CN107312765A

CN107312765A - A kind of glycosaminoglycan lyases for being difficult to degraded CS E and its encoding gene and application

Info

Publication number: CN107312765A
Application number: CN201710544077.9A
Authority: CN
Inventors: 李福川; 彭春娥; 王庆彬; 王淑敏; 王文爽; 王凌天
Original assignee: Shandong University
Current assignee: Shandong University
Priority date: 2017-07-05
Filing date: 2017-07-05
Publication date: 2017-11-03
Anticipated expiration: 2037-07-05
Also published as: CN107312765B; WO2019007033A1

Abstract

The present invention relates to a kind of glycosaminoglycan lyases for being difficult to degraded CS E and its encoding gene and application.The amino acid sequence of glycosaminoglycan lyases is as shown in SEQ ID NO.2；The encoding gene and nucleotide sequence of glycosaminoglycan lyases are as shown in SEQ ID NO.1；It is 13.8 respectively that glycosaminoglycan lyases prepared by the present invention is lived to HA and CS A, CS C, CS D, CS E ratio, 7.2,6.7,5.9,5.3U/mg.And the oligosaccharides of the different polymerization degree of high sulphation is prepared as substrate using low sulphated CS E polysaccharide, the oligosaccharides of the high sulphation of preparation can be used for anti-tumor metastasis.The enzyme can also be applied to the fields such as medicine and cosmetics, have broad application prospects.

Description

A kind of glycosaminoglycan lyases for being difficult to degraded CS-E and its encoding gene and application

Technical field

The present invention relates to a kind of glycosaminoglycan lyases for being difficult to degraded CS-E and its encoding gene and application, belong to gene Field of engineering technology.

Background technology

Glycosaminoglycan (glycosaminoglycan, GAG) is the straight chain linear polysaccharide for repeating disaccharide unit composition.Disaccharides Unit is by hexosamine (N- acetyl ammonia gucosamine/N- acetylgalactosamines) and hexuronic acid (D-Glucose aldehydic acid/L- idoses Aldehydic acid) or D- galactolipins pass through glycosidic bond connection composition.GAG early stages, which are also known as in mucopolysaccharide, structure, contains sulfate and (or) carboxylic Base, it is negatively charged, with polyanion characteristic.

According to whether occurring sulphation, glycosaminoglycan can be divided into sulphation and the major class of non sulphate two.Non sulphate GAG, Refer mainly to hyaluronic acid (Hyaluronic Acid, HA)；Sulphation GAG, including chondroitin sulfate/dermatan sulfate (Chondroitin Sulfate/Dermatan Sulfate, CS/DS), heparin/Heparan sulfate (Heparin/ Heparan Sulfate, Hep/HS), keratan sulfate (Keratan Sulfate, KS) three major types.Wherein keratan sulfate is not Containing hexuronic acid, repeat disaccharide unit and be made up of D- galactolipins and hexosamine, and other GAG repetition disaccharide unit is by hexose Aldehydic acid and hexosamine composition.Hyaluronic acid structure is relatively easy, the disaccharides being made up of D-Glucose aldehydic acid and N-acetyl-glucosamine Unit is formed by connecting through β -1,4- glycosidic bonds；Other glycosaminoglycans are then because the effect of various modification enzymes makes sugar chain become abnormal multiple It is miscellaneous, it is mainly manifested in different parts hydroxyl (- OH) and amino (- NH in sugar chain₂) sulphation, D-Glucose aldehydic acid is poor in C5- It is changed into acetylation of L- iduronic acids and the bit amino of hexosamine two etc. in the presence of to isomerase.Glycosaminoglycan sugar chain knot The high complexity of structure does not occur at random, but the Space-time speciality with height, is that various sugar chain synthesis relevant enzymes exist Caused by different cell tissues and the different developmental phases expression regulation level of organ, different structures makes it have different work( Can, the complexity of structure assigns the diversity of its function.

GAG is the polysaccharide side chain of proteoglycans (proteoglycan, PG), is distributed widely in the extracellular base of animal tissue Matter and cell surface, by take part in development of central nervous system with a series of protein-interactings, wound reparation, virus is invaded Dye, tissue morphology occurs, signal transduction, a variety of physiology and the pathologic process [1-3] such as cell division.Glycosaminoglycan have one The important biological function of series becomes important bioactive molecule, extensively should be obtained in medicine and functional food With such as heparin, chondroitin sulfate, hyaluronic acid [4,5].But due to the inhomogeneity of glycosaminoglycan structures, particularly sulfuric acid Change the high complexity of glycosaminoglycan structures, the same glycosaminoglycan of separate sources and different batches is existed very in activity Big difference [6].Numerous studies in recent years show that the biological function of glycosaminoglycan is by having special construction in polysaccharide chain Not there are the functional areas of different structure in the special interaction of functional areas and specific protein, and not come what is realized in same polysaccharide chain With protein-interacting can exercise different functions, therefore can by selective Partial digestion glycosaminoglycan polysaccharide chain, The homogeneous or relatively uniform specific function area oligosaccharides of preparation structure is used for medicine and functional food, not only structure and the work of such product Property determine, but also due to molecular weight it is small be beneficial to absorb and substantially increase utilization rate.

Glycosaminoglycan digestive enzyme is the important tool enzyme studied glycosaminoglycan structure-activity relationship and prepare bioactive oligosaccharide, main To include the hydrolysis enzyme system of microbe-derived cracking enzyme system and animal origin.Hyaluronic acid can be divided into according to the difference of substrate Enzyme, chondroitin sulfate/dermatan sulfate digestive enzyme, heparin/Heparan sulfate digestive enzyme, keratan sulfate digestive enzyme four are big Class.Single-minded chondroitin sulfate/dermatan sulfate degraded enzyme family is not found always in animal body, increasing research is aobvious Show that the degraded of chondroitin sulfate in mammal body/sulfuric acid skin element is mainly completed by some enzymes of hyaluronic acid enzyme family , nearest hyaluronidase family member HYAL4 is accredited as a chondroitin sulfate hydrolase [7].Microbe-derived sugar Amine Polyose degradation enzyme, because vigor is high, property is stable, it is easy to recombinantly express, the features such as being adapted to extensive prepare, with important Application value.

At present, it is possible to use commercialization glycosaminoglycan digestive enzyme be extremely limited, with regard to chondroitin sulfate digestive enzyme (CSase) For, the main CsaseABC originated including Proteus vulgaris, it has extensive degradation of substrates activity, can both dropped Solution HA can degrade CS and DS [8] again, further study showed that commercialization CSase ABC include two kinds of enzymes, endo-type CSaseABC I and circumscribed-type CSaseABC II；CSaseAC is very quick to the epimerization of GlcUA residues in GAG chains C5 Sense, therefore the HA and CS that can only degrade, the CSaseAC of current commercialization mainly include Flavobacterium heparinulm and originated Endo-type CSaseAC I [9] and Arthrobacter aurescens source circumscribed-type CSase AC II [10]；And The CsaseB in Flavobacterium heparinum sources is high specificity dermatan sulfate digestive enzyme, to chondroitin sulfate With hyaluronic acid without degrading activity [11].The different substrate selectives having using various glycosaminoglycan digestive enzymes and degraded Product diversity, can carry out composition 26S Proteasome Structure and Function research to baroque glycosaminoglycan, with reference to various separation analysis hands Section identified the specific function area that is combined in polysaccharide chain with target protein, and medicinal and function oligosaccharides eventually for high activity Prepared by enzyme process, but the glycosaminoglycan digestive enzymes few in number identified at present far can not also meet complicated glycosaminoglycan structure The need for the research of effect relation and the preparation of structure specific activity oligosaccharides.

CS-E from squid cartilage is the chondroitin sulfate rich in E unit (4GlcUA β 1-3GalNAc (4S, 6S)), E unit content reaches 40-60%, 4 and 6 generation sulphur of E unit N- acetyl-D-amino galactolipins in its polysaccharide chain Acidifying, with high negative electrical charge, makes it have specific molecular structure.This CS rich in high sulphation disaccharides can with growth because Son, which is combined, promotes neurite outgrowth [12,13]；This characteristic is more conducive to and the specific knot such as cell factor, chemotactic factor (CF) simultaneously Close, to adjust various physiology and pathologic process [14].Chondroitin sulfate E polysaccharide, possesses other species chondroitin sulfates and does not have Standby unique pharmacological activity.When for anti-herpes simplex virus, it causes the possibility of allergy lower than hormone medicine [15]；It is high The CS-E of sulphation can suppress Neuronal cell death [16], the transfer for promoting neurite outgrowth, suppressing cancer cell, suppress female sharp Element lacks the osteoporosis [17,18] induced；These researchs show that CS-E can be as new glycosaminoglycan medicament research and development Precursor.Acted on by selective enzymolysis, remove the non sulphate and low sulphated fragment in CS-E, prepare the widow rich in E unit Sugar, is more beneficial for strengthening preventions of the CS to relevant diseases such as cancer, viral infection, neuralgias, therapeutic effect.Therefore preparation structure Homogeneous or relatively uniform, activity is determined, the CS-E oligosaccharides rich in E unit is particularly important for medicine research and development.But, for a long time with The glycosaminoglycan digestive enzyme of E unit oligose fragments can be rich in selective retention in degradation process to lack all the time.

Chinese patent literature CN103923857A (application number 201410159983.3) discloses one plant of vibrios FC509 bacterial strain And its cultural method and application.It is general that the bacterial strain was preserved in China Committee for Culture Collection of Microorganisms on 03 12nd, 2014 Logical microorganism center, deposit number CGMCC NO.8913, address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Chinese science Institute of microbiology of institute.Invention vibrios isolated first (Vibrio sp.) FC509 bacterial strains, can prepare glycosaminoglycan Lyases, it is 45,000U/mg that it is 110,000U/mg that the enzyme is lived to the ratio of hyaluronic acid, the ratio to chondroitin sulfate is lived；Enzyme activity Power is tens to hundreds of times of known commercialization glycosaminoglycan lyases, the fields such as medicine and cosmetics is can be applied to, with wide Wealthy application prospect.

The content of the invention

In view of the deficiencies of the prior art, the present invention provides a kind of glycosaminoglycan lyases and its coding for being difficult to degraded CS-E Gene and application.

A kind of glycosaminoglycan lyases for being difficult to degraded CS-E, amino acid sequence is as shown in (a) or (b)：

(a) amino acid sequence is as shown in SEQ ID NO.2；

(b) amino acid sequence in (a) passes through substitution, lacks or adds one or more amino acid and with sugar Amine polysaccharide lyase activity as protein derived from (a).

According to currently preferred, the amino acid sequence (b) is as shown in SEQ ID NO.3 or SEQ ID NO.4.

A kind of encoding gene for the glycosaminoglycan lyases for being difficult to degraded CS-E, nucleotide sequence is as shown in (i) or (ii)：

(i) nucleotide sequence is as shown in SEQ ID NO.1；

(ii) DNA sequence dna limited under strict conditions with (i) hybridizes and coding cracks enzymatic activity with glycosaminoglycan Protein DNA molecule.

According to currently preferred, described in the nucleotide sequence (ii) under stringent condition, refer to：

In the 6 × SSC buffer solutions of the 0.5%SDS containing mass concentration, hybridize at 65 DEG C, then with containing mass concentration 0.1%SDS 2 × SSC buffer solutions and the 1 × SSC buffer solutions of the 0.1%SDS containing mass concentration respectively wash film once.

According to the present invention it is further preferred that the nucleotide sequence (ii) such as SEQ ID NO.5 or SEQ ID NO.6 institutes Show.

A kind of recombinant expression carrier, inserts the above-mentioned glycosaminoglycan lyases for being difficult to degraded CS-E in expression vector Encoding gene.

Above-mentioned expression vector is selected from coli expression carrier, Yeast expression carrier, hay bacillus expression vector, lactic acid bacteria Expression vector, streptomyces expression vector, phage vector, filamentous fungi expression vector, plant expression vector, insect expression vector Or mammalian cell expression vector.

A kind of recombinant cell, inserts the coding base of the above-mentioned glycosaminoglycan lyases for being difficult to degraded CS-E in cell Cause.

Above-mentioned cell is selected from e. coli host cell, yeast host cells, hay bacillus host cell, lactic acid bacteria place Chief cell, actinomyces host cell, filamentous fungal host cell, insect cell or mammalian cell.

Recombinant cell for recombinantly expressing glycosaminoglycan lyases HCLase Ei, selected from e. coli host cell (such as Escherichia coli BL21, Escherichia coli JM109, Escherichia coli DH5 α etc.), saccharomycete Host cell (such as Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces Iactis), Hay bacillus host cell (such as Bacillus subtilis R25, Bacillus subtilis 9920), lactic acid bacteria host Cell (such as Lactic acid bacteria C0CC101), actinomyces host cell (such as Streptomyces spp.), Filamentous fungal host cell (such as Trichoderma viride, Trichoderma reesei, Aspergillus niger, Aspergillus nidulans etc.), insect cell (such as Bombyxmori, Antharaea eucalypti etc.) or lactation it is dynamic Thing cell (such as Chinese hamster ovary cell CHO, baby hamster kidney cell BHK, CHL cells CHL etc.).

Absorption or delivering composition of the above-mentioned glycosaminoglycan lyases for being difficult to degraded CS-E as enhancing medicine are preparing medicine Application in thing.

A kind of chondroitin sulfate using the glycosaminoglycan lyases HCLase Ei degraded squids source for being difficult to degraded CS-E Application in the relatively uniform different polymerization degree oligosaccharides of CS-E preparation structures.

The relatively uniform different polymerization degree oligosaccharides of said structure is preparing the application in suppressing Nasopharyngeal neoplasms medicine.

Beneficial effect

1st, the present invention has found and identified a kind of glycosaminoglycan for being difficult to degraded CS-E from marine microorganism genome and splits Solve enzyme (HCLase Ei), the enzyme can degrade HA, ox cartilage source CS-A, Shark cartilage source CS-C and CS-D produce Disaccharides end-product, but can only a large amount of HMW oligosaccharides for being rich in E unit of Partial digestion CS-E generations；After testing, the enzyme is to saturating The ratio of bright matter acid lives as 13.8U/mg, CS-A, CS-C, CS-D, CS-E ratio is lived is 7.2 respectively, 6.7,5.9,5.3U/mg.

2nd, the present invention first using be difficult to degrade CS-E glycosaminoglycan lyases (HCLase Ei) with low sulphated CS-E polysaccharide is that substrate prepares the relatively uniform different polymerization degree oligosaccharides of series structure, and its E unit content is significantly larger than CS-E Polysaccharide, and high polymerization degree oligosaccharides therein can significantly inhibit the transfer of tumour cell, can be applied to the neck such as medicine and cosmetics Domain, has broad application prospects；And provide important tool enzyme for CS-E activated oligosaccharide of the enzymolysis preparation rich in E unit.

Brief description of the drawings

Fig. 1, glycosaminoglycan lyases protein three-dimensional structure model；

Fig. 2, the glycosaminoglycan lyases HCLase Ei expression for being difficult to degraded CS-E and purifying situation polyacrylamide coagulate Gel electrophoresis figure (SDS-PAGE)；

Wherein：M, protein molecular weight standard, band from top to bottom size be 116kD, 66.2kD, 45kD, 35kD, 25kD, 18.4kD, 14.4kD；Bacterium solution after thalline before swimming lane 1, control strain broken wall, the μ L of applied sample amount 6, swimming lane 2, recombinant bacterium broken wall, Supernatant after the μ L of applied sample amount 6, swimming lane 3, recombinant bacterium broken wall, the μ L of applied sample amount 6, swimming lane 4, the HCLase Ei through ni-sepharose purification, loading Measure 6 μ L.

Fig. 3, p Η values to be difficult to degrade CS-E glycosaminoglycan lyases HCLase Ei activity influence curve；

Fig. 4, temperature to be difficult to degrade CS-E glycosaminoglycan lyases HCLase Ei activity influence curve；

Fig. 5, temperature to be difficult to degrade CS-E glycosaminoglycan lyases HCLase Ei stability influence curve；

Fig. 6, metal ion to be difficult to degrade CS-E glycosaminoglycan lyases HCLase Ei activity influence column diagram；

Fig. 7, the glycosaminoglycan lyases HCLase Ei degraded commercialization HA (A) and CS-A (B), CS- for being difficult to degraded CS-E C (C), CS-D (D), the HPLC analysis charts of CS-E (E) end-product；

In figure：1：Two sulphation disaccharides, 2：Monosulfated disaccharides, 3：Non sulphate disaccharides；

Fig. 8, the CS-E that is difficult to degrade glycosaminoglycan lyases HCLase Ei different times degraded CS-A products therefroms HPLC analysis charts；

In figure：1：Tetrose, 2：Monosulfated disaccharides, 3：Non sulphate disaccharides；

Fig. 9, the glycosaminoglycan lyases HCLase Ei for the CS-E that is difficult to degrade degrade end-product obtained by low sulphated CS-E HPLC analysis charts；

Figure 10, be difficult to degrade CS-E glycosaminoglycan lyases HCLase Ei degraded CS-E prepare the antitumor effect of oligosaccharides Fruit is analyzed；

Figure 11, three enzymes degraded commercialization CS-E comparative graph；

In figure：1：Two sulphation disaccharides, 2：Monosulfated disaccharides.

Embodiment

The elaboration of following examples, is some common technologies how implemented for the comprehensive disclosure present invention, rather than be The application of the limitation present invention.Inventor tried one's best ensure in embodiment the accuracy of a parameter (for example measure, Temperature, etc.), but some experimental errors and deviation should also pay attention to.Unless otherwise indicated, middle-molecular-weihydroxyethyl of the present invention is Refer to weight average molecular weight, temperature is degree Celsius.

Biological material source

Vibrios (Vibrio sp.) FC509 is existing known bacterial strain, purchased from China Committee for Culture Collection of Microorganisms Common micro-organisms center, deposit number CGMCC NO.8913.

The extraction of embodiment 1, vibrios (Vibrio sp.) FC509 strain gene group DNAs

By vibrios (Vibrio sp.) FC509 inoculations into fluid nutrient medium, under conditions of 30 DEG C, 200rpm, Shaken cultivation is to OD₆₀₀=0.8；Culture bacterium solution 40mL is taken, 25min is centrifuged under the conditions of 12,000rmp, bacterial sediment is collected, used 20mL bacteriolyze enzyme buffer liquid (10mM Tris-HCl pH 8.0) washing, 25min is centrifuged under the conditions of 12,000rmp, is collected Bacterial sediment.

In above-mentioned bacterial sediment, often pipe adds bacteriolyze enzyme buffer liquid 12.0mL, obtains about 14.0mL bacterium solution, is separately added into Concentration is 20mg/mL each 560 μ L of lysozyme, the μ g/mL of its final concentration about 800；After ice bath 1.0h, 37 DEG C of warm bath 2h, to solution It is sticky；Add 10wt% SDS 0.82mL, 100mg/mL Proteinase K Solution 60 μ L, 52 DEG C of water-bath 1.0h；Add Tris- Equilibrated phenol/chloroform/isoamyl alcohol (volume ratio 25：24：1) 15mL, gently overturns and mixes, extremely fully emulsified；10,000g、4℃ Under the conditions of centrifuge 10min, shift supernatant, add 2.0mL NaAc-HAc (pH 5.2,3.0M) buffer solution, and 17.0mL Absolute ethyl alcohol, is mixed；Choose thread DNA with 1.0mL pipette tips, be transferred in 1.5mL EP centrifuge tubes, with percent by volume 70% ethanol solution (stores in -20 DEG C), washs 2 times, supernatant is abandoned after micro- centrifugation；10,000g, 3min is centrifuged under the conditions of 4 DEG C, thoroughly Discard supernatant；Sample is in aseptic working platform, and the drying of alcolhol burner leeward is dry；Dissolving DNA sample, 4 is resuspended with aseptic deionized water DEG C overnight, obtain macromolecule genomic DNA.

Every liter of component of aforesaid liquid culture medium is as follows：

Tryptone 10g, yeast extract 5g, NaCl 30g, KH₂PO₄ 3g、K₂HPO₄ 7g、(NH₄)₂SO₄ 2g、 MgSO₄·7H₂0 5mg、FeSO₄·7H₂0 2mg, pH value is 7.2.

Embodiment 2, the scanning of vibrios (Vibrio sp.) FC509 strain genes group and its sequence analysis.

Macromolecule genomic DNA made from embodiment 1 is sequenced (Mei Ji biotech firms).Use NCBI (National Center for Biotechnology Information,http://www.ncb1.nlm.nih.gov/) On software sequencing result is analyzed.Used NCBI analysis softwares are Open Reading Frame Finder (ORF Finder,http://www.ncb1.nlm.nih.gov/gorf/gorf.html) and Basic Local Alignment Search Tool(BLAST,http://blast.ncbi.nlm.nih.gov/Blast.cgi)。

NCBI analysis results, which are shown, carries a glycosaminoglycan lyase gene in Vibrio sp.FC509 strain gene groups Hclase ei, gene code head of district 2973bp, its nucleotide sequence is as shown in SEQ ID NO.1.With Vibrio Chondroitinase genes (NCBI sequence numbers in vulnificus whole genome sequence：WP039547743.1) 238 Amino acid has 36% homology.

HCLase Ei are made up of 990 amino acid, and its amino acid sequence is as shown in SEQ ID NO.2, the theory of protein Molecular weight is about 107kD.With Simple Modular Architecture Research Tool (SMART, http:// Smart.embl_heidelberg.de/) analysis glycosaminoglycan lyases HCLase Ei structural information, as a result shows N-terminal the 1 to the 21st amino acid is signal peptide sequence, and 23-702 amino acids sequences belong to glycosaminoglycan lyases superfamily.With The homologous Modeling Servers of SWISS-MODEL (http://swissmodel.expasy.org) to glycosaminoglycan lyases HCLase Ei protein three-dimensional structure carries out homologous modeling, the HCLase Ei protein three-dimensional structure models finally given, such as Fig. 1 institutes Show.

Embodiment 3, rHCLase Ei recombination expression of the gene in Escherichia coli

Using macromolecule genomic DNA made from embodiment 1 as template, enter performing PCR amplification.

Primer is as follows：

Forward primer HCLase Ei-F：GGGAATTCCATATGATAATCAAAGAAGTCGAAAATC；

Reverse primer HCLase Ei-R：CCGCTCGAGTTTCACCGGCTCTTGCAAC；

Forward primer underscore mark is restriction enzyme NdeI, and reverse primer underscore mark is in restricted Enzyme cutting Xho I sites.Primerstar HS archaeal dna polymerases are purchased from precious biotech firm, and PCR reaction systems are provided according to company The description of product is operated.

PCR reaction conditions：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 10s, 68 DEG C of annealing 2.5min, 30 circulations；72 DEG C are prolonged Stretch 10min.

By PCR primer Nde I and XhoI double digestions, agarose gel electrophoresis reclaims the PCR primer of digestion.U.S. will be purchased from The product pET-30a carriers NdeI and XhoI double digestions of Novagen companies of state, it is big that agarose gel electrophoresis reclaims digestion carrier Fragment.NdeI and Xho I are purchased from precious biotech firm, and the system of enzyme-to-substrate reaction, temperature and time are provided according to company The description of product operation.

It will be connected by the PCR primer of double digestion with also passing through double digestion pET-30a carriers, connection product conversion large intestine The Luria-Bertani culture mediums solid plate containing 50 μ g/mL cards that penicillin is coated on after bacillus DH5 α bacterial strains (routinely Technology is prepared) on, 37 DEG C of culture 14h, picking monoclonal；Monoclonal is accessed into the liquid containing 50 μ g/mL cards that penicillin Cultivated in Luria-Bertani culture mediums (routinely technology preparation), extract plasmid；By plasmid forward primer HCLase Ei- F and reverse primer HCLase Ei-R carries out bacterium solution PCR checkings, as a result obtains the correct amplified production of size, and preliminary proof is built Recombinant plasmid it is correct；Recombinant plasmid sequencing result shows, SEQ is inserted between pET-30a NdeI and Xho I restriction enzyme sites HCLase Ei genes shown in ID NO.1, and direction of insertion is correct, so further prove that the recombinant plasmid built is correct, will The recombinant plasmid is named as pET30a-HCLase Ei.

PET30a-HCLase Ei are converted into coli strain BL21 (DE3) (being purchased from Novagen companies of the U.S.), then The operating procedure provided according to the said firm carries out restructuring glycosaminoglycan lyases HCLase Ei induced expressions.And use Ni Fast Flow (GE) gels of Sepharose 6 are purified to HCLase Ei, purification condition according to GE companies product manual Operation.Restructuring glycosaminoglycan lyases HCLase Ei purifying situation is detected with polyacrylamide gel electrophoresis, as a result such as Fig. 2 Shown, restructuring glycosaminoglycan lyases HCLase Ei after purification are in single band on running gel, and position and point of prediction Son amount matches.

The characterization analysis of embodiment 4, restructuring glycosaminoglycan lyases HCLase Ei

The influence of pH and temperature to enzymatic activity

By mass concentration be 1% hyaluronic acid or chondroitin sulfate substrate, HCLase Ei enzyme liquids, different pH value 150mM HAc-NaAc、NaH₂PO₄-Na₂HPO₄, Tris-HCl buffer solutions and water (pH scopes are 5.0~10.0), by 2：1：3：4 (bodies Product ratio) ratio mixing after, react 60min at 30 DEG C, enzyme activity surveyed by foregoing ultraviolet method.As a result show that HCLase Ei exist Maximum vigor is reached during pH 8.0, the optimal reaction pH for showing HCLase Ei is 8.0 (such as Fig. 3).

Under optimal pH, by mass concentration be 1% hyaluronic acid or chondroitin sulfate substrate, HCLase Ei enzyme liquids, 150mM Tris-HCl buffer solutions and water (pH8.0) press 2：1：3：The ratio mixing of 4 (volume ratios), respectively in (0 DEG C of different temperatures ~90 DEG C) reaction 10min, enzyme activity is surveyed by foregoing ultraviolet method.As a result show that HCLase Ei reach maximum work at 30 DEG C Power, the optimal reactive temperature for showing HCLase Ei is 30 DEG C (such as Fig. 4).

Influence of the temperature to enzyme stability

It is 1% hyaluronic acid or sulphur that the HCLase Ei enzyme liquids after different time will be heat-treated at 30 DEG C with mass concentration Aching and limp ossein substrate solution presses 2：The ratio mixing of 3 (volume ratios), then determines remaining enzyme activity under optimum temperature and optimal pH, 100% relative activity (relativie activity) is defined as with the enzyme liquid enzyme activity without Overheating Treatment, as a result shown HCLase Ei still have at a temperature of 30 DEG C, after 12h is more than 60% active (such as Fig. 5).

Influence of the metal ion to HCLsae Ei activity

It is 1% hyaluronic acid or chondroitin sulfate substrate, HCLase Ei enzyme liquids, 150mM Tris-HCl by mass concentration Buffer solution and water press 2：1：3：After the ratio mixing of 4 (volume ratios), different metal ions are then added into reaction system, The final concentration of 5mM of ion of addition, then reacts 60min at 30 DEG C, and enzyme activity is surveyed by foregoing ultraviolet method.Control group is to be not added with HCLase Ei activity (being set as 100%) during any metal ion, shown in result figure 7.Experimental result shows, Li⁺, EDTA, Na⁺K⁺、Ca²⁺、Mg²⁺On HCLase Ei activity substantially without influence, Ag⁺、Cu²⁺、Co²⁺、Ni²⁺、Cr³⁺、Fe³⁺、Fe²⁺、Hg²⁺、Pb²⁺、 Zn²⁺Inhibitory action (Fig. 6) is presented Deng other ion pair enzyme activity.

The enzyme activity determination of embodiment 5, HCLase Ei

It is 1% hyaluronic acid or chondroitin sulfate substrate, HCLase Ei enzyme liquids, 150mM Tris-HCl by mass concentration Buffer solution and water press 2：1：3：After the ratio mixing of 4 (volume ratios), 1~10min is reacted under optimum temperature and optimal pH, is pressed Foregoing ultraviolet method surveys enzyme activity, while with being purchased from the quantification of protein kit measurement HCLase Ei enzymes that health is ShiJi Co., Ltd The protein content of liquid, as a result shows that recombinate HCLase Ei lives for 13.8U/mg, to CS-A, CS-C, CS- to the ratio of hyaluronic acid It is 7.2 respectively that D, CS-E ratio, which is lived, 6.7,5.9,5.3U/mg.Wherein substrate HA and ox cartilage source CS-A come from Sigma- Aldrich, Shark cartilage source CS-C and CS-D are purchased from Seikagaku companies, squid cartilage originate low sulphated CS-E according to The method of Chinese patent literature CN105924544A (application number 201610323540.2) specifications embodiment 1 prepares CS-E (E 39.3%) unit contents is.

The albumen shown in SEQ ID NO.3 and the albumen shown in SEQ ID NO.4 are detected as stated above：

It is that 0.09U/mg, the ratio to chondroitin sulfate A (CSA) are lived and be that albumen shown in SEQ ID NO.3 is lived to the ratio of hyaluronic acid 0.1U/mg；

It is that 0.07U/mg, the ratio to chondroitin sulfate A (CSA) are lived and be that albumen shown in SEQ ID NO.4 is lived to the ratio of hyaluronic acid 0.09U/mg；

Enzyme activity unit is defined：Catalysis glycosaminoglycan per minute produces the enzyme amount required for 1 μm of oL unsaturated double-bond.According to Ultraviolet method surveys the method [8] that glycosaminoglycan splits enzyme enzyme activity.

Efficient liquid phase (HPLC) analysis of embodiment 6, HCLase Ei degraded glycosaminoglycan catabolites

It is 1% hyaluronic acid or chondroitin sulfate substrate, HCLase Ei enzyme liquids, 150mM Tris-HCl by mass concentration Buffer solution and water press 2：1：3：After the ratio mixing of 4 (volume ratios), reacted under the conditions of pH8.0,30 DEG C, choose different enzymolysis Time (0,1,2,8,12,24,72h) product carry out HPLC analyses.HPLC analysis conditions are gel column：superdex peptide10/300GL(GE)；Mobile phase：0.2M ammonium hydrogen carbonate；Flow velocity：0.4mL/min；Testing conditions：UV232nm.

As a result as shown in Figure 7 and Figure 8, Fig. 7 results show that HCLase Ei can thoroughly drop HA, CS-A, CS-C and CS-D Solve as different degree of sulfation disaccharides, but be difficult to CS-E of the squid cartilage source rich in Eunit that degrade, imply that Eunit presence Inhibit the activity of the enzyme.CS-A time gradient Degrading experiment is shown, with the extension of degradation time, the product degree of polymerization by Gradually reduce, be finally converted into disaccharides (Fig. 8).The result shows that HCLase Ei belong to inscribe glycosaminoglycan lyases and are difficult to drop CS-E of the solution rich in Eunit, therefore, can be used for glycosaminoglycan oligosaccharides and is particularly preparation and osamine rich in E unit oligosaccharides Glycan structure activity study.

Two glycan analysis of efficient liquid phase (HPLC) and each component after embodiment 7, HCLase Ei degraded CS-E polysaccharide

It is that 1% crude product CS-E, HCLase Ei enzyme liquids, 150mM Tris-HCl buffer solutions and water press 2 by mass concentration： 1：3：After the ratio mixing of 4 (volume ratios), reacted under the conditions of pH8.0,30 DEG C, choose different enzymolysis times (0,4,8,12, 24th, 72h) product carry out HPLC analyses.HPLC analysis conditions are gel column：superdex peptide 10/300GL(GE)； Mobile phase：0.2M ammonium hydrogen carbonate；Flow velocity：0.4mL/min；Testing conditions：UV232nm.

Component 1~6 is collected, is degraded after desalination with commercialization CSaseABC, degradation condition is carried out with reference to specification, product HPLC is analyzed.HPLC analysis conditions are：HPLC conditions：Chromatographic column：YMC-Pack PA-G column, mobile phase：NaH₂PO₄Line Property elution, NaH₂PO₄Concentration is raised to 460mM in 60min from 16mM.Flow velocity：1mL/min, testing conditions：Ex330nm, Em 420nm.As a result as shown in Fig. 9 and table 1, table 1 is glycosaminoglycan lyases HCLase Ei degraded CS-E preparations more than or equal to four The disaccharide composition analysis of the macromolecule component of sugar：

Table 1

HCLase Ei are bright by the oligosaccharides of each component its E unit content for CS-E preparations of degrading as can be seen from Table 1 Aobvious raising, significantly larger than CS-E polysaccharide.

The effect of embodiment 8, the anti-tumor metastasis of different polymerization degree oligosaccharides

(1) tumour cell is cultivated：Breast carcinoma cell strain 4T1 is containing 10% hyclone, 100U/ml penicillin, streptomysin In dual anti-DMEM nutrient solutions, in 37 DEG C, 5%CO₂Incubator Secondary Culture；

(2) cell is collected：Tumour cell is collected by centrifugation and is diluted to 2 × 10 with PBS⁶Individual/ml is stand-by；

(3) PBS, the sugar of 20 μ g CS-E 8, the sugar of 20 μ g CS-E 10,20 μ g are injected respectively to BALB/c mouse (8 weeks or so) 200 μ l tumour cells are injected after the sugar of CS-E 12,30min, mouse diseased region, statistics mouse interior tumor are dissected after 3 weeks Number, examines antitumous effect.As a result as shown in Figure 10, the sugar of CS-E 10 and higher molecular weight oligosaccharides have significant antitumor turn Effect is moved, and the sugared effects of CS-E10 are better than CS-E12 sugar.

The application of embodiment 9, glycosaminoglycan lyases HCLase Ei in medicine

Glycosaminoglycan lyases HCLase Ei can be used for strengthening the absorption or/and delivering of medicine, including but not limited to pass through Cross dermal route assist drug penetration.Exemplary medicine includes corticosteroid such as hydrocortisone, prednisolone, times chlorine rice Loose propionic ester, flumethasone, triamcinolone, clobetasol propionate etc.；Antalgesic and/or antiinflammatory such as paracetamol, first go out Acid, Flufenamic acid, Diclofenac, C14H10Cl2NNaO2, alclofenac, Oxyphenbutazone, phenylbutazone, brufen, Flurbiprofen, bigcatkin willow Acid, menthol, camphor, naproxen etc.；Antihypertensive such as pindolol, Indenolol, nifepine etc.；Antibiotic such as mould Element, tetracycline, terramycin, neomycin, erythromycin, chloramphenicol etc.；Anesthetic such as lidocaine, benzocainum etc. and other medicines Thing.

By compress, gauze, or other dermal application approach apply glycosaminoglycan lyases.Glycosaminoglycan cracks enzyme solutions Suitable application can be coated to upper (such as 5-6 layers of gauze).Application should cover affected area, and application uses paraffin paper or bandage in itself It is fixed.The amount of the preparation of application depends on the area of damage, usually 5~100IU/cm².Application should be small using 12~24 daily When, continuously using 10~100 days.

Used for local, solution, suspension, gel, paste, ointment, emulsifiable paste or glycosaminoglycan lyases other It is formulated (being with or without other activating agent, can use).It is used for office comprising pharmacy and cosmetic field in the formula such as solution Portion uses acceptable diluent, adjuvant and excipient, and these other formulas mainly include buffer such as phosphate, lemon Hydrochlorate, acetate and other acylates, antioxidant such as ascorbic acid, peptide, protein such as seralbumin, gelatin or immune Globulin；Hydrophilic polymer such as polyvinylpyrrolidone, natural or synthesis oil；Amino acid such as glycine, glutamic acid, day Winter propylhomoserin, or arginine；Monose, disaccharides and other carbohydrate, including cellulose or derivatives thereof, glucose, lactose is sweet Dew sugar or dextrin；Chelating agent such as EDTA；Sugar alcohol such as mannitol or D-sorbite；Inorganic salts, such as sodium chloride, and non-ionic surface Activating agent such as tween, polyethylene glycol.

A kind of preferred, glycosaminoglycan cracking enzyme preparation is that glycosaminoglycan lyases HCLase Ei freeze-dried powder suspends Or be dissolved in containing in 0.1%~10% sucrose, the solvent of 1%~20% glycerine, the pH of solution is maintained at 6.5~8.5 scopes It is interior.

Glycosaminoglycan cracking enzymatic compositions can be administered orally or parenteral, and glycosaminoglycan lyases group Compound is administered after being combined with suitable delivery vector.

Combine glycosaminoglycan lyases medicine that acquisition be used to be administered orally of the reactive compound with solid excipient can be passed through Thing preparation.The above-mentioned mixture of selection adds suitable attached auxiliary agent and is used in mixed way.If desired, suitable excipient is carbon Hydrate or protein, such as sugar, cellulose, bovine serum albumin(BSA).

Glycosaminoglycan lyases enzyme is combined with medicine (such as hydrocortisone, antibiotic, vitamin).With oral gel, Paste, or suspension form by intravenous, subcutaneously or intramuscularly drug administration by injection；Or with ointment, cream, mask is locally given Medicine；And as cosmetic adjuncts, the absorption for strengthening skin.

Experimental example 10

Split using the glycosaminoglycan prepared in Chinese patent literature CN103923857A (application number 201410159983.3) The CSaseABC of enzyme-HCLase and commercialization purchase, and HCLase Ei prepared by the embodiment of the present invention are solved each optimal Under the conditions of fully degraded commercialization CS-E (E unit contents are 61%), using HPLC according to UV absorbance detection reaction product. As a result as shown in figure 11, by result as can be seen that HCLase and commercialization CSaseABC can be produced with degradable CS-E Disaccharides.

As seen from the above, HCLase Ei described herein are difficult to the commercialization CS-E that degrades, but can be to a certain extent The low sulphated CS-E (Fig. 9) of degraded, illustrates that E unit may suppress HCLase Ei vigor, it is difficult to which degrade CS-E, is especially enriched in E unit CS-E.Therefore the oligosaccharides rich in E unit is have accumulated when degrading low sulphated CS-E, this result phase with table 1 Symbol.HCLase and commercialization CSaseABC can degradable CS-E, although can prepare the oligosaccharides of different molecular weight, can not but make The standby oligosaccharides for being rich in E unit.

The bibliography being related in specification

[1].Bradbury,E.J.,et al.,Chondroitinase ABC promotes functional recovery after spinal cord injury.Nature,2002.416(6881):p.636-40.

[2].Kamhi,E.,et al.,Glycosaminoglycans in infectious disease.Biol Rev Camb Philos Soc,2013.88(4):p.928-43.

[3].Linhardt,R.J.,et al.,CS lyases:structure,activity,and applications in analysis and the treatment of diseases.Adv Pharmacol,2006.53: p.187-215.

[4].Jiang,D.,J.Liang and P.W.Noble,Hyaluronan in tissue injury and repair.Annu Rev Cell Dev Biol,2007.23:p.435-61.

[5].Noble,P.W.,Hyaluronan and its catabolic products in tissue injury and repair.Matrix Biol,2002.21(1):p.25-9.

[6].Sugahara,K.,et al.,Recent advances in the structural biology of chondroitin sulfate and dermatan sulfate.Curr Opin Struct Biol,2003.13(5): p.612-20.

[7].Yamada,S.,K.Sugahara and S.Ozbek,Evolution of glycosaminoglycans: Comparative biochemical study.Commun Integr Biol,2011.4(2):p.150-8.

[8].Yamagata,T.,et al.,Purification and properties of bacterial chondroitinases and chondrosulfatases.J Biol Chem,1968.243(7):p.1523-35.

[9].Hiyama,K.and S.Okada,Crystallization and some properties of chondroitinase from Arthrobacter aurescens.J Biol Chem,1975.250(5):p.1824-8.

[10].Yin,F.X.,F.S.Wang and J.Z.Sheng,Uncovering the Catalytic Direction of Chondroitin AC Exolyase:FROM THE REDUCING END TOWARDS THE NON- REDUCING END.J Biol Chem,2016.291(9):p.4399-406.

[11].Gu,K.,et al.,Purification,characterization and specificity of chondroitin lyases and glycuronidase from Flavobacterium heparinum.Biochem J, 1995.312(Pt 2):p.569-77.

[12].Deepa,S.S.,et al.,Specific molecular interactions of oversulfated chondroitin sulfate E with various heparin-binding growth factors.Implications as a physiological binding partner in the brain and other tissues.J Biol Chem,2002.277(46):p.43707-16.

[13].Clement,A.M.,K.Sugahara and A.Faissner,Chondroitin sulfate E promotes neurite outgrowth of rat embryonic day 18 hippocampal neurons.Neurosci Lett,1999.269(3):p.125-8.

[14].Bishop,J.R.,M.Schuksz and J.D.Esko,Heparan sulphate proteoglycans fine-tune mammalian physiology.Nature,2007.446(7139):p.1030-7.

[15].Bergefall,K.,et al.,Chondroitin sulfate characterized by the E- disaccharide unit is a potent inhibitor of herpes simplex virus infectivity and provides the virus binding sites on gro2C cells.J Biol Chem,2005.280(37): p.32193-9.

[16].Sato,Y.,et al.,A highly sulfated chondroitin sulfate preparation,CS-E,prevents excitatory amino acid-induced neuronal cell death.J Neurochem,2008.104(6):p.1565-76.

[17].Li,F.,et al.,Involvement of Highly Sulfated Chondroitin Sulfate in the Metastasis of the Lewis Lung Carcinoma Cells.Journal of Biological Chemistry,2008.283(49):p.34294-34304.

[18].Koike,T.,et al.,Chondroitin sulfate-E mediates estrogen-induced osteoanabolism.Sci Rep,2015.5:p.8994.

SEQUENCE LISTING

<110>Shandong University

<120>A kind of glycosaminoglycan lyases for being difficult to degraded CS-E and its encoding gene and application

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 2973

<212> DNA

<213> Vibrio sp.

<400> 1

ttgaagaagt tcaaattatc ggtaattacc gcatcggtgc tagccattac tggatgtaat 60

ggaataatca aagaagtcga aaatcaacat gcttccgaag ttcaatctca ggcagccaat 120

gagttcgagc tggtgcgcca gaatatgctg agtggttttg ttgagcgcca aaccgacata 180

gccgctagac aacagaaatc agtgtcggag ctagcgcaag agtatgctga cagcatggcc 240

gcggatggca gttgggaaga tattgaatat gccgacgaag atccaactgg ttggcaagcc 300

ggagatcacc taagacgcct gcggatgatc ggcgctgcgt tcgtgcaatc aaataatgcc 360

gatttggcgg atgcggctat ccgtggcttg aactattggc atcaacaaga tttcaaaacc 420

ggttggtggt gggcagacat tggtcagcct caattcctgg gtgaagttgc tctgatgttg 480

ggtgatctgc tgccgatgga gcagcgcttt caaaccgcga tgatcatgtc agatactcct 540

ggagtccgta agagtgataa tgctgagaca actggcggta accgcagtga catcaaccta 600

gtcgtaatct accgtggcct gcttatccat agcaaatctc tggttggcgc cgcagtaaaa 660

gacatggaaa ataccgtcaa actcaccaat ggcgaaggca ttcaggcgga ttactctttc 720

caccagcacg gcgctcaact gtacagcgca ggctatggcg aagtctggtt tggcgcaacc 780

ttgcgagtcg cctatatggt ccgcgatacc gaatggcggt ttagccaaga gaaggcggat 840

attctcacca acttcttcct ggatggctgg cgctggatga agcgcggcaa ccgtctggac 900

tacaacacct ggggacgcgg tatcagccgc agcaaaccag aactgactcc tctggctgag 960

ctaccgccgt taaaaccaag caataatatc acccagatgg atatggtggc tgcattaact 1020

cctgaacgtg cagctgaagc tatggccttt aaagcgcacg ttacaggtgc cagacatggc 1080

gtaccttccg gtttgaatgg ttttaaacac ttctggcgca gtgactattc caccaaaatg 1140

gccgatggtc acttcttcgg cattcgcatg aactcccagc gaacctaccc taatgaaagt 1200

ggtaacggtg aaaacctgtt gggctattgg ctgggcttcg gcagcacatt tctggaacag 1260

cgcggcgacg aataccacaa cattttcccg gtatggaact ggaagttggt gccgggcgta 1320

accgcgcctg aatatgaagg cttgccggat gactggggta aggttgaaca gccagaagtt 1380

gctttcgtgg gtggcgtgtc taacggcaat tatggcgtaa caaccatgga tatgaacctg 1440

gataccagtc cagccaaagg tgatgcattc aacactaaag cgaagaaatc atggttcagc 1500

tttaaaaacg agatagttgc gttaggcgct ggcatctctt caacatccgc tgaaaatgtg 1560

aacactactc tcaaccaggc cctgctcaac ggtaaggtga cggttgatgg tgtggaagtt 1620

gaaaacggtg tacgtgagat cagctctgcc aactgggtgc accatgatgg cgttggctat 1680

atattcccgc aaaacggcga acgccaccta tccaatcagg cgcagaaagg taactggaaa 1740

cggatccgca gtggatcttc cgccaatgaa gtctctaagg atgtcttcac cctgcatatc 1800

agccacggtg tgaagccaag tgacgccgac taccagtaca ttattgtgcc tgagctgacc 1860

gcagagcaga cggcgtccta tcagcagatg atgctagtga ccgtactgca gaatagcacc 1920

agcgtacagg ccgtacgtaa ttccgatctt aagatcactg gtgtcgtttt ccatcaggcc 1980

ggcagcgtag tgatcagcga cgatcttacg gtttctgtag ataaaccgag cgtattgctg 2040

ttagatgaaa gcggtgctga accgatcgta accttatcca ctccaggttt gtcttacgct 2100

gaagttaagc tgacgctgga ctctaaagcc aagggcgaag cggtaactcg catggtgatg 2160

acacacggca aaactgcgga acaaggtaac agcgtaacct tcccgttcta ccaaggtgcg 2220

gagaagataa accaagcctt cagggatgaa atcaagcaag cagaagaaga agcaagagtc 2280

gcagctgaag cccaagccgc agttgttgcc aaagcggaag cagcagccaa agaggcttct 2340

gaagccgaag caaaagctga tgcagaagcc agagcgaagg ccaagcaaga tctggcaact 2400

ggcggactag agctgaaagt gactcaagac gcttatgtgc gcggtggtaa tcaggctgac 2460

aaattcgacg gtattgcttg ggggttcatg ggggtagaaa atcactacaa caacccggca 2520

ctggatcata taagtattct tcgctttgat acaaacggcc tgatgggctt aaaagcgact 2580

tccgccaaat taaagttgca tatccgaggt gttgacaccc gtccagacaa aactggcggt 2640

aatatagata cccgcttgca ggcctttgct gcagacgccg gcgactgggt tgaaaaagaa 2700

agcatcactt ggaatactct accttccacc gatggcgcca cagcatctgg cattgccaca 2760

gccagccatg gtcaaagcca gaaatggatt gagctggatg taactgatat cgtcaacaaa 2820

ttggacagta agcgttcact ggatctgctg ctggttaata tcgacgagaa aggtcaaggc 2880

ggttatgtcg gtttatctac caaagagcac agtggcggta aatatacccc tcagctgcta 2940

atccaaggtg agttgcaaga gccggtgaaa taa 2973

<210> 2

<211> 990

<212> PRT

<213> Vibrio sp.

<400> 2

Leu Lys Lys Phe Lys Leu Ser Val Ile Thr Ala Ser Val Leu Ala Ile

1 5 10 15

Thr Gly Cys Asn Gly Ile Ile Lys Glu Val Glu Asn Gln His Ala Ser

20 25 30

Glu Val Gln Ser Gln Ala Ala Asn Glu Phe Glu Leu Val Arg Gln Asn

35 40 45

Met Leu Ser Gly Phe Val Glu Arg Gln Thr Asp Ile Ala Ala Arg Gln

50 55 60

Gln Lys Ser Val Ser Glu Leu Ala Gln Glu Tyr Ala Asp Ser Met Ala

65 70 75 80

Ala Asp Gly Ser Trp Glu Asp Ile Glu Tyr Ala Asp Glu Asp Pro Thr

85 90 95

Gly Trp Gln Ala Gly Asp His Leu Arg Arg Leu Arg Met Ile Gly Ala

100 105 110

Ala Phe Val Gln Ser Asn Asn Ala Asp Leu Ala Asp Ala Ala Ile Arg

115 120 125

Gly Leu Asn Tyr Trp His Gln Gln Asp Phe Lys Thr Gly Trp Trp Trp

130 135 140

Ala Asp Ile Gly Gln Pro Gln Phe Leu Gly Glu Val Ala Leu Met Leu

145 150 155 160

Gly Asp Leu Leu Pro Met Glu Gln Arg Phe Gln Thr Ala Met Ile Met

165 170 175

Ser Asp Thr Pro Gly Val Arg Lys Ser Asp Asn Ala Glu Thr Thr Gly

180 185 190

Gly Asn Arg Ser Asp Ile Asn Leu Val Val Ile Tyr Arg Gly Leu Leu

195 200 205

Ile His Ser Lys Ser Leu Val Gly Ala Ala Val Lys Asp Met Glu Asn

210 215 220

Thr Val Lys Leu Thr Asn Gly Glu Gly Ile Gln Ala Asp Tyr Ser Phe

225 230 235 240

His Gln His Gly Ala Gln Leu Tyr Ser Ala Gly Tyr Gly Glu Val Trp

245 250 255

Phe Gly Ala Thr Leu Arg Val Ala Tyr Met Val Arg Asp Thr Glu Trp

260 265 270

Arg Phe Ser Gln Glu Lys Ala Asp Ile Leu Thr Asn Phe Phe Leu Asp

275 280 285

Gly Trp Arg Trp Met Lys Arg Gly Asn Arg Leu Asp Tyr Asn Thr Trp

290 295 300

Gly Arg Gly Ile Ser Arg Ser Lys Pro Glu Leu Thr Pro Leu Ala Glu

305 310 315 320

Leu Pro Pro Leu Lys Pro Ser Asn Asn Ile Thr Gln Met Asp Met Val

325 330 335

Ala Ala Leu Thr Pro Glu Arg Ala Ala Glu Ala Met Ala Phe Lys Ala

340 345 350

His Val Thr Gly Ala Arg His Gly Val Pro Ser Gly Leu Asn Gly Phe

355 360 365

Lys His Phe Trp Arg Ser Asp Tyr Ser Thr Lys Met Ala Asp Gly His

370 375 380

Phe Phe Gly Ile Arg Met Asn Ser Gln Arg Thr Tyr Pro Asn Glu Ser

385 390 395 400

Gly Asn Gly Glu Asn Leu Leu Gly Tyr Trp Leu Gly Phe Gly Ser Thr

405 410 415

Phe Leu Glu Gln Arg Gly Asp Glu Tyr His Asn Ile Phe Pro Val Trp

420 425 430

Asn Trp Lys Leu Val Pro Gly Val Thr Ala Pro Glu Tyr Glu Gly Leu

435 440 445

Pro Asp Asp Trp Gly Lys Val Glu Gln Pro Glu Val Ala Phe Val Gly

450 455 460

Gly Val Ser Asn Gly Asn Tyr Gly Val Thr Thr Met Asp Met Asn Leu

465 470 475 480

Asp Thr Ser Pro Ala Lys Gly Asp Ala Phe Asn Thr Lys Ala Lys Lys

485 490 495

Ser Trp Phe Ser Phe Lys Asn Glu Ile Val Ala Leu Gly Ala Gly Ile

500 505 510

Ser Ser Thr Ser Ala Glu Asn Val Asn Thr Thr Leu Asn Gln Ala Leu

515 520 525

Leu Asn Gly Lys Val Thr Val Asp Gly Val Glu Val Glu Asn Gly Val

530 535 540

Arg Glu Ile Ser Ser Ala Asn Trp Val His His Asp Gly Val Gly Tyr

545 550 555 560

Ile Phe Pro Gln Asn Gly Glu Arg His Leu Ser Asn Gln Ala Gln Lys

565 570 575

Gly Asn Trp Lys Arg Ile Arg Ser Gly Ser Ser Ala Asn Glu Val Ser

580 585 590

Lys Asp Val Phe Thr Leu His Ile Ser His Gly Val Lys Pro Ser Asp

595 600 605

Ala Asp Tyr Gln Tyr Ile Ile Val Pro Glu Leu Thr Ala Glu Gln Thr

610 615 620

Ala Ser Tyr Gln Gln Met Met Leu Val Thr Val Leu Gln Asn Ser Thr

625 630 635 640

Ser Val Gln Ala Val Arg Asn Ser Asp Leu Lys Ile Thr Gly Val Val

645 650 655

Phe His Gln Ala Gly Ser Val Val Ile Ser Asp Asp Leu Thr Val Ser

660 665 670

Val Asp Lys Pro Ser Val Leu Leu Leu Asp Glu Ser Gly Ala Glu Pro

675 680 685

Ile Val Thr Leu Ser Thr Pro Gly Leu Ser Tyr Ala Glu Val Lys Leu

690 695 700

Thr Leu Asp Ser Lys Ala Lys Gly Glu Ala Val Thr Arg Met Val Met

705 710 715 720

Thr His Gly Lys Thr Ala Glu Gln Gly Asn Ser Val Thr Phe Pro Phe

725 730 735

Tyr Gln Gly Ala Glu Lys Ile Asn Gln Ala Phe Arg Asp Glu Ile Lys

740 745 750

Gln Ala Glu Glu Glu Ala Arg Val Ala Ala Glu Ala Gln Ala Ala Val

755 760 765

Val Ala Lys Ala Glu Ala Ala Ala Lys Glu Ala Ser Glu Ala Glu Ala

770 775 780

Lys Ala Asp Ala Glu Ala Arg Ala Lys Ala Lys Gln Asp Leu Ala Thr

785 790 795 800

Gly Gly Leu Glu Leu Lys Val Thr Gln Asp Ala Tyr Val Arg Gly Gly

805 810 815

Asn Gln Ala Asp Lys Phe Asp Gly Ile Ala Trp Gly Phe Met Gly Val

820 825 830

Glu Asn His Tyr Asn Asn Pro Ala Leu Asp His Ile Ser Ile Leu Arg

835 840 845

Phe Asp Thr Asn Gly Leu Met Gly Leu Lys Ala Thr Ser Ala Lys Leu

850 855 860

Lys Leu His Ile Arg Gly Val Asp Thr Arg Pro Asp Lys Thr Gly Gly

865 870 875 880

Asn Ile Asp Thr Arg Leu Gln Ala Phe Ala Ala Asp Ala Gly Asp Trp

885 890 895

Val Glu Lys Glu Ser Ile Thr Trp Asn Thr Leu Pro Ser Thr Asp Gly

900 905 910

Ala Thr Ala Ser Gly Ile Ala Thr Ala Ser His Gly Gln Ser Gln Lys

915 920 925

Trp Ile Glu Leu Asp Val Thr Asp Ile Val Asn Lys Leu Asp Ser Lys

930 935 940

Arg Ser Leu Asp Leu Leu Leu Val Asn Ile Asp Glu Lys Gly Gln Gly

945 950 955 960

Gly Tyr Val Gly Leu Ser Thr Lys Glu His Ser Gly Gly Lys Tyr Thr

965 970 975

Pro Gln Leu Leu Ile Gln Gly Glu Leu Gln Glu Pro Val Lys

980 985 990

<210> 3

<211> 990

<212> PRT

<213>It is artificial synthesized

<400> 3

Leu Lys Lys Phe Lys Leu Ser Val Ile Thr Ala Ser Val Leu Ala Ile

1 5 10 15

Thr Gly Cys Asn Gly Ile Ile Lys Glu Val Glu Asn Gln His Ala Ser

20 25 30

Glu Val Gln Ser Gln Gly Ala Asn Glu Phe Glu Leu Val Arg Gln Asn

35 40 45

Met Leu Ser Gly Phe Val Glu Arg Gln Ala Asp Ile Ala Ala Arg Gln

50 55 60

Gln Lys Ser Val Ser Glu Leu Ala Gln Glu Tyr Ala Asp Ser Met Ala

65 70 75 80

Ala Asp Gly Ser Trp Glu Asp Ile Glu Tyr Ala Asp Glu Asp Pro Thr

85 90 95

Gly Trp Gln Ala Gly Asp His Leu Arg Arg Leu Arg Met Ile Gly Ala

100 105 110

Ala Phe Val Gln Ser Asn Asn Ala Asp Leu Ala Asp Ala Ala Ile Arg

115 120 125

Gly Leu Asn Tyr Trp His Gln Gln Asp Phe Lys Thr Gly Trp Trp Trp

130 135 140

Ala Asp Ile Gly Gln Pro Gln Phe Leu Gly Glu Val Ala Leu Met Leu

145 150 155 160

Gly Asp Leu Leu Pro Met Glu Gln Arg Phe Gln Thr Ala Met Ile Met

165 170 175

Ser Asp Thr Pro Gly Val Arg Lys Ser Asp Asn Ala Glu Thr Thr Gly

180 185 190

Gly Asn Arg Ser Asp Ile Asn Leu Val Val Ile Tyr Arg Gly Leu Leu

195 200 205

Ile His Ser Lys Ser Leu Val Gly Ala Ala Val Lys Asp Met Glu Asn

210 215 220

Thr Val Lys Leu Thr Asn Gly Glu Gly Ile Gln Ala Asp Tyr Ser Phe

225 230 235 240

His Gln His Gly Ala Gln Leu Tyr Ser Ala Gly Tyr Gly Glu Val Trp

245 250 255

Phe Gly Ala Thr Leu Arg Val Ala Tyr Met Val Arg Asp Thr Glu Trp

260 265 270

Arg Phe Ser Gln Glu Lys Ala Asp Ile Leu Thr Asn Phe Phe Leu Asp

275 280 285

Gly Trp Arg Trp Met Lys Arg Gly Asn Arg Leu Asp Tyr Asn Thr Trp

290 295 300

Gly Arg Gly Ile Ser Arg Ser Lys Pro Glu Leu Thr Pro Leu Ala Glu

305 310 315 320

Leu Pro Pro Leu Lys Pro Ser Asn Asn Ile Thr Gln Met Asp Met Val

325 330 335

Ala Ala Leu Thr Pro Glu Arg Ala Ala Glu Ala Met Ala Phe Lys Ala

340 345 350

His Val Thr Gly Ala Arg His Gly Val Pro Ser Gly Leu Asn Gly Phe

355 360 365

Lys His Phe Trp Arg Ser Asp Tyr Ser Thr Lys Met Ala Asp Gly His

370 375 380

Phe Phe Gly Ile Arg Met Asn Ser Gln Arg Thr Tyr Pro Asn Glu Ser

385 390 395 400

Gly Asn Gly Glu Asn Leu Leu Gly Tyr Trp Leu Gly Phe Gly Ser Thr

405 410 415

Phe Leu Glu Gln Arg Gly Asp Glu Tyr His Asn Ile Phe Pro Val Trp

420 425 430

Asn Trp Lys Leu Val Pro Gly Val Thr Ala Pro Glu Tyr Glu Gly Leu

435 440 445

Pro Asp Asp Trp Gly Lys Val Glu Gln Pro Glu Val Ala Phe Val Gly

450 455 460

Gly Val Ser Asn Gly Asn Tyr Gly Val Thr Thr Met Asp Met Asn Leu

465 470 475 480

Asp Thr Ser Pro Ala Lys Gly Asp Ala Phe Asn Thr Lys Ala Lys Lys

485 490 495

Ser Trp Phe Ser Phe Lys Asn Glu Ile Val Ala Leu Gly Ala Gly Ile

500 505 510

Ser Ser Thr Ser Ala Glu Asn Val Asn Thr Thr Leu Asn Gln Ala Leu

515 520 525

Leu Asn Gly Lys Val Thr Val Asp Gly Val Glu Val Glu Asn Gly Val

530 535 540

Arg Glu Ile Ser Ser Ala Asn Trp Val His His Asp Gly Val Gly Tyr

545 550 555 560

Ile Phe Pro Gln Asn Gly Glu Arg His Leu Ser Asn Gln Ala Gln Lys

565 570 575

Gly Asn Trp Lys Arg Ile Arg Ser Gly Ser Ser Ala Asn Glu Val Ser

580 585 590

Lys Asp Val Phe Thr Leu His Ile Ser His Gly Val Lys Pro Ser Asp

595 600 605

Ala Asp Tyr Gln Tyr Ile Ile Val Pro Glu Leu Thr Ala Glu Gln Thr

610 615 620

Ala Ser Tyr Gln Gln Met Met Leu Val Thr Val Leu Gln Asn Ser Thr

625 630 635 640

Ser Val Gln Gly Val Arg Asn Ser Asp Leu Lys Ile Thr Gly Val Val

645 650 655

Phe His Gln Ala Gly Ser Val Val Ile Ser Asp Asp Leu Ala Val Ser

660 665 670

Val Asp Lys Pro Ser Val Leu Leu Leu Asp Glu Ser Gly Ala Glu Pro

675 680 685

Ile Val Thr Leu Ser Thr Leu Gly Leu Ser Tyr Ala Glu Val Lys Leu

690 695 700

Thr Leu Asp Ser Lys Ala Lys Gly Glu Ala Val Thr Arg Met Val Met

705 710 715 720

Thr His Gly Lys Thr Ala Glu Gln Gly Asn Ser Val Thr Phe Pro Phe

725 730 735

Tyr Gln Gly Ala Glu Lys Ile Asn Gln Ala Phe Arg Asp Glu Ile Lys

740 745 750

Gln Ala Glu Glu Glu Ala Arg Val Ala Ala Glu Ala Gln Ala Ala Val

755 760 765

Val Ala Lys Ala Glu Ala Ala Ala Lys Glu Ala Ser Glu Ala Glu Ala

770 775 780

Lys Ala Asp Ala Glu Ala Arg Ala Lys Ala Lys Gln Asp Leu Ala Thr

785 790 795 800

Gly Gly Leu Glu Leu Lys Val Thr Gln Asp Ala Tyr Val Arg Gly Gly

805 810 815

Asn Gln Ala Asp Lys Phe Asp Gly Ile Ala Trp Gly Phe Met Val Val

820 825 830

Glu Asn His Tyr Asn Asn Pro Ala Leu Asp His Ile Ser Ile Leu Arg

835 840 845

Phe Asp Thr Asn Gly Leu Met Gly Leu Lys Ala Thr Ser Ala Lys Leu

850 855 860

Lys Leu His Ile Arg Gly Val Asp Thr Arg Pro Asp Lys Thr Gly Gly

865 870 875 880

Asn Ile Asp Thr Arg Leu Gln Ala Phe Ala Ala Asp Ala Gly Asp Trp

885 890 895

Val Glu Lys Glu Ser Ile Thr Trp Asn Thr Leu Pro Ser Thr Asp Gly

900 905 910

Ala Thr Ala Ser Gly Ile Ala Thr Ala Ser His Gly Gln Ser Gln Lys

915 920 925

Trp Ile Glu Leu Asp Val Thr Asp Ile Val Asn Lys Leu Asp Ser Lys

930 935 940

Arg Ser Leu Asp Leu Leu Leu Val Asn Ile Asp Glu Lys Gly Gln Gly

945 950 955 960

Gly Tyr Val Gly Leu Ser Thr Lys Glu His Ser Gly Gly Lys Tyr Thr

965 970 975

Pro Gln Leu Leu Ile Gln Gly Glu Leu Gln Glu Pro Val Lys

980 985 990

<210> 4

<211> 990

<212> PRT

<213>It is artificial synthesized

<400> 4

Leu Lys Lys Phe Lys Leu Ser Val Ile Thr Ala Ser Val Leu Ala Ile

1 5 10 15

Thr Gly Cys Asn Gly Ile Ile Lys Glu Val Glu Asn Gln His Ala Ser

20 25 30

Glu Val Gln Ser Gln Gly Ala Asn Glu Phe Glu Leu Val Arg Gln Asn

35 40 45

Met Leu Ser Gly Phe Val Glu Arg Gln Ala Asp Ile Ala Ala Arg Gln

50 55 60

Gln Lys Ser Val Ser Glu Leu Ala Gln Glu Tyr Ala Asp Ser Met Ala

65 70 75 80

Ala Asp Gly Ser Trp Glu Asp Ile Glu Tyr Ala Asp Glu Asp Pro Thr

85 90 95

Gly Trp Gln Ala Gly Asp His Leu Arg Arg Leu Arg Met Ile Gly Ala

100 105 110

Ala Phe Val Gln Ser Asn Asn Ala Asp Leu Ala Asp Ala Ala Ile Arg

115 120 125

Gly Leu Asn Tyr Trp His Gln Gln Asp Phe Lys Thr Gly Trp Trp Trp

130 135 140

Ala Asp Ile Gly Gln Pro Gln Phe Leu Gly Glu Val Ala Leu Met Leu

145 150 155 160

Gly Asp Leu Leu Pro Met Glu Gln Arg Phe Gln Thr Ala Met Ile Met

165 170 175

Ser Asp Thr Pro Gly Val Arg Lys Ser Asp Asn Ala Glu Thr Thr Gly

180 185 190

Gly Asn Arg Ser Asp Ile Asn Leu Val Val Ile Tyr Arg Gly Leu Leu

195 200 205

Ile His Ser Lys Ser Leu Val Gly Ala Ala Val Lys Asp Met Glu Asn

210 215 220

Thr Val Lys Leu Thr Asn Gly Glu Gly Ile Gln Ala Asp Tyr Ser Phe

225 230 235 240

His Gln His Gly Ala Gln Leu Tyr Ser Ala Gly Tyr Gly Glu Val Trp

245 250 255

Phe Gly Ala Thr Leu Arg Val Ala Tyr Met Val Arg Asp Thr Glu Trp

260 265 270

Arg Phe Ser Gln Glu Lys Ala Asp Ile Leu Thr Asn Phe Phe Leu Asp

275 280 285

Gly Trp Arg Trp Met Lys Arg Gly Asn Arg Leu Asp Tyr Asn Thr Trp

290 295 300

Gly Arg Gly Ile Ser Arg Ser Lys Pro Glu Leu Thr Pro Leu Ala Glu

305 310 315 320

Leu Pro Pro Leu Lys Pro Ser Asn Asn Ile Thr Gln Met Asp Met Val

325 330 335

Ala Ala Leu Thr Pro Glu Arg Ala Ala Glu Ala Met Ala Phe Lys Ala

340 345 350

His Val Thr Gly Ala Arg His Gly Val Pro Ser Gly Leu Asn Gly Phe

355 360 365

Lys His Phe Trp Arg Ser Asp Tyr Ser Thr Lys Met Ala Asp Gly His

370 375 380

Phe Phe Gly Ile Arg Met Asn Ser Gln Arg Thr Tyr Pro Asn Glu Ser

385 390 395 400

Gly Asn Gly Glu Asn Leu Leu Gly Tyr Trp Leu Gly Phe Gly Ser Thr

405 410 415

Phe Leu Glu Gln Arg Gly Asp Glu Tyr His Asn Ile Phe Pro Val Trp

420 425 430

Asn Trp Lys Leu Val Pro Gly Val Thr Ala Pro Glu Tyr Glu Gly Leu

435 440 445

Pro Asp Asp Trp Gly Lys Val Glu Gln Pro Glu Val Ala Phe Val Gly

450 455 460

Gly Val Ser Asn Gly Asn Tyr Gly Val Thr Thr Met Asp Met Asn Leu

465 470 475 480

Asp Thr Ser Pro Ala Lys Gly Asp Ala Phe Asn Thr Lys Ala Lys Lys

485 490 495

Ser Trp Phe Ser Phe Lys Asn Glu Ile Val Ala Leu Gly Ala Gly Ile

500 505 510

Ser Ser Thr Ser Ala Glu Asn Val Asn Thr Thr Leu Asn Gln Ala Leu

515 520 525

Leu Asn Gly Lys Val Thr Val Asp Gly Val Glu Val Glu Asn Gly Val

530 535 540

Arg Glu Ile Ser Ser Ala Asn Trp Val His His Asp Gly Val Gly Tyr

545 550 555 560

Ile Phe Pro Gln Asn Gly Glu Arg His Leu Ser Asn Gln Ala Gln Lys

565 570 575

Gly Asn Trp Lys Arg Ile Arg Ser Gly Ser Ser Ala Asn Glu Val Ser

580 585 590

Lys Asp Val Phe Thr Leu His Ile Ser His Gly Val Lys Pro Ser Asp

595 600 605

Ala Asp Tyr Gln Tyr Ile Ile Val Pro Glu Leu Thr Ala Glu Gln Thr

610 615 620

Ala Ser Tyr Gln Gln Met Met Leu Val Thr Val Leu Gln Asn Ser Thr

625 630 635 640

Ser Val Gln Gly Val Arg Asn Ser Asp Leu Lys Ile Thr Gly Val Val

645 650 655

Phe His Gln Ala Gly Ser Val Val Ile Ser Asp Asp Leu Ala Val Ser

660 665 670

Val Asp Lys Pro Ser Val Leu Leu Leu Asp Glu Ser Gly Ala Glu Pro

675 680 685

Ile Val Thr Leu Ser Thr Leu Gly Leu Ser Tyr Ala Glu Val Lys Leu

690 695 700

Thr Leu Asp Ser Lys Ala Lys Gly Glu Ala Val Thr Arg Met Val Met

705 710 715 720

Thr His Gly Lys Thr Ala Glu Gln Gly Asn Ser Val Thr Phe Pro Phe

725 730 735

Tyr Gln Gly Ala Glu Lys Ile Asn Gln Ala Phe Arg Asp Glu Ile Lys

740 745 750

Gln Ala Glu Glu Glu Ala Arg Val Ala Ala Glu Ala Gln Ala Ala Val

755 760 765

Val Ala Lys Ala Glu Ala Ala Ala Lys Glu Ala Ser Glu Ala Glu Ala

770 775 780

Lys Ala Asp Ala Glu Ala Arg Ala Lys Ala Lys Gln Asp Leu Ala Thr

785 790 795 800

Gly Gly Leu Glu Leu Lys Val Thr Gln Asp Ala Tyr Val Arg Gly Gly

805 810 815

Asn Gln Ala Asp Lys Phe Asp Gly Ile Ala Trp Gly Phe Met Val Val

820 825 830

Glu Asn His Tyr Asn Asn Pro Ala Leu Asp His Ile Leu Ile Leu Arg

835 840 845

Phe Asp Thr Asn Gly Leu Met Gly Leu Lys Ala Thr Ser Ala Lys Leu

850 855 860

Lys Leu His Ile Arg Gly Val Asp Thr Arg Pro Asp Lys Thr Gly Gly

865 870 875 880

Asn Ile Asp Ala Arg Leu Gln Ala Phe Ala Ala Asp Ala Gly Asp Trp

885 890 895

Val Glu Lys Glu Ser Ile Thr Trp Asn Thr Leu Pro Ser Thr Asp Gly

900 905 910

Ala Thr Ala Ser Gly Ile Ala Thr Ala Ser His Gly Gln Ser Gln Lys

915 920 925

Trp Ile Glu Leu Asp Val Thr Asp Ile Val Asn Lys Leu Asp Ser Lys

930 935 940

Arg Ser Leu Asp Leu Leu Leu Val Asn Ile Asp Glu Lys Gly Gln Gly

945 950 955 960

Gly Tyr Val Gly Leu Ser Thr Lys Glu His Ser Gly Gly Lys Tyr Thr

965 970 975

Pro Gln Leu Leu Ile Gln Gly Glu Leu Gln Glu Pro Val Lys

980 985 990

<210> 5

<211> 2973

<212> DNA

<213>It is artificial synthesized

<400> 5

ttgaagaagt tcaaattatc ggtaattacc gcatcggtgc tagccattac tggatgtaat 60

ggaataatca aagaagtcga aaatcaacat gcttccgaag ttcaatctca gggcgccaat 120

gagttcgagc tggtgcgcca gaatatgctg agtggttttg ttgagcgcca agcagacata 180

gccgctagac aacagaaatc agtgtcggag ctagcgcaag agtatgctga cagcatggcc 240

gcggatggca gttgggaaga tattgaatat gccgacgaag atccaactgg ttggcaagcc 300

ggagatcacc taagacgcct gcggatgatc ggcgctgcgt tcgtgcaatc aaataatgcc 360

gatttggcgg atgcggctat ccgtggcttg aactattggc atcaacaaga tttcaaaacc 420

ggttggtggt gggcagacat tggtcagcct caattcctgg gtgaagttgc tctgatgttg 480

ggtgatctgc tgccgatgga gcagcgcttt caaaccgcga tgatcatgtc agatactcct 540

ggagtccgta agagtgataa tgctgagaca actggcggta accgcagtga catcaaccta 600

gtcgtaatct accgtggcct gcttatccat agcaaatctc tggttggcgc cgcagtaaaa 660

gacatggaaa ataccgtcaa actcaccaat ggcgaaggca ttcaggcgga ttactctttc 720

caccagcacg gcgctcaact gtacagcgca ggctatggcg aagtctggtt tggcgcaacc 780

ttgcgagtcg cctatatggt ccgcgatacc gaatggcggt ttagccaaga gaaggcggat 840

attctcacca acttcttcct ggatggctgg cgctggatga agcgcggcaa ccgtctggac 900

tacaacacct ggggacgcgg tatcagccgc agcaaaccag aactgactcc tctggctgag 960

ctaccgccgt taaaaccaag caataatatc acccagatgg atatggtggc tgcattaact 1020

cctgaacgtg cagctgaagc tatggccttt aaagcgcacg ttacaggtgc cagacatggc 1080

gtaccttccg gtttgaatgg ttttaaacac ttctggcgca gtgactattc caccaaaatg 1140

gccgatggtc acttcttcgg cattcgcatg aactcccagc gaacctaccc taatgaaagt 1200

ggtaacggtg aaaacctgtt gggctattgg ctgggcttcg gcagcacatt tctggaacag 1260

cgcggcgacg aataccacaa cattttcccg gtatggaact ggaagttggt gccgggcgta 1320

accgcgcctg aatatgaagg cttgccggat gactggggta aggttgaaca gccagaagtt 1380

gctttcgtgg gtggcgtgtc taacggcaat tatggcgtaa caaccatgga tatgaacctg 1440

gataccagtc cagccaaagg tgatgcattc aacactaaag cgaagaaatc atggttcagc 1500

tttaaaaacg agatagttgc gttaggcgct ggcatctctt caacatccgc tgaaaatgtg 1560

aacactactc tcaaccaggc cctgctcaac ggtaaggtga cggttgatgg tgtggaagtt 1620

gaaaacggtg tacgtgagat cagctctgcc aactgggtgc accatgatgg cgttggctat 1680

atattcccgc aaaacggcga acgccaccta tccaatcagg cgcagaaagg taactggaaa 1740

cggatccgca gtggatcttc cgccaatgaa gtctctaagg atgtcttcac cctgcatatc 1800

agccacggtg tgaagccaag tgacgccgac taccagtaca ttattgtgcc tgagctgacc 1860

gcagagcaga cggcgtccta tcagcagatg atgctagtga ccgtactgca gaatagcacc 1920

agcgtacagg gcgtacgtaa ttccgatctt aagatcactg gtgtcgtttt ccatcaggcc 1980

ggcagcgtag tgatcagcga cgatcttgca gtttctgtag ataaaccgag cgtattgctg 2040

ttagatgaaa gcggtgctga accgatcgta accttatcca ctctaggttt gtcttacgct 2100

gaagttaagc tgacgctgga ctctaaagcc aagggcgaag cggtaactcg catggtgatg 2160

acacacggca aaactgcgga acaaggtaac agcgtaacct tcccgttcta ccaaggtgcg 2220

gagaagataa accaagcctt cagggatgaa atcaagcaag cagaagaaga agcaagagtc 2280

gcagctgaag cccaagccgc agttgttgcc aaagcggaag cagcagccaa agaggcttct 2340

gaagccgaag caaaagctga tgcagaagcc agagcgaagg ccaagcaaga tctggcaact 2400

ggcggactag agctgaaagt gactcaagac gcttatgtgc gcggtggtaa tcaggctgac 2460

aaattcgacg gtattgcttg ggggttcatg gtggtagaaa atcactacaa caacccggca 2520

ctggatcata taagtattct tcgctttgat acaaacggcc tgatgggctt aaaagcgact 2580

tccgccaaat taaagttgca tatccgaggt gttgacaccc gtccagacaa aactggcggt 2640

aatatagata cccgcttgca ggcctttgct gcagacgccg gcgactgggt tgaaaaagaa 2700

agcatcactt ggaatactct accttccacc gatggcgcca cagcatctgg cattgccaca 2760

gccagccatg gtcaaagcca gaaatggatt gagctggatg taactgatat cgtcaacaaa 2820

ttggacagta agcgttcact ggatctgctg ctggttaata tcgacgagaa aggtcaaggc 2880

ggttatgtcg gtttatctac caaagagcac agtggcggta aatatacccc tcagctgcta 2940

atccaaggtg agttgcaaga gccggtgaaa taa 2973

<210> 6

<211> 2973

<212> DNA

<213>It is artificial synthesized

<400> 6

ttgaagaagt tcaaattatc ggtaattacc gcatcggtgc tagccattac tggatgtaat 60

ggaataatca aagaagtcga aaatcaacat gcttccgaag ttcaatctca gggcgccaat 120

gagttcgagc tggtgcgcca gaatatgctg agtggttttg ttgagcgcca agcagacata 180

gccgctagac aacagaaatc agtgtcggag ctagcgcaag agtatgctga cagcatggcc 240

gcggatggca gttgggaaga tattgaatat gccgacgaag atccaactgg ttggcaagcc 300

ggagatcacc taagacgcct gcggatgatc ggcgctgcgt tcgtgcaatc aaataatgcc 360

gatttggcgg atgcggctat ccgtggcttg aactattggc atcaacaaga tttcaaaacc 420

ggttggtggt gggcagacat tggtcagcct caattcctgg gtgaagttgc tctgatgttg 480

ggtgatctgc tgccgatgga gcagcgcttt caaaccgcga tgatcatgtc agatactcct 540

ggagtccgta agagtgataa tgctgagaca actggcggta accgcagtga catcaaccta 600

gtcgtaatct accgtggcct gcttatccat agcaaatctc tggttggcgc cgcagtaaaa 660

gacatggaaa ataccgtcaa actcaccaat ggcgaaggca ttcaggcgga ttactctttc 720

caccagcacg gcgctcaact gtacagcgca ggctatggcg aagtctggtt tggcgcaacc 780

ttgcgagtcg cctatatggt ccgcgatacc gaatggcggt ttagccaaga gaaggcggat 840

attctcacca acttcttcct ggatggctgg cgctggatga agcgcggcaa ccgtctggac 900

tacaacacct ggggacgcgg tatcagccgc agcaaaccag aactgactcc tctggctgag 960

ctaccgccgt taaaaccaag caataatatc acccagatgg atatggtggc tgcattaact 1020

cctgaacgtg cagctgaagc tatggccttt aaagcgcacg ttacaggtgc cagacatggc 1080

gtaccttccg gtttgaatgg ttttaaacac ttctggcgca gtgactattc caccaaaatg 1140

gccgatggtc acttcttcgg cattcgcatg aactcccagc gaacctaccc taatgaaagt 1200

ggtaacggtg aaaacctgtt gggctattgg ctgggcttcg gcagcacatt tctggaacag 1260

cgcggcgacg aataccacaa cattttcccg gtatggaact ggaagttggt gccgggcgta 1320

accgcgcctg aatatgaagg cttgccggat gactggggta aggttgaaca gccagaagtt 1380

gctttcgtgg gtggcgtgtc taacggcaat tatggcgtaa caaccatgga tatgaacctg 1440

gataccagtc cagccaaagg tgatgcattc aacactaaag cgaagaaatc atggttcagc 1500

tttaaaaacg agatagttgc gttaggcgct ggcatctctt caacatccgc tgaaaatgtg 1560

aacactactc tcaaccaggc cctgctcaac ggtaaggtga cggttgatgg tgtggaagtt 1620

gaaaacggtg tacgtgagat cagctctgcc aactgggtgc accatgatgg cgttggctat 1680

atattcccgc aaaacggcga acgccaccta tccaatcagg cgcagaaagg taactggaaa 1740

cggatccgca gtggatcttc cgccaatgaa gtctctaagg atgtcttcac cctgcatatc 1800

agccacggtg tgaagccaag tgacgccgac taccagtaca ttattgtgcc tgagctgacc 1860

gcagagcaga cggcgtccta tcagcagatg atgctagtga ccgtactgca gaatagcacc 1920

agcgtacagg gcgtacgtaa ttccgatctt aagatcactg gtgtcgtttt ccatcaggcc 1980

ggcagcgtag tgatcagcga cgatcttgca gtttctgtag ataaaccgag cgtattgctg 2040

ttagatgaaa gcggtgctga accgatcgta accttatcca ctctaggttt gtcttacgct 2100

gaagttaagc tgacgctgga ctctaaagcc aagggcgaag cggtaactcg catggtgatg 2160

acacacggca aaactgcgga acaaggtaac agcgtaacct tcccgttcta ccaaggtgcg 2220

gagaagataa accaagcctt cagggatgaa atcaagcaag cagaagaaga agcaagagtc 2280

gcagctgaag cccaagccgc agttgttgcc aaagcggaag cagcagccaa agaggcttct 2340

gaagccgaag caaaagctga tgcagaagcc agagcgaagg ccaagcaaga tctggcaact 2400

ggcggactag agctgaaagt gactcaagac gcttatgtgc gcggtggtaa tcaggctgac 2460

aaattcgacg gtattgcttg ggggttcatg gtggtagaaa atcactacaa caacccggca 2520

ctggatcata tacttattct tcgctttgat acaaacggcc tgatgggctt aaaagcgact 2580

tccgccaaat taaagttgca tatccgaggt gttgacaccc gtccagacaa aactggcggt 2640

aatatagatg cacgcttgca ggcctttgct gcagacgccg gcgactgggt tgaaaaagaa 2700

agcatcactt ggaatactct accttccacc gatggcgcca cagcatctgg cattgccaca 2760

gccagccatg gtcaaagcca gaaatggatt gagctggatg taactgatat cgtcaacaaa 2820

ttggacagta agcgttcact ggatctgctg ctggttaata tcgacgagaa aggtcaaggc 2880

ggttatgtcg gtttatctac caaagagcac agtggcggta aatatacccc tcagctgcta 2940

atccaaggtg agttgcaaga gccggtgaaa taa 2973

Claims

1. a kind of glycosaminoglycan lyases for being difficult to degraded CS-E, it is characterised in that amino acid sequence is as shown in (a) or (b)：

(a) amino acid sequence is as shown in SEQ ID NO.2；

(b) amino acid sequence in (a) is by replacing, lacking or add one or more amino acid and poly- with osamine Sugar cracking enzymatic activity as protein derived from (a).

2. glycosaminoglycan lyases as claimed in claim 1, it is characterised in that the amino acid sequence (b) such as SEQ ID Shown in NO.3 or SEQ ID NO.4.

3. it is a kind of be difficult to degrade CS-E glycosaminoglycan lyases encoding gene, it is characterised in that nucleotide sequence such as (i) or (ii) shown in：

(i) nucleotide sequence is as shown in SEQ ID NO.1；

(ii) albumen of DNA sequence dna hybridization and coding with glycosaminoglycan cracking enzymatic activity limited under strict conditions with (i) The DNA molecular of matter.

4. encoding gene as claimed in claim 3, it is characterised in that stringent condition described in the nucleotide sequence (ii) Under, refer to：

In the 6 × SSC buffer solutions of the 0.5%SDS containing mass concentration, hybridize at 65 DEG C, then with containing mass concentration 0.1% SDS 2 × SSC buffer solutions and the 1 × SSC buffer solutions of the 0.1%SDS containing mass concentration respectively wash film once.

5. encoding gene as claimed in claim 4, it is characterised in that the nucleotide sequence (ii) such as SEQ ID NO.5 or Shown in SEQ ID NO.6.

6. a kind of recombinant expression carrier, the osamine being difficult to degraded CS-E described in claim 3 is inserted in expression vector and is gathered The encoding gene of sugared lyases；

It is preferred that, above-mentioned expression vector is selected from coli expression carrier, Yeast expression carrier, hay bacillus expression vector, breast Sour bacterium expression vector, streptomyces expression vector, phage vector, filamentous fungi expression vector, plant expression vector, insect expression Carrier or mammalian cell expression vector.

7. a kind of recombinant cell, inserts the glycosaminoglycan lyases being difficult to degraded CS-E described in claim 3 in cell Encoding gene；

It is preferred that, above-mentioned cell is selected from e. coli host cell, yeast host cells, hay bacillus host cell, lactic acid Bacterium host cell, actinomyces host cell, filamentous fungal host cell, insect cell or mammalian cell.

8. it is difficult to absorption or delivering composition of the degraded CS-E glycosaminoglycan lyases as enhancing medicine described in claim 1 to exist Prepare the application in medicine.

9. a kind of utilize chondroitin sulfates of the glycosaminoglycan lyases HCLase Ei in degraded squid source for being difficult to degraded CS-E Application in the relatively uniform different polymerization degree oligosaccharides of CS-E preparation structures.

10. the relatively uniform different polymerization degree oligosaccharides of the structure of claim 9 preparation is preparing suppression Nasopharyngeal neoplasms medicine In application.