CN107312817A - Primed probe, kit and the method precisely quantitatively detected for genetically modified rice Kemingdao strain-specific gene composition - Google Patents
Primed probe, kit and the method precisely quantitatively detected for genetically modified rice Kemingdao strain-specific gene composition Download PDFInfo
- Publication number
- CN107312817A CN107312817A CN201610257607.7A CN201610257607A CN107312817A CN 107312817 A CN107312817 A CN 107312817A CN 201610257607 A CN201610257607 A CN 201610257607A CN 107312817 A CN107312817 A CN 107312817A
- Authority
- CN
- China
- Prior art keywords
- genetically modified
- strain
- modified rice
- specific gene
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the accurate Oligonucleolide primers probe quantitatively detected for genetically modified rice Kemingdao strain-specific gene composition, the kit of the primed probe is included.The invention further relates to the digital pcr detection method for quantitatively detecting genetically modified rice Kemingdao strain-specific gene composition, methods described is including the use of the specific oligonucleotide primer and fluorescence labeling probe for genetically modified rice Kemingdao strain-specific gene.The invention further relates to application of the specific oligonucleotide primer and fluorescence probe for genetically modified rice strain-specific gene in quantitative detection genetically modified rice Kemingdao strain-specific gene composition.Using the digital pcr detection method of the present invention, can accurate delicately genetically modified rice Kemingdao strain-specific gene component content in determination sample, sensitivity can reach 0.5 copies/ μ L.
Description
Technical field
The invention belongs to biological technical field, genetically modified rice Kemingdao strain specifically, the present invention relates to special
The Oligonucleolide primers and fluorescence labeling probe of specific gene composition detection, include the kit of the primed probe, for surveying
Determine genetically modified rice gram snout moth's larva in the digital pcr detection method and sample of genetically modified rice Kemingdao strain-specific gene composition
The specific oligonucleotide primer and probe of rice strain-specific gene composition is special in detection genetically modified rice Kemingdao strain
Application in property gene element.
Background technology
Numerous studies and its extensive use in daily life with transgenic product, transgenic product are strong to the mankind
The safety issue that health and living environment are brought has caused extensive concern and the arguement of common people.Therefore, countries in the world exist
Actively while research transgenic technology, numerous studies also have been carried out to the determination method of various GM foods.But by
Many in transgenic species, quantity is big, and especially many GM foods turn base after deep processing and the processing of various conditions are preserved
Because composition is largely degraded, detection difficulty is increased.Various turn base accordingly, it would be desirable to constantly update and develop according to the development of science and technology
Because of the detection technique of food, to strengthen GM food supervision, monitoring and manage, the risk that its commercialization may be brought is reduced,
Public health, protection consumers in general's right to know and right to choose are protected simultaneously.
At present, countries in the world are strengthened genetically modified organism and products thereof for the various purposes such as economy, health, environmental protection are numerous and confused
Management and detection.50 or so the countries and regions including China promulgate and have carried out " transgenic labeling system " in succession,
Genetically modified organism and its converted products are identified and managed.In recent years, with the relevant GMO in various countries（Genetically
Modified organism）The foundation of labeling acts and constantly improve, to the existing defined of GMO contents lower limit in food.A lot
Country is not only required to carry out qualitative detection to GM food, in addition it is also necessary to which the GMO contents in food are quantitatively detected, so as to
Mark, its threshold value identified is general between 0.9% -5%.And the detection technique standard for setting up transgenic product is especially precisely fixed
Amount detection technique is to implement the technology premise of transgenic product mark.Therefore, the accurate quantitative technique of transgene component will be with
The whole world identifies the perfect of system and developed increasingly important.
Digital pcr (digital polymerase chain reaction, dPCR) is as more accurate and more sensitive
The quantitative new detecting techniques of DNA, realize the absolute quantitation of single-molecule DNA.DPCR is set up on the basis of ordinary numbers PCR
DNA absolute quantification methods, solve the problems such as standard curve used in ordinary numbers PCR produces influence to measurement result, and
Its matrix effect brought can be reduced.DPCR has the characteristics of measurement independence is with without any caliberator.
China's transgenic paddy rice research is in the leading level in the world, and the appearance of dPCR technologies is quantitative for rice transgene component
Detection opens new approach so that the quantitative analysis of rice transgene component is possibly realized with tracing to the source in food.Utilize dPCR
The accuracy and practical value of skill upgrading quantitative detecting method are by one as the accurate quantitative measurement technology development of transgenosis
Important directions.
The content of the invention
It is an advantage of the invention to provide precisely quantitatively detection genetically modified rice Kemingdao strain-specific gene into
The specific oligonucleotide primer and fluorescence labeling probe divided.
It is a further object of the invention to provide accurate quantitative determination genetically modified rice Kemingdao strain-specific gene
The digital pcr detection kit of composition.
It is a further object of the invention to provide accurate quantitative determination genetically modified rice Kemingdao strain-specific gene
The digital pcr detection method of composition.
The present invention further an object is that there is provided the specificity of genetically modified rice Kemingdao strain-specific gene composition
Oligonucleolide primers and probe are precisely quantitatively being detected in food in genetically modified rice Kemingdao strain-specific gene composition
Using.
For foregoing invention purpose, the present invention provides following technical scheme：
The present inventor devises energy according to genetically modified rice Kemingdao external source insertion point and rice genome intersection
Specificity differentiates the Oligonucleolide primers pair and probe of genetically modified rice Kemingdao strain-specific gene composition, can be from sample
Efficient specific amplified goes out genetically modified rice specific gene fragment one section shorter in DNA.According to one embodiment of the present invention
Case, the present invention is provided to the specificity of digital pcr method detection genetically modified rice Kemingdao strain-specific gene composition is few
Nucleotide primer pair and fluorescence labeling probe, the primer pair and probe are according to genetically modified rice Kemingdao strain specificity base
Designed because of the characteristics of there is otherness with other lines transgenic crops.The primer pair is by sense primer and anti-sense primer
Composition, the sense primer is KMD-LF TCCGCAATGTGTTATTAAGTTGTCTAA（SEQ ID No.1）, the downstream is drawn
Thing is KMD-LR CCGATATGCCTGCCCATCT（SEQ ID No.2）；The probe is KMD-LP
CGTCAATTTGTTTACACCACAATATATCCCG（SEQ ID No.3）, a fluorescent quenching base is connected with 3 ' ends of probe
Group BHQ1,5 ' ends are connected with a fluorescent reporter group FAM.In one embodiment, the genetically modified rice that the present invention is provided
Specific detection composition, the composition includes specific oligonucleotide primer pair and probe.In a preferred embodiment party
In case, the invention provides quantitatively detect genetically modified rice Kemingdao strain-specific gene composition for digital pcr method
Composition, the composition includes genetically modified rice specific oligonucleotide primer pair and probe, wherein the genetically modified rice
Specific primer sense primer and anti-sense primer to being made up of, and the base sequence of the sense primer is SEQ ID No.1, described
The base sequence of anti-sense primer is SEQ ID No.2；The base sequence of the probe is SEQ ID No.3, at 3 ' ends of probe
A fluorescent quenching group BHQ1 is connected with, 5 ' ends are connected with a fluorescent reporter group FAM.
According to another embodiment of the invention, the present invention provide genetically modified rice Kemingdao strain-specific gene into
Point digital pcr quantitative detecting method, methods described including the use of for genetically modified rice Kemingdao strain-specific gene into
The specific oligonucleotide primer pair and probe divided, the primer pair and probe are special according to genetically modified rice Kemingdao strain
The uniqueness of property gene and design.In one embodiment, genetically modified rice Kemingdao strain-specific gene of the invention
In the digital pcr quantitative detecting method of composition, used genetically modified rice specific oligonucleotide primer pair is by sense primer
With anti-sense primer composition, the base sequence of the sense primer is SEQ ID No.1, and the base sequence of the anti-sense primer is
SEQ ID No.2；The base sequence of the probe is SEQ ID No.3, and a fluorescent quenching base is connected with 3 ' ends of probe
Group BHQ1,5 ' ends are connected with a fluorescent reporter group FAM.In one embodiment, described PCR amplification conditions are 95
DEG C, 5min（1℃/s）；94 DEG C of 15 s, 60 DEG C of 1 min（1℃/s）, totally 50 circulations；98℃10 min（1℃/s）.
In one embodiment, genetically modified rice digital pcr quantitative detecting method of the invention is still further comprised really
The step of determining the quantitative test limit of specific oligonucleotide primer and probe combination.In one embodiment, the digital pcr
Detection method quantitatively detects that the detection sensitivity of genetically modified rice Kemingdao strain-specific gene composition is 0.5 copy/ μ
L。
According to another embodiment of the invention, the present invention is provided to precisely quantitatively detect genetically modified rice Kemingdao
The kit of strain-specific gene composition, the kit, which includes the present invention, is used for digital pcr method detection genetically modified rice
The specific oligonucleotide primer pair and probe and operation instructions of Kemingdao strain-specific gene composition.The present invention's
In kit preferred embodiment, genetically modified rice Kemingdao strain-specific gene component quantifying detection specificity of the invention
Oligonucleolide primers are to being to be respectively provided with difference according to the sequence of the strain-specific gene and other any genetically modified crops
The characteristics of property and design.In one embodiment, the genetically modified rice specific oligonucleotide primer pair of the kit
It is made up of sense primer and anti-sense primer, the base sequence of the sense primer is SEQ ID No.1, the alkali of the anti-sense primer
Motif is classified as SEQ ID No.2；The base sequence of the kit middle probe is SEQ ID No.3, in 3 ' end connections of probe
There is a fluorescent quenching group BHQ1,5 ' ends are connected with a fluorescent reporter group FAM.According to another embodiment party of the present invention
Case, it is described the present invention is provided to precisely quantitatively detect the kit of genetically modified rice Kemingdao strain-specific gene composition
The digital pcr method that is used for that kit includes the present invention differentiates the special of genetically modified rice Kemingdao strain-specific gene composition
Property Oligonucleolide primers pair and probe and operation instructions.In a preferred embodiment of kit, the kit
In comprising genetically modified rice specific oligonucleotide primer pair SEQ ID No.1, SEQ ID No.2 and genetically modified rice specificity
Probe SEQ ID No.3, a fluorescent quenching group BHQ1 are connected with 3 ' ends of probe, 5 ' ends are connected with a fluorescence report
Group FAM.In preferred embodiments, the operation instructions of the kit are included to big for quick detection transgenosis
The description of the digital pcr amplification condition of rice Kemingdao strain-specific gene composition.In a preferred embodiment, it is described
The PCR amplification conditions provided in the specification of kit are 95 DEG C, 5min（1℃/s）；94 DEG C of 15 s, 60 DEG C of 1 min（1℃/
s）, totally 50 circulations；98℃10 min（1℃/s）.In a specific embodiment, the present invention is used for genetically modified rice gram
The kit of snout moth's larva rice strain-specific gene component quantifying detection also includes reference substance.Preferably, reference substance includes negative control
Product and positive reference substance.In one embodiment, negative control is aseptic double-distilled water.
According to another embodiment of the invention, the digital pcr method detection that is used for that the present invention provides the present invention turns base
Because rice Kemingdao strain-specific gene composition specific oligonucleotide primer and probe detection food in transgenosis it is big
Application in rice Kemingdao strain-specific gene composition.In a preferred embodiment, the present invention provides fruit juice transfer
Specific oligonucleotide primer pair SEQ ID No.1, the SEQ ID No.2 of gene rice Kemingdao strain-specific gene composition
With genetically modified rice specific probe SEQ ID No.3, a fluorescence is connected with 3 ' ends of genetically modified rice ITS gene probes
Quenching group BHQ1,5 ' ends are connected with a fluorescent reporter group FAM.In another embodiment, the present invention also provides this
Application of the kit of invention in quantitative detection genetically modified rice Kemingdao strain-specific gene composition.Preferably, in this hair
In bright above-mentioned application, the kit includes the genetically modified rice specific oligonucleotide primer pair and probe of the present invention.More
It is preferred that, in the above-mentioned application of the present invention, the genetically modified rice specific oligonucleotide that the kit includes the present invention draws
The application of thing pair and probe in detection genetically modified rice Kemingdao strain-specific gene composition.
The present invention is using the genome of genetically modified rice strain Kemingdao as reference template, according to the strain-specific gene sequence
The characteristics of row have otherness with other genetically modified crops genes designs primer, is detected using digital pcr standard measure in sample
Genetically modified rice Kemingdao strain-specific gene composition.
Digital pcr technology (digital polymerase chain reaction, dPCR) is by the way that micro-example is divided
Level is made the dilution of big multiple and segmented, until after testing molecule number contained in each subdivision sample is not over 1, then by institute
There is subdivision sample while entering performing PCR amplification, a kind of skill counted one by one according to Poisson distribution principle under the same conditions
Art, is a kind of absolute quantitation measuring method.
Cycle threshold of the digital pcr detection method independent of amplification curve of the present invention, it is not required that house-keeping gene and
Standard curve, is DNA absolute quantification methods, has the advantages that reliable results and accurate sensitive.The present invention according to primer sequence
The kit being made, for the precisely quantitative and sensitive qualitative detection of low content of such product, with quantitative result it is accurate, detect
Sensitivity height, high specificity, result are reliable and stable and avoid cross pollution from causing the advantage of false positive.Use the numeral of the present invention
PCR detection method and PCR detection kit, can be carried out precisely quantitative to genetically modified rice Kemingdao strain-specific gene composition
Detection, its quantitative test limit can reach 0.5 copy/μ L, be suitable on domestic and international market genetically modified rice gram snout moth's larva in rice made products
The actual quantification detection demand of rice strain-specific gene composition.
Brief description of the drawings
The result by real-time fluorescent PCR amplification genetically modified rice Kemingdao strain-specific gene sequence is shown in Fig. 1, its
It is genetically modified rice Kemingdao strain sample and the amplification curve of positive control above middle baseline, is genetically modified rice below baseline
Rich No. 6 of section, M12, genetically engineered soybean GTS-40-3-2, DP-306043, transgenic corns NK603, Mon88017 and non-transgenic
Rice, soybean, corn, blank control（Aseptic double-distilled water）.
Fig. 2 is shown digital pcr and precisely quantitatively detects genetically modified rice Kemingdao and the result of other genetically modified crops
Figure, wherein being from left to right followed successively by genetically modified rice Kemingdao, rich No. 6 of genetically modified rice section, M12, genetically engineered soybean GTS-40-
3-2, DP-306043, transgenic corns NK603, Mon88017 and non-transgenic rice, soybean, corn, blank control（It is sterile
Distilled water）.
Fig. 3 is the accuracy that genetically modified rice Kemingdao strain-specific gene composition is precisely quantitatively detected to digital pcr
Evaluated with sensitivity, genetically modified rice sample gene group DNA stostes are diluted into 5 times, 25 times, 250 times, each gradient respectively
3 repeated experiments, carry out digital pcr amplification.And theoretical value is compared to the deviation for calculating quantitative result, and tested according to 3 repetitions
As a result itself SD and RSD value is calculated.
Fig. 4 is that theoretical content low is contained for 0.5 copies/ μ L Kemingdao using the digital pcr technology set up of the present invention
Measure analog sample and carry out precisely quantitative digital pcr droplet distribution map.From left to right, respectively 4 it is parallel, it is each parallel to enter
2 repetitions of having gone are tested.
Embodiment
The present invention is further illustrated by way of embodiment, but the present invention is not limited only to following reality
Apply example.
Embodiment 1
The present inventor's first passage real-time fluorescence PCR（Sonde method）Expand genetically modified rice Kemingdao strain specificity base
Cause.Used genetically modified rice Kemingdao strain-specific gene primer probe sequence is sense primer KMD-LF
TCCGCAATGTGTTATTAAGTTGTCTAA（SEQ ID No.1）, anti-sense primer is KMD-LR CCGATATGCCTGCCCATCT
（SEQ ID No.2）；Probe is KMD-LP CGTCAATTTGTTTACACCACAATATATCCCG（SEQ ID No.3）.
1. used detection key instrument：
Micropipettor（eppendorf）, quantitative real time PCR Instrument（AB7500）, high speed tabletop centrifuge (12 000 r/min),
Electrophoresis apparatus (DYY22C types) etc..
2. detect main agents：
2 × TaqMan Universal PCR Master Mix (ABI), primed probe（Thermofisher）Deng.
3. detect key step：
Real-time fluorescence PCR reaction system：
2×Mastermix 12.5μL
Sense primer（10mM） 1.0μL
Anti-sense primer（10mM） 1.0μL
Probe（10mM） 0.5μL
Template DNA 50ng
Plus aseptic double-distilled water to cumulative volume is 25 μ L
Note：Corresponding blank control is set up in each PCR detections（DNA profiling is replaced with the ultra-pure water for preparing reaction system, is detected
Whether reagent is contaminated）；
4 real-time fluorescence PCR response parameters：
95℃ 10 min
95℃ 15 s
60℃ 1 min
Note：Different instruments should make the appropriate adjustments each reagents of PCR and response parameter.
As shown in figure 1, during using real-time PCR detection genetically modified rice Kemingdao strain-specific gene, Kemingdao
Strain sample and positive control may occur in which amplification curve, rich No. 6 of other lines transgenic rice sections, M12, genetically engineered soybean GTS-
40-3-2, DP-306043, transgenic corns NK603, Mon88017 and non-transgenic rice, soybean, corn, blank control are equal
Do not occur fluorescence curve, show that the primed probe has specificity to genetically modified rice Kemingdao strain.
Embodiment 2
The present embodiment is quantitatively to be detected through digital pcr by using genetically modified rice Kemingdao strain specificity primer probe sequence
The copy number of genetically modified rice gene.Used genetically modified rice Kemingdao strain specificity primer probe sequence draws for upstream
Thing is sense primer KMD-LF TCCGCAATGTGTTATTAAGTTGTCTAA（SEQ ID No.1）, anti-sense primer is KMD-LR
CCGATATGCCTGCCCATCT（SEQ ID No.2）；Probe is KMD-LP CGTCAATTTGTTTACACCACAATATATCCCG
（SEQ ID No.3）.
1. used detection key instrument：
Micropipettor（eppendorf）, droplet type digital pcr instrument（Bio-rad, QX200）, high speed tabletop centrifuge (12
000 r/min) etc..
2. detect main agents：
2 × TaqMan Master Mix (Bio-rad), primed probe（Thermofisher）Deng.
3. detect key step：
Digital pcr reaction system：
2×Mastermix 10 μL
Sense primer（10mM） 1.0μL
Anti-sense primer（10mM） 1.0μL
Probe（10mM） 0.5μL
The μ L of template DNA 5.0
The μ L of aseptic double-distilled water 2.5
Note：Corresponding blank control is set up in each PCR detections（DNA profiling is replaced with the ultra-pure water for preparing reaction system, is detected
Whether reagent is contaminated）；
4. digital pcr response parameter：
95 DEG C, 5min（1℃/s）；94 DEG C of 15 s, 60 DEG C of 1 min（1℃/s）, totally 50 circulations；98℃10 min（1℃/s）
Note：Different instruments should make the appropriate adjustments each reagents of PCR and response parameter.
As shown in Fig. 2 when the genetically modified rice and other samples of same DNA concentration are precisely quantitatively detected using digital pcr,
The amount for successfully detecting genetically modified rice is 578copies/ μ L, and rich No. 6 of other lines transgenic rice sections, M12, transgenosis
Soybean GTS-40-3-2, DP-306043, transgenic corns NK603, Mon88017 and non-transgenic rice, soybean, corn, sky
White control shows that this method can the accurate special genetically modified rice Kemingdao composition detected in sample without amplification.
Embodiment 3
It is identical with the method described in embodiment 2, genetically modified rice sample gene group DNA is diluted after 1 times, 5 times and 50 times respectively
As template, each dilution gradient is repeated 3 times, using in genetically modified rice Kemingdao amplimer probe sequence and embodiment 2
It is identical, carry out digital pcr quantitatively detect, with assay method sensitivity.
Average content after genetically modified rice sample gene group DNA stostes, 5 times and 50 times of dilution is respectively 551
Copies/ μ L, 106.4copies/ μ L, 13.2copies/ μ L, and the deviation of theoretical value is respectively -4.67%, 0.15%,
1.74%, substantially conform to its theory copy numerical value, the RSD values of 3 repetitions of each dilution gradient respectively 1.07%, 6.92%,
7.35%（Fig. 3）, show accurate during the accurate quantitative detecting method detection genetically modified rice Kemingdao strain-specific gene composition
Property and sensitivity preferably, the strain-specific gene composition of different content can be carried out precisely quantitative.
Embodiment 4
The kit for precisely quantitatively detecting genetically modified rice Kemingdao strain-specific gene composition is provided in the present embodiment.It is described
The digital pcr method that is used for that kit includes the present invention differentiates the special of genetically modified rice Kemingdao strain-specific gene composition
Property Oligonucleolide primers pair and probe and operation instructions.The kit includes primer pair SEQ ID No.1, SEQ ID
No.2 and genetically modified rice specific probe SEQ ID No.3, in genetically modified rice TT51-1 strain-specific gene probes
3 ' ends are connected with a fluorescent quenching group BHQ1, and 5 ' ends are connected with a fluorescent reporter group FAM, the operation instructions
PCR amplification conditions are given, the condition is 95 DEG C, 5min（1℃/s）；94 DEG C of 15 s, 60 DEG C of 1 min（1℃/s）, totally 50 are followed
Ring；98℃10 min（1℃/s）.For different instruments, response parameter makes the appropriate adjustments.It is identical with the method described in embodiment 3,
DPCR amplifications are carried out for 0.5 copies/ μ L Kemingdao low content analog sample to theoretical content, each sample is repeated 3 times,
Setting 6 is parallel altogether.
As shown in figure 3, when Kemingdao detectable concentration is 0.5 copy/ μ L, 6 parts of parallel sample quantitative results are respectively
0.53336 copies/μL、0.47793copies/μL、0.55447copies/μL、0.50107copies/μL、
0.55442copies/ μ L, 0.49793copies/ μ L, and theoretical content value deviation between -4.41% ~ 10.89%, its is each
The RSD of parallel sample is between 9.07% ~ 24.71 %, and the RSD of 6 parts of parallel samples is 6.2 %, meets RSD values and is less than or equal to
25% requirement.As a result show this method for precisely quantitatively detect low content genetically modified rice TT51-1 strain specificity bases
Method precision and reappearance are preferable during because of composition.
Because current digital pcr platform is divided into two kinds of droplet type and chip type, the present invention in different platform by carrying out
Embodiment is analyzed, and is demonstrated the method for the invention set up and is applicable simultaneously for the two platforms.Although to the present invention's
Specific embodiment is described, but those skilled in the art will appreciate that without departing from the scope of the present invention or spirit
On the premise of the present invention can be variously changed and be modified.Thus, this invention is intended to cover to fall in appended claims
And its all these changes in range of equivalency and modification.
Claims (5)
1. the specific oligonucleotide for detecting genetically modified rice Kemingdao strain-specific gene composition for digital pcr method draws
Thing pair and fluorescence labeling probe composition, wherein it is sense primer KMD-LF that the primer pair, which is sense primer,
TCCGCAATGTGTTATTAAGTTGTCTAA（SEQ ID No.1）, anti-sense primer is KMD-LR CCGATATGCCTGCCCATCT
（SEQ ID No.2）；Probe is KMD-LP CGTCAATTTGTTTACACCACAATATATCCCG（SEQ ID No.3）.
2. composition according to claim 1, wherein being connected with a fluorescent quenching group BHQ1,5 ' at 3 ' ends of probe
End is connected with a fluorescent reporter group FAM.
3. the kit of genetically modified rice Kemingdao strain-specific gene composition is quantitatively detected by digital pcr method, it is described
Kit includes the primer combination of probe thing and operation instructions described in claim 1-2.
4. quantitatively detecting the digital pcr method of genetically modified rice Kemingdao strain-specific gene composition, methods described includes making
With the kit described in the primer combination of probe thing and claim 3 described in claim 1-2.
5. the kit described in primer combination of probe thing and claim 3 described in claim 1-2 is in detection rice made products transfer
The application of gene rice Kemingdao strain-specific gene composition.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610257607.7A CN107312817A (en) | 2016-04-25 | 2016-04-25 | Primed probe, kit and the method precisely quantitatively detected for genetically modified rice Kemingdao strain-specific gene composition |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610257607.7A CN107312817A (en) | 2016-04-25 | 2016-04-25 | Primed probe, kit and the method precisely quantitatively detected for genetically modified rice Kemingdao strain-specific gene composition |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107312817A true CN107312817A (en) | 2017-11-03 |
Family
ID=60184401
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610257607.7A Pending CN107312817A (en) | 2016-04-25 | 2016-04-25 | Primed probe, kit and the method precisely quantitatively detected for genetically modified rice Kemingdao strain-specific gene composition |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107312817A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146824A (en) * | 2013-03-01 | 2013-06-12 | 浙江省农业科学院 | Recombinant standard plasmid and kit for PCR (Polymerase Chain Reaction) detection of transgenic rice |
| KR20140135575A (en) * | 2013-05-16 | 2014-11-26 | 한국표준과학연구원 | Standard Plasmid for Detection of Genetically Modified Organism, Qualitative detection method using the same and Detection Kit comprising the same |
| CN105255874A (en) * | 2015-11-09 | 2016-01-20 | 北京出入境检验检疫局检验检疫技术中心 | Kit for accurately and quantitatively detecting transgenic maize line T25 and detection method thereof |
-
2016
- 2016-04-25 CN CN201610257607.7A patent/CN107312817A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146824A (en) * | 2013-03-01 | 2013-06-12 | 浙江省农业科学院 | Recombinant standard plasmid and kit for PCR (Polymerase Chain Reaction) detection of transgenic rice |
| KR20140135575A (en) * | 2013-05-16 | 2014-11-26 | 한국표준과학연구원 | Standard Plasmid for Detection of Genetically Modified Organism, Qualitative detection method using the same and Detection Kit comprising the same |
| CN105255874A (en) * | 2015-11-09 | 2016-01-20 | 北京出入境检验检疫局检验检疫技术中心 | Kit for accurately and quantitatively detecting transgenic maize line T25 and detection method thereof |
Non-Patent Citations (2)
| Title |
|---|
| RUZHA BABEKOVA ET AL.: ""Development of an event-specific Real-time PCR detection method for the transgenic Bt rice line KMD1"", 《 EUR FOOD RES TECHNOL》 * |
| 金荣愉: ""转Bt基因棉花及水稻检测用质粒标准分子的构建、定值与分析"", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kralik et al. | A basic guide to real time PCR in microbial diagnostics: definitions, parameters, and everything | |
| CN104046700B (en) | The detection kit of a kind of Rapid identification donkey hide, horse skin and mule skin | |
| Nörz et al. | Evaluation of a fully automated high-throughput SARS-CoV-2 multiplex qPCR assay with built-in screening functionality for del-HV69/70-and N501Y variants such as B. 1.1. 7 | |
| Fischer et al. | Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis | |
| Cui et al. | Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice | |
| Pestechian et al. | Genetic diversity of Echinococcus granulosus in center of Iran | |
| CN103397105B (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN108977582B (en) | A kind of real-time fluorescence quantitative RT-PCR detection method of avian infectious bronchitis virus | |
| CN106399542B (en) | A kind of quick detection primer of rolling ring constant-temperature amplification and kit of mycoplasma pneumoniae | |
| CN110229932A (en) | African swine fever virus nucleic acid is hands-free to take fluorescence isothermal amplification detection kit | |
| CN105506127A (en) | Primers and kit for detecting rice blast resistance genes Pigm and genetic typing method | |
| Tao et al. | Species‐specific real‐time PCR detection of Colletotrichum kahawae | |
| Lee et al. | Development and practical use of RT-PCR for seed-transmitted Prune dwarf virus in quarantine | |
| Alemu | Real-time PCR and its application in plant disease diagnostics | |
| Wacharapluesadee et al. | Development of a TaqMan real-time RT-PCR assay for the detection of rabies virus | |
| CN104593504A (en) | Composite PCR (polymerase chain reaction) amplification fluorescence detection kit for 27 plant transgenic loci | |
| RU2550257C2 (en) | METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS | |
| CN1932037B (en) | Method of screening transgenic wheat | |
| CN107312821A (en) | Primed probe, kit and the method precisely quantitatively detected for genetically modified rice M12 strain-specific gene compositions | |
| CN106520914A (en) | Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials | |
| CN107312817A (en) | Primed probe, kit and the method precisely quantitatively detected for genetically modified rice Kemingdao strain-specific gene composition | |
| Leisova‐Svobodova et al. | Detection of Garlic Viruses Using SYBR Green Real‐time Reverse Transcription‐Polymerase Chain Reaction | |
| CN107312820A (en) | Primed probe, kit and the method precisely quantitatively detected for genetically modified rice TT51-1 strain-specific gene compositions | |
| CN107488708A (en) | Primed probe, kit and the method precisely quantitatively detected for dog derived component digital pcr | |
| CN107488705A (en) | The primed probe and method and kit precisely quantitatively detected for mink source composition digital pcr |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171103 |
|
| WD01 | Invention patent application deemed withdrawn after publication |