CN107300543A - The method of AgNCs probe super sensitivity detection mercury ion of the one kind based on T Hg (II) T structures - Google Patents

The method of AgNCs probe super sensitivity detection mercury ion of the one kind based on T Hg (II) T structures Download PDF

Info

Publication number
CN107300543A
CN107300543A CN201710401070.1A CN201710401070A CN107300543A CN 107300543 A CN107300543 A CN 107300543A CN 201710401070 A CN201710401070 A CN 201710401070A CN 107300543 A CN107300543 A CN 107300543A
Authority
CN
China
Prior art keywords
agncs
dna1
dna2
fluorescence
solution
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710401070.1A
Other languages
Chinese (zh)
Other versions
CN107300543B (en
Inventor
邓春艳
丁亚林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Central South University
Original Assignee
Central South University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Central South University filed Critical Central South University
Priority to CN201710401070.1A priority Critical patent/CN107300543B/en
Publication of CN107300543A publication Critical patent/CN107300543A/en
Application granted granted Critical
Publication of CN107300543B publication Critical patent/CN107300543B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K11/00—Luminescent, e.g. electroluminescent, chemiluminescent materials
    • C09K11/08—Luminescent, e.g. electroluminescent, chemiluminescent materials containing inorganic luminescent materials
    • C09K11/65—Luminescent, e.g. electroluminescent, chemiluminescent materials containing inorganic luminescent materials containing carbon

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Inorganic Chemistry (AREA)
  • Optics & Photonics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Materials Engineering (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)

Abstract

A kind of method of AgNCs probe super sensitivity detection mercury ions based on T Hg (II) T structures of the invention, this method is using DNA1 as templated synthesis silver nanoclusters (DNA1 AgNCs), DNA1 AgNCs and DNA2, which hybridizes, to be combined, obtain DNA1/DNA2 AgNCs fluorescence probes, the concentration of the Hg (II) in the change in fluorescence detection solution of DNA1/DNA2 AgNCs fluorescence probes is recycled, this method has good label-free, signal, high specificity, sensitivity is high, detectable concentration scope is wide, the low advantage of test limit.

Description

AgNCs probe super sensitivity detection mercury ion of the one kind based on T-Hg (II)-T structures Method
Technical field
The present invention relates to a kind of Hg2+Detection method, more particularly to a kind of is templated synthesis DNA1/DNA2- based on DNA AgNCs fluorescence probes, and using DNA1/DNA2-AgNCs fluorescence probes to Hg2+The method of specificity fluorescent detection, belongs to biological Field of sensing technologies.
Background technology
Metal mercury ions are widely present in the Nature with the form of inorganic salts and organic coordination compound and metal mercury. Mercury ion is accumulated easily by food chain in vivo, causes brain, liver and central nervous system are by permanent wound Evil.EPA (EPA) strictly defines concentration≤10nM of Mercury in Drinking Water ion.At present to the micro- of metal mercury ion The problem of amount detection becomes a solution too impatient to wait, the reliable metal mercury ion detecting method of tradition is mainly based upon atom Absorption/emission spectrometry.However, such method is time-consuming and expends large number quipments.In the last few years, many team were directed to always Metal ion quotes fluorescence metal nanocluster (NCs) as the research of new inducing probes in environment and biosystem, and And have document report by metal ion and silver nanoclusters occur fluorescent quenching (DNA/AgNCs) (Peng, J., et al., Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization.Spectrochim Acta A Mol Biomol Spectrosc,2015.137:P.1250-7.) or in marking fluorescein to realize in nucleic acid chains the fluorescence of micro mercury ion is examined Survey (Zhang, H., et al., Hg2+-triggered exonuclease III-assisted dual-cycle targets recycling amplification for label-free and ultrasensitive colorimetric detection of Hg2+.Sensors and Actuators B:Chemical,2017.246:p.896-903.).Such side The maximum defect of method is low to mercury ion progress accuracy in detection using fluorescent quenching, and additionally need that fluorescein is marked is glimmering Light probe, cost is high, and synthesis is complicated, detects limit for height, and detection is linear narrow.
The content of the invention
For Hg in existing detection water sample2+The defect that the method for concentration is present, the purpose of the present invention is to be offer one Plant good label-free, signal, high specificity, sensitivity is high, detectable concentration scope is wide and test limit is low to Hg2+Specificity fluorescent The method of detection.
In order to realize above-mentioned technical purpose, surpass the invention provides a kind of AgNCs probes based on T-Hg (II)-T structures The method of Sensitive Detection mercury ion, this method comprises the following steps：
1) using DNA1 as templated synthesis DNA1-AgNCs；
2) DNA1-AgNCs and DNA2, which hybridizes, combines, and obtains DNA1/DNA2-AgNCs fluorescence probes；
3) a series of Hg of the DNA1/DNA2-AgNCs fluorescence probes and various concentrations2+After standard liquid reaction, carry out Fluoroscopic examination, obtains a series of fluorescence signal values, sets up Hg2+The standard curve of solution concentration and fluorescence signal value；
4) by DNA1/DNA2-AgNCs fluorescence probes and Hg to be measured2+After solution reaction, fluoroscopic examination is carried out, fluorescence is obtained Signal value, and according to standard curve, calculate Hg to be measured2+The concentration of solution；
The DNA1, which is included, to be hybridized complementary fragment with DNA2, synthesizes AgNCs template segments and and Hg2+Specificity knot The fragment of conjunction；
The DNA2, which is included, to be hybridized complementary fragment with DNA1, makes the fragment and and Hg of AgNCs Fluorescence Increasings2+Specificity With reference to fragment.
Technical scheme key is using DNA as templated synthesis AgNCs silver nanoclusters fluorescence probes, then profit With AgNCs silver nanoclusters fluorescence probes to Hg2+Specificity fluorescent is detected.Templated synthesis silver nanoclusters are used as first with DNA1 (template segments that synthesizing nano-silver cluster is contained in DNA1), are treated after fluorescent stabilization, addition DNA2 (is wrapped in DNA2 in system Contain and hybridized complementary fragment, the fragment for making silver nanoclusters Fluorescence Increasing and continuous thymidine (thymine, T) with DNA1 Or increase certain repetition AGC sequences after continuous T).After DNA2 is added in system, DNA1 is sent out with DNA2 partial complementarities Part guanine (guanine, G) strengthens fluorescence signal close to silver nanoclusters in raw hybridization, DNA2.Added again in system Hg2+, thymidine T in the DNA1 and DNA2 chains and Hg added2+Specific binding forms stable T-Hg2+- T, is conducive to DNA1 and DNA2 chains are stretched so that the guanine G in DNA2 is closer to AgNCs, so as to cause fluorescence signal to be remarkably reinforced.Cause This, gradually enhanced trend is presented with the increase of ion concentration of mercury in the fluorescence of whole system.Using the principle, Hg is realized2+ Specificity fluorescent detect, and between 0.00002nM~0.16nM scopes system fluorescence intensity with concentration increase be in line Property enhancing.Detection of this fluorescence probe compared with transmission spectra method relatively to mercury ion, the detection range of linearity of this fluorescence probe Relatively broad, test limit is lower.
It is preferred that scheme, the Serial No. of the DNA1：5'-TTTTTTCCCCCTAATTCCCAA AGCTCGACGGATT- 3'。
It is preferred that scheme, the Serial No. of the DNA2：5'-AATCCGTCGAGCAGGGGAAGGGGAAGGGTTTTTT- 3', or be 5'-AATCCGTCGAGCAGGGGAAGGGGAAGGGTTTTTTCGACGACGACGACGACGAC GACGACGACGA- 3'。
The DNA1 and DNA2 of the present invention can be bought in Shanghai bioengineering Co., Ltd.Both sequences are as follows：DNA1: 5'-TTTTTTCCCCCTAATTCCCAA AGCTCGACGGATT-3'；DNA2：5'- AATCCGTCGAGCAGGGGAAGGGGAAGGGTTTTTT-3' or 5'- AATCCGTCGAGCAGGGGAAGGGGAAGGGTTTTTTCGACGACGACGACGACGACGACGACGACGA-3'；According to above-mentioned DNA sequence dna understand, DNA1 and DNA2 are constituted by three parts:12,5' ends base in 12,3' ends base and DNA2 in DNA1 Carry out complete complementary；DNA1 pars intermedia CCCCCTAATTCCCAAA fragments as synthesis silver nanoclusters template, in DNA2 Between part AGG GGA AGGGGAAGGG be the part rich in G bases, be mainly used in increase fluorescence signal, when guanine G is close Strengthen fluorescence signal during silver nanoclusters；3' ends are 6 thymidine T in 5' ends and DNA2 in DNA1.In addition, in DNA2 cores When acid sequence is designed, experiments prove that in DNA2 certain and DNA1 incomplementarities the base sequence of 3' ends increase, Ke Yituo The degree of accuracy of the wide fluorescence probe to the detection interval of mercury ion, and enhancing mercury ion detecting.When DNA1/DNA2-AgNCs fluorescence Probe adds Hg2+Afterwards, the thymidine T and Hg in DNA1 and DNA2 chains2+Specific binding forms stable rigid structure T- Hg2+- T, makes DNA1 5 ＇ ends and DNA2 3 ＇ ends be combined to form rectilinear rigid structure.Now DNA2 chains center section AGGGGA repetitive sequences are presented gradually closer to template silver nanoclusters, the fluorescence of whole system with the increase of ion concentration of mercury Enhanced trend, therefore the fluorescence of probe can strengthen with the increase of ion concentration of mercury.Particularly in T-Hg2+The tail of-T structures When end increases certain pulling force (different AGC repetitive sequences), detection sensitivity of the probe to mercury ion can be improved, makes detection zone Between it is wider.
It is preferred that scheme, by dissolved with DNA1 phosphate buffer and AgNO3After solution mixing, NaBH is added4Solution is mixed, 1~3h is reacted under 20~30 DEG C of constant temperature, DNA1-AgNCs is produced.Preferred synthetic DNA 1-AgNCs method：First will DNA1 shakes mixing 15min at room temperature with silver nitrate solution, phosphate buffer (20mM, pH=7.0), is subsequently added Fresh Sodium borohydride, rapid concussion mixes, is subsequently placed in 25 DEG C of constant water bath box and reacts 2h, you can detect its fluorescence signal.Through Experiment proves that the method synthesis silver nanoclusters only need 2h, whole DNA1-AgNCs systems 2h to be that can reach stabilization.
More preferably scheme, DNA1, AgNO3And NaBH4Mol ratio be 1:5~7:5~7.More preferably 1:6:6.
It is preferred that scheme, the DNA1-AgNCs silver nanoclusters mix with DNA2 equimolar ratios, react, produce at room temperature DNA1/DNA2-AgNCs fluorescence probes.The DNA2 used in technical scheme and in DNA1 nucleotide sequences each own 12 It is individual continuously to hybridize the base sequence of complementation.After two DNAs carry out mixing certain time, 12 bases of two chains Complementary pairing can be carried out one by one.By it is demonstrated experimentally that the time needed for two chains carry out complementary pairing is 1h, namely DNA1-AgNCs After the whole solution hybrid reaction 1h of DNA2, system reaches complete stabilization, that is, obtains detecting the fluorescence probe of mercury ion DNA1/DNA2-AgNCs。
It is preferred that scheme, step 3) in, the DNA1/DNA2-AgNCs fluorescence probes and standard Hg2+Solution is at room temperature React 3~6min.
It is preferred that scheme, step 4) in, the DNA1/DNA2-AgNCs fluorescence probes and Hg to be measured2+Solution is at room temperature React 3~6min.
Compared with the prior art, the advantageous effects that technical scheme is brought：
The technical scheme silver nanoclusters fluorescence probe DNA1/DNA2-AgNCs special by building, is realized To Hg2+Specific fluoroscopic examination, with label-free, signal is good, high specificity, sensitivity is high, detectable concentration scope is wide, detection Low advantage is limited, is conducive to popularization and application.
Technical scheme builds silver nanoclusters fluorescence by two special DNAs comprising hybridization complementary fragment and visited Pin DNA1/DNA2-AgNCs, recycles Hg2+The characteristics of being specifically bound with thymidine T, to carry out Hg2+Detection.Hg2+With In DNA1 in silver nanoclusters fluorescence probe in 5' ends and DNA2 3' ends thymidine T specific bindings, form linear pattern T- Hg2+- T rigid structures；Helical form is presented because of the active force between base in the position that base hybridizes in two DNAs；Two DNAs Center section, due to T-Hg2+The formation of-T structures causes the chain at 3' ends in 5' ends and DNA2 in DNA1 to stretch, and makes in the middle of DNA2 chains AGGGGA parts closer to silver nanoclusters so that whole fluorescence probe fluorescence signal strengthens.DNA1/DNA2- The fluorescence of AgNCs whole systems strengthens with the increase of ion concentration of mercury, with signal it is strong, it is specific high the characteristics of, and To Hg2+Response range is wide, it is adaptable to the Hg of 0.00002nM~0.16nM concentration ranges2+Detection, to Hg2+Detection sensitivity is very Good, test limit has reached 0.00002nM.In addition, by the length to the chain of complementary DNA 2 regulating and controlling, find to connect in DNA2 sequences Continuous thymidine (thymine, T) tail end increases the hangover of Different Alkali radix, can substantially widen the detection interval of mercury ion, this Fluorescence probe is applied to 0.00002nM~1.6nM to the detectable concentration scope of mercury ion, well below EPA least concentration contents It is required that detection.
Technical scheme silver nanoclusters fluorescence probe stablizes Nano silver grain by DNA nucleotide sequences, and its is steady It is qualitative good, and the size of silver nanoclusters is small, resistance to environmental impact is strong；And application DNA high selectivity and specific feature The problem of low above-mentioned sensitivity and low test limit can be effectively improved.
Technical scheme is using silver nanoclusters fluorescence probe to Hg2+Detection, with quick, efficient, accurately Feature, it is only necessary to which 5min effects can reach stable detection, the result accuracy of detection is high.
The present invention passes through fluorescence signal change detection Hg2+Hg is detected with existing electrochemical method2+Compare with obvious Technical advantage, such as property is more stable, operates more easy, and the sensitivity of detection is high, and the scope of detection is wide, test limit It is low.
Technical scheme is first with Hg2+Specifically bound with thymidine T, recycle T-Hg2+- T structures Formed, realize and guanine G and silver nanoclusters distance are regulated and controled, so that the fluorescence intensity of fluorescence probe is controlled, therefore it is real Now object is detected.
Brief description of the drawings
【Fig. 1】For the schematic diagram of the method for the AgNCs probe super sensitivity detection mercury ions based on T-Hg (II)-T structures；
【Fig. 2】Hg is detected in the range of finite concentration for embodiment 12+The fluorogram of content；
【Fig. 3】Hg is detected in the range of finite concentration for embodiment 12+The graph of a relation of concentration and fluorescent value；
【Fig. 4】Hg is detected in the range of finite concentration for embodiment 12+The standard curve linear relationship chart of content；
【Fig. 5】Hg is detected in the range of finite concentration for embodiment 22+The graph of a relation of concentration and fluorescent value；
【Fig. 6】Hg is detected in the range of finite concentration for embodiment 22+The standard curve linear relationship chart of content.
Embodiment
Implement to be intended to further illustrate present invention below, rather than limit the protection domain of the claims in the present invention.
Embodiment 1
The DNA1 Serial No. of use:5'-TTTTTTCCCCCTAATTCCCAAAGCTCGACGGATT-3'；
The DNA2 Serial No. of use：5'-AATCCGTCGAGCAGGGGAAG GGGAAGGGTTTTTT-3'；
DNA1-AgNCs preparation method, step is as follows：
33 μ L DNA1 (100 μM) is taken, DNA1 pH=7.4,10mM phosphate buffer dissolving are (before being not used The DNA1 solution for completing centrifugation is placed on storage inside 4 DEG C of refrigerator).Then by 160 μ L phosphate buffers (20mM, pH= 7.0) mixed with 33 above-mentioned μ L DNA1, mix in solution and add 13.2 μ L AgNO3The aqueous solution (1.5mM), it is above-mentioned whole mixed Close solution and mix 15min (1000r/min) with vortex mixer sustained oscillation at room temperature, then take 13.2 μ L Fresh NaBH4(1.5mM) solution is rapidly added into above-mentioned mixed solution, and whole solution is mixed into 30s, then puts whole solution 2h is reacted in 25 DEG C of thermostat water baths, question response determines the fluorescence of the DNA1-AgNCs silver nanoclusters of synthesis afterwards completely.
DNA1/DNA2-AgNCs synthesis steps are as follows：
Above-mentioned DNA1-AgNCs synthesis treated after fluorescent stabilization, 1:1 toward adding 23 μ L DNA2 in DNA1-AgNCs solution (100 μM), treat whole solution reaction 1h, and whole DNA1/DNA2-AgNCs fluorescence reaches stabilization, you can detect that its fluorescence is believed Number.
Hg(NO3)2The preparation steps of solution are as follows：
According to document introduction, mercuric nitrate and its water is not readily dissolved in, therefore using following when nitric acid mercury solution is prepared Method is prepared：Precise 0.0223g Hg (NO3)2Add 10 μ L 0.1M HNO3Carry out solution, treat it is solution-stabilized after 100mL is settled to ultra-pure water, concentration is finally given for 0.65mM Hg (NO3)2Solution.
Hg2+Detecting step it is as follows：
After the fluorescence probe fluorescent stabilization for treating above-mentioned DNA1/DNA2-AgNCs, by synthetic DNA1/DNA2- AgNCs solution is in charge of in equal volume, then takes the nitric acid mercury solution of same volume various concentrations to be added separately to above-mentioned be in charge of In DNA1/DNA2-AgNCs solution, whole solution mixes reaction 5min, determines DNA1/DNA2-AgNCs fluorescence signals in solution Change.
Hg2+The step of fluorescence standard curve is set up is as follows：
Many different Hg are detected in above-mentioned mercury ion detecting step2+The aqueous solution of concentration, the Hg of each concentration2+It will go out An existing photoluminescence peak, is repeated 4 times experiment, the data drawn carry out linear fit with origin, fits corresponding logcHg2+- Fluorescence intensity canonical plottings.
Detect Hg2+Solution step to be measured is as follows：
Various concentrations Hg is prepared with running water2+Solution to be measured, take with the solution to be measured of mercuric nitrate solution same volume in In DNA1/DNA2-AgNCs solution, the fluorescent value determined according to the mercury ion solution to be measured of concentration known, by obtained fluorescent value Substitute among known standard curve, calculate in solution to be measured and contain Hg2+Concentration.
As can be seen from Figure 2 fluorescence signal is with Hg2+Concentration increases and increased.
As can be seen from Figure 4 the Hg in 0.00002nM~0.16nM concentration range2+With the response signal corresponding to it There is certain linear relationship.
Embodiment 2
Operating procedure and experiment condition are same as Example 1, and DNA2 sequence numbers only are substituted for into 5'- AATCCGTCGAGCAGGGGAAGGGGAAGGGTTTTTTCGACGACGACGACGACGACGACGACGACGA-3'。
As can be seen from Figure 5 the Hg in 0.00002nM~1.6nM concentration range2+With the response signal corresponding to it There is certain linear relationship.

Claims (6)

1. the method for AgNCs probe super sensitivity detection mercury ion of the one kind based on T-Hg (II)-T structures, it is characterised in that：Including Following steps：
1) using DNA1 as templated synthesis DNA1-AgNCs；
2) DNA1-AgNCs and DNA2, which hybridizes, combines, and obtains DNA1/DNA2-AgNCs fluorescence probes；
3) a series of Hg of the DNA1/DNA2-AgNCs fluorescence probes and various concentrations2+After standard liquid reaction, fluorescence is carried out Detection, obtains a series of fluorescence signal values, sets up Hg2+The standard curve of solution concentration and fluorescence signal value；
4) by DNA1/DNA2-AgNCs fluorescence probes and Hg to be measured2+After solution reaction, fluoroscopic examination is carried out, fluorescence signal is obtained Value, and according to standard curve, calculate Hg to be measured2+The concentration of solution；
The DNA1, which is included, to be hybridized complementary fragment with DNA2, synthesizes AgNCs template segments and and Hg2+Specific binding Fragment；
The DNA2, which is included, to be hybridized complementary fragment with DNA1, makes the fragment and and Hg of AgNCs Fluorescence Increasings2+Specific binding Fragment.
2. the method for the AgNCs probe super sensitivity detection mercury ions according to claim 1 based on T-Hg (II)-T structures, It is characterized in that：
The Serial No. of the DNA1：5'-TTTTTTCCCCCTAATTCCCAA AGCTCGACGGATT-3'；
The Serial No. of the DNA2：5'-AATCCGTCGAGCAGGGGAAGGGGAAGGGTTTTTT-3' is 5'- AATCCGTCGAGCAGGGGAAGGGGAAGGGTTTTTTCGACGACGACGACGACGACGACGACGACGA-3。
3. the side of the AgNCs probe super sensitivity detection mercury ions according to claim 1 or 2 based on T-Hg (II)-T structures Method, it is characterised in that：By dissolved with DNA1 phosphate buffer and AgNO3After solution mixing, NaBH is added4Solution is mixed, 20~ 1~3h is reacted under 30 DEG C of constant temperature, DNA1-AgNCs is produced.
4. the AgNCs probes according to claim 3 based on T-Hg (II)-T structures are to the side of mercury ion super sensitivity detection Method, it is characterised in that：DNA1、AgNO3And NaBH4Mol ratio be 1:5~7:5~7.
5. the method for the AgNCs probe super sensitivity detection mercury ions according to claim 1 based on T-Hg (II)-T structures, It is characterized in that：The DNA1-AgNCs is mixed with DNA2 equimolar ratios, and isothermal reaction produces DNA1/DNA2-AgNCs fluorescence Probe.
6. the AgNCs probes based on T-Hg (II)-T structures according to claim 1,2,4 or 5 are examined to mercury ion hypersensitive The method of survey, it is characterised in that：
Step 3) in, the DNA1/DNA2-AgNCs fluorescence probes and standard Hg2+Solution reacts 3~6min at room temperature；
Step 4) in, the DNA1/DNA2-AgNCs fluorescence probes and Hg to be measured2+Solution reacts 3~6min at room temperature.
CN201710401070.1A 2017-05-31 2017-05-31 A method of being based on the AgNCs probe super sensitivity detection mercury ion of T-Hg (II)-T structure Active CN107300543B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710401070.1A CN107300543B (en) 2017-05-31 2017-05-31 A method of being based on the AgNCs probe super sensitivity detection mercury ion of T-Hg (II)-T structure

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710401070.1A CN107300543B (en) 2017-05-31 2017-05-31 A method of being based on the AgNCs probe super sensitivity detection mercury ion of T-Hg (II)-T structure

Publications (2)

Publication Number Publication Date
CN107300543A true CN107300543A (en) 2017-10-27
CN107300543B CN107300543B (en) 2019-11-19

Family

ID=60137604

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710401070.1A Active CN107300543B (en) 2017-05-31 2017-05-31 A method of being based on the AgNCs probe super sensitivity detection mercury ion of T-Hg (II)-T structure

Country Status (1)

Country Link
CN (1) CN107300543B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108333155A (en) * 2018-01-12 2018-07-27 济南大学 A kind of biosensor of fluoroscopic examination mercury ion

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102495033A (en) * 2011-12-01 2012-06-13 湖南大学 Detection method of mercury element
CN102590170A (en) * 2012-02-28 2012-07-18 江南大学 Method for simultaneously detecting mercury ion and/or silver ion in water solution based on fluorescence resonance energy transfer
CN103242195A (en) * 2013-04-28 2013-08-14 中南大学 Synthesis and application of fluorescence enhancement detection mercury ion probe
CN103264165A (en) * 2013-04-22 2013-08-28 浙江师范大学 Method for synthesizing silver nanoclusters by aid of single-stranded DNA (deoxyribonucleic acid) used as template
CN105256034A (en) * 2015-10-21 2016-01-20 广东省生态环境与土壤研究所 Mercury ion detection method and detection kit of DNA nano-fluorescence switch device
CN106404726A (en) * 2016-05-26 2017-02-15 吉林大学 Fluorescent probe based on double-stranded DNA protection and application of same to preparation of drug used for detecting Plasmodium falciparum lactate dehydrogenase

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102495033A (en) * 2011-12-01 2012-06-13 湖南大学 Detection method of mercury element
CN102590170A (en) * 2012-02-28 2012-07-18 江南大学 Method for simultaneously detecting mercury ion and/or silver ion in water solution based on fluorescence resonance energy transfer
CN103264165A (en) * 2013-04-22 2013-08-28 浙江师范大学 Method for synthesizing silver nanoclusters by aid of single-stranded DNA (deoxyribonucleic acid) used as template
CN103242195A (en) * 2013-04-28 2013-08-14 中南大学 Synthesis and application of fluorescence enhancement detection mercury ion probe
CN105256034A (en) * 2015-10-21 2016-01-20 广东省生态环境与土壤研究所 Mercury ion detection method and detection kit of DNA nano-fluorescence switch device
CN106404726A (en) * 2016-05-26 2017-02-15 吉林大学 Fluorescent probe based on double-stranded DNA protection and application of same to preparation of drug used for detecting Plasmodium falciparum lactate dehydrogenase

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LIU DENG 等: "Fluorescent silver nanoclusters in hybridized DNA duplexes for the turn-on detection of Hg2+ ions", 《CHEM. COMMUN.》 *
第3106-3110页: "A DNA-Silver Nanocluster Probe That Fluoresces upon Hybridization", 《NANO LETTERS》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108333155A (en) * 2018-01-12 2018-07-27 济南大学 A kind of biosensor of fluoroscopic examination mercury ion

Also Published As

Publication number Publication date
CN107300543B (en) 2019-11-19

Similar Documents

Publication Publication Date Title
Liu et al. Novel hybrid probe based on double recognition of aptamer-molecularly imprinted polymer grafted on upconversion nanoparticles for enrofloxacin sensing
Song et al. A nuclease-assisted label-free aptasensor for fluorescence turn-on detection of ATP based on the in situ formation of copper nanoparticles
Kong et al. An ultrasensitive electrochemical “turn-on” label-free biosensor for Hg2+ with AuNP-functionalized reporter DNA as a signal amplifier
Han et al. Mercury (II) detection by SERS based on a single gold microshell
Chen et al. Ultra-sensitive detection of Pb2+ based on DNAzymes coupling with multi-cycle strand displacement amplification (M-SDA) and nano-graphene oxide
Su et al. A kinetic method for expeditious detection of pyrophosphate anions at nanomolar concentrations based on a nucleic acid fluorescent sensor
Wang et al. A novel fluorescence probe of dsDNA-templated copper nanoclusters for quantitative detection of microRNAs
CN103264165A (en) Method for synthesizing silver nanoclusters by aid of single-stranded DNA (deoxyribonucleic acid) used as template
CN105087791B (en) The fluorescence detection method of mercury ion based on T T mispairing principles and its application
CN105352924B (en) A kind of copper ion detection method and detection kit
Qiu et al. A novel fluorescent sensor for mutational p53 DNA sequence detection based on click chemistry
Li et al. Graphene oxide‐assisted and DNA‐modulated SERS of AuCu alloy for the fabrication of apurinic/apyrimidinic endonuclease 1 biosensor
CN108251506A (en) The biological sensor kit and detection method of a kind of trace detection mercury ion
Ou et al. Poly (thymine)-templated fluorescent copper nanoparticles for ultrasensitive label-free detection of Pb2+ ion
Tang et al. Luminescent lanthanide coordination polymer as a platform for DNA colorimetric detection
CN107064515B (en) A kind of copper ion detection method and detection kit based on click chemistry
Park et al. A DNA-templated silver nanocluster probe for label-free, turn-on fluorescence-based screening of homo-adenine binding molecules
CN108304932A (en) The structure of logic gate based on silver nanoclusters and its application in intelligent measurement
Li et al. Graphene oxide-based fluorometric determination of microRNA-141 using rolling circle amplification and exonuclease III-aided recycling amplification
Zhu et al. Label-free and immobilization-free electrochemiluminescent sensing platform for highly sensitive detection of As (III) by combining target-induced strand displacement amplification with polydopamine nanospheres
Peng et al. Hairpin loop-enhanced fluorescent copper nanoclusters and application in S1 nuclease detection
Wei et al. A label-free Exonuclease I-assisted fluorescence aptasensor for highly selective and sensitive detection of silver ions
CN107300543A (en) The method of AgNCs probe super sensitivity detection mercury ion of the one kind based on T Hg (II) T structures
Xu et al. Highly sensitive biosensor based on aptamer and hybridization chain reaction for detection of cadmium ions
Shi et al. A novel sustainable biomass-based fluorescent probe for sensitive detection of salicylic acid in rice

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant