 5
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 5
ggaaggtgtg cacgccgctg gtc 23
<210> 6
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 6
gtcttcccct tgacccgct 19
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 7
ctgtgagaat tccccgtcgg a 21
<210> 8
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 8
catcatatca gggtgcagac ac 22
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (7)..(7)
<223>R is g or a
<220>
<221> misc_feature
<222> (12)..(12)
<223>M is a or c
<400> 9
gtggtcrtcg cmtgcctggt 20
<210> 10
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (15)..(15)
<223>R is g or a
<400> 10
gtcttccccc tggcrccct 19
<210> 11
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 11
ccgctttcgc tccaggtcac act 23
<210> 12
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (12)..(12)
<223>R is g or a
<400> 12
aagccccggg trctgctga 19
<210> 13
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (14)..(14)
<223>M is a or c
<400> 13
aggactactt cccmgaaccg gtg 23
<210> 14
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 14
taccacccaa cgtccgtgac t 21
<210> 15
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 15
ccctccaatg ccacctccgt gact 24
Claims (8)
1. a kind of method of the copy number distribution of 5 kinds of Ig of utilization digital pcr identification bone-marrow-derived lymphocyte C areas gene, including it is as follows
Step：
(A1) five sets of primers are designed according to 5 kinds of Ig C areas gene order, often covered in primer comprising reverse transcription primer, for expanding C
The amplimer and taqman probes of area's gene；
(A2) 5 parts of RNA from same person under inspection's equivalent are fetched as sample to be tested, every part of a set of primer of RNA correspondences, using institute
Reverse transcription primer is stated by the RNA reverse transcriptions into cDNA；Using the amplimer and the taqman probes to the cDNA
Do digital pcr detection, so as to obtain the original copy number of corresponding Ig C areas gene in 5 parts of cDNA samples, and then calculate it is described by
The copy number distribution of 5 kinds of Ig of inspection person's bone-marrow-derived lymphocyte C areas gene.
2. according to the method described in claim 1, it is characterised in that：Five sets of primers are as follows：
(B1) it is directed to IgE C areas gene：The sequence of the reverse transcription primer is as shown in sequence 1 in sequence table；The amplimer
The primer pair constituted for the sequence 1 in sequence table and two single strand dnas shown in sequence 6；The sequence of the taqman probes
Row are as shown in sequence 15 in sequence table；
(B2) it is directed to IgM C areas gene：The sequence of the reverse transcription primer is as shown in sequence 2 in sequence table；The amplimer
The primer pair constituted for the sequence 2 in sequence table and two single strand dnas shown in sequence 7；The sequence of the taqman probes
Row are as shown in sequence 12 in sequence table；
(B3) it is directed to IgD C areas gene：The sequence of the reverse transcription primer is as shown in sequence 3 in sequence table；The amplimer
The primer pair constituted for the sequence 3 in sequence table and two single strand dnas shown in sequence 8；The sequence of the taqman probes
Row are as shown in sequence 14 in sequence table；
(B4) it is directed to IgA C areas gene：The sequence of the reverse transcription primer is as shown in sequence 4 in sequence table；The amplimer
The primer pair constituted for the sequence 4 in sequence table and two single strand dnas shown in sequence 9；The sequence of the taqman probes
Row are as shown in sequence 11 in sequence table；
(B5) it is directed to IgG C areas gene：The sequence of the reverse transcription primer is as shown in sequence 5 in sequence table；The amplimer
The primer pair constituted for the sequence 5 in sequence table and two single strand dnas shown in sequence 10；The sequence of the taqman probes
Row are as shown in sequence 13 in sequence table.
3. method according to claim 1 or 2, it is characterised in that：It is to be examined from described as the RNA of the sample to be tested
The RNA extracted in person's peripheral blood.
4. application of any methods described in following in claim 1-3：Identification and utilization immune group storehouse PCR sequencing PCR detection B lymphs
The multiplexed PCR amplification primer used during the copy number distribution of 5 kinds of Ig of cell C areas gene is with the presence or absence of amplification Preference.
5. a kind of copy number distribution when institute of 5 kinds of Ig of identification and utilization immune group storehouse PCR sequencing PCR detection bone-marrow-derived lymphocyte C areas gene
The multiplexed PCR amplification primer of use comprises the following steps with the presence or absence of the method for amplification Preference：
(C1) 5 kinds of Ig of any described method detection person under inspection's bone-marrow-derived lymphocyte C areas gene in claim 1-3 is utilized
Copy number is distributed；
(C2) copy number point of 5 kinds of Ig of person under inspection's bone-marrow-derived lymphocyte C areas gene is detected using immune group storehouse PCR sequencing PCR
Cloth；
(C3) bone-marrow-derived lymphocyte is detected according to utilization immune group storehouse PCR sequencing PCR is identified below according to the testing result of (C1) and (C2)
The multiplexed PCR amplification primer used during the copy number distribution of 5 kinds of Ig C areas gene is with the presence or absence of amplification Preference：If (C1)
The copy number distribution situation of 5 kinds of Ig of gained person under inspection's bone-marrow-derived lymphocyte C areas gene and the person under inspection B obtained by (C2)
The copy number distribution situation of 5 kinds of Ig of lymphocyte C areas gene is consistent, then thin using immune group storehouse PCR sequencing PCR detection B lymphs
Amplification Preference is not present in the multiplexed PCR amplification primer used during the copy number distribution of 5 kinds of Ig of born of the same parents C areas gene；Conversely,
What is used when being then distributed using the copy number of 5 kinds of Ig of immune group storehouse PCR sequencing PCR detection bone-marrow-derived lymphocyte C areas gene is multiple
There is amplification Preference in pcr amplification primer thing.
6. application of any methods described or claim 5 methods described in following in claim 1-3：To utilizing immune group
There is amplification Preference in the script used during the copy number distribution of 5 kinds of Ig of storehouse PCR sequencing PCR detection bone-marrow-derived lymphocyte C areas gene
Multiplexed PCR amplification primer consumption and/or proportioning be adjusted, with correct originally exist amplification Preference.
7. primer set, it is characterised in that：The primer set is five sets of primers described in claim 2.
8. the primer set described in claim 7 identifies the copy of 5 kinds of Ig of bone-marrow-derived lymphocyte C areas gene in utilization digital pcr
Application in number distribution situation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710669647.7A CN107312863A (en) | 2017-08-08 | 2017-08-08 | The method that the Ig gene distributions of bone-marrow-derived lymphocyte are identified using digital pcr |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710669647.7A CN107312863A (en) | 2017-08-08 | 2017-08-08 | The method that the Ig gene distributions of bone-marrow-derived lymphocyte are identified using digital pcr |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107312863A true CN107312863A (en) | 2017-11-03 |
Family
ID=60175094
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710669647.7A Pending CN107312863A (en) | 2017-08-08 | 2017-08-08 | The method that the Ig gene distributions of bone-marrow-derived lymphocyte are identified using digital pcr |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107312863A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321569A (en) * | 2018-10-29 | 2019-02-12 | 凯杰（苏州）转化医学研究有限公司 | A kind of primer combination of probe object and its application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104080916A (en) * | 2011-09-19 | 2014-10-01 | 科马布有限公司 | Antibodies, variable domains & chains tailored for human use |
| CN104520440A (en) * | 2012-05-08 | 2015-04-15 | 适应生物技术公司 | Compositions and method for measuring and calibrating amplification bias in multiplexed pcr reactions |
| CN105555972A (en) * | 2013-07-25 | 2016-05-04 | 伯乐生命医学产品有限公司 | Genetic assays |
| CN106811516A (en) * | 2015-12-01 | 2017-06-09 | 杭州致远医学检验所有限公司 | A kind of molecular detecting method for examining and determine bacterium and human genome copy number ratio |
-
2017
- 2017-08-08 CN CN201710669647.7A patent/CN107312863A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104080916A (en) * | 2011-09-19 | 2014-10-01 | 科马布有限公司 | Antibodies, variable domains & chains tailored for human use |
| CN104520440A (en) * | 2012-05-08 | 2015-04-15 | 适应生物技术公司 | Compositions and method for measuring and calibrating amplification bias in multiplexed pcr reactions |
| CN105555972A (en) * | 2013-07-25 | 2016-05-04 | 伯乐生命医学产品有限公司 | Genetic assays |
| CN106811516A (en) * | 2015-12-01 | 2017-06-09 | 杭州致远医学检验所有限公司 | A kind of molecular detecting method for examining and determine bacterium and human genome copy number ratio |
Non-Patent Citations (3)
| Title |
|---|
| EDUARDO TAMAYO等: "Quantification of IgM molecular response by droplet digital PCR as a potential tool for the early diagnosis of sepsis", 《CRITICAL CARE》 * |
| YASUHIKO KIMOTO: "Yasuhiko Kimoto", 《GENES，CHROMOSOMES&CANCER》 * |
| 张黎等: "抗体组库技术研究进展", 《江苏预防医学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321569A (en) * | 2018-10-29 | 2019-02-12 | 凯杰（苏州）转化医学研究有限公司 | A kind of primer combination of probe object and its application |
| CN109321569B (en) * | 2018-10-29 | 2022-04-12 | 迈杰转化医学研究(苏州)有限公司 | Primer probe composition and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101410532B (en) | For detecting the urine gene expression ratios of cancer | |
| CN104198690B (en) | Lipoprotein analysis is carried out by differential charged-particle mobility | |
| WO2014018774A1 (en) | Screening, diagnosis and prognosis of autism and other developmental disorders | |
| CN108323184A (en) | Biomarker is verified to measure | |
| CN105861641A (en) | Primer, kit and method for detecting CHO cell DNA residues | |
| CN104619858B (en) | The Non-invaive examination of foetus health state | |
| CN107586776A (en) | Suitable for the plasmid control material of H7N9 avian influenza virus real-time fluorescence quantitative PCR detection | |
| CN106434996A (en) | Kit and method for detecting Acinetobacter baumannii DNA | |
| CN107312873B (en) | A kind of multiple liquid phase genetic chip detection primer, kit and method of 5 kinds of Respiratory Tract of Mice cause of diseases of quick differentiation | |
| Mucksová et al. | Simultaneous detection of chicken cytokines in plasma samples using the Bio-Plex assay | |
| CN103074452A (en) | Kit for synchronously detecting fifteen hemorrhagic fever pathogens and detection method of kit | |
| CN108603885A (en) | Diagnosis or the novel multiple analysis of disease or disorder in assessment mammal | |
| CN106191311A (en) | A kind of quick detection Cavia porcellus LCMV, SV, PVM, Reo 3 virus multiple liquid phase method for gene chip and reagent | |
| CN108449999A (en) | The method for infecting disease or the composition and checkout and diagnosis marker of its complication using color amide-tRNA synthesis enzymatic diagnosis | |
| CN105177127A (en) | Polynucleotide, method and kit for detecting listeria monocytogenes | |
| CN102892904B (en) | The comparative genomic hybridization array approach that before implanting, genetic screening is used | |
| CN109762932A (en) | Identify the detection primer and probe, kit and application of HP-PRRSV and NADC30-like strain | |
| CN107312863A (en) | The method that the Ig gene distributions of bone-marrow-derived lymphocyte are identified using digital pcr | |
| CN109652510A (en) | Detect primer, probe and the method and kit of BAALC gene relative expression quantity in sample | |
| Wang | Molecular Epidemiology | |
| CN105002295A (en) | Polynucleotide, method and kit for detecting Bacillus anthraci | |
| Shan et al. | Rapid on-site PEDV detection using homogeneous fluorescence resonance energy transfer-based ELISA | |
| RU2696114C2 (en) | Diagnostic technique for breast cancer and ovarian cancer | |
| Roh et al. | Simultaneous detection of five major serotypes of Avian coronavirus by a multiplex microsphere-based assay | |
| US20220148690A1 (en) | Immunorepertoire wellness assessment systems and methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171103 |