CN107287205B

CN107287205B - Reference gene RPS18 stably expressed in different developmental stages of fasciolopsis sanguinea and application thereof

Info

Publication number: CN107287205B
Application number: CN201710672145.XA
Authority: CN
Inventors: 巩中军; 蒋月丽; 李彤; 王强; 段云; 苗进; 武予清
Original assignee: Institute of Plant Protection of Henan Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Henan Academy of Agricultural Sciences
Priority date: 2017-08-08
Filing date: 2017-08-08
Publication date: 2020-07-07
Anticipated expiration: 2037-08-08
Also published as: CN107287205A

Abstract

The invention discloses an internal reference gene RPS18 stably expressed in different developmental stages of fasciolopsis sanguinea and application thereof. The nucleotide sequence of the reference gene RPS18 is shown as SEQ ID NO:1 is shown. The invention obtains the gene sequence related to the fasciolopsis sanguinea according to the measured fasciolopsis sanguinea transcriptome data, designs a primer and obtains 6 gene nucleotide sequences of the fasciolopsis sanguinea through PCR reaction. The method provided by the invention is characterized in that the fasciola gigantica under different development conditions is used as an experimental material for Real time PCR detection, Ct data is analyzed by utilizing geNorm reference gene stability analysis software, and the reference gene RPS18 with the most stable expression of the fasciola gigantica under different development conditions is screened out, so that reference is provided for the quantification of the fasciola gigantica gene under the following different development conditions, and the accuracy of the result of the quantitative experiment is guaranteed.

Description

Reference gene RPS18 stably expressed in different developmental stages of fasciolopsis sanguinea and application thereof

The technical field is as follows:

the invention belongs to the technical field of internal reference genes stably expressed in insect bodies in molecular biology, and particularly relates to an internal reference gene RPS18 stably expressed in different developmental stages of fasciolopsis sanguinea and application thereof.

Secondly, background art:

wheat red blotch (sitodiplosis mosselana (gehin)) is a devastating pest widely distributed in asia, north america and european wheat producing areas. Records of harmful wheat in both Ming Qing and Ming Guo. The main outbreak area of the wheat red sucking plasmaphylls in 1950 includes 32-36 degrees of north latitude, such as Zhejiang, Jiangxi, Jiangsu, Anhui, Henan, Hebei, Shanxi, Shaanxi and the like, and the main outbreak area becomes a strip from the northwest to the southeast and transversely spans the middle of the east of China in the great plains. The use of saturla in soil treatment has ceased since late 1950 s until the use of saturla in 1983, during which time fluke was no longer a problem in wheat production. After 1985, the wheat red sipunculus trilobus reappears in the Huang-Huai-Hai plain and the northwest area of China, the east plain is the most serious of Henan, Anhui, Shandong, Hebei, Tianjin and Beijing, and the emergence area is shifted to the north latitude of 40 degrees. Researches for many years show that the specific diapause polymorphic phenomena of malus asiatica, such as oversummering diapause, oversummering to wintering diapause, secondary diapause and prolonged perennial diapause, are the main reasons causing the immoderation and the local rampant among the malus asiatica. Fasciolopsis littoralis generally occurs one generation per year, overwintering in the soil with mature larvae (third instar) cocoons, called hibernation bodies. In spring, when wheat turns green and rises, the larvae climb out of the cocoons and rise to a surface soil layer (some larvae have a phenomenon of overwintering for many years) to prepare for pupation. When the wheat is pregnant with ears, the wheat begins to grow cocoons and pupate. If the humidity is low and the temperature is high, the larvae are not cocooned but directly transformed into naked pupae in the soil. The pupal stage generally lasts for 8-10 days, and the pupal stage emerges as an adult when the ear shoots are raised (from south (south-yang) to north (Tianjin, Tangshan) in the whole country in the middle ten days of 4 months to the last ten days of 5 months), and the activity rule of the serovars at this stage is in close correspondence with the phenological stage of wheat.

Real-time quantitative PCR (real-time quantitative PCR) is a method for quantifying mRNA expression quantity on a transcription level, and has the advantages of high speed, good repeatability, high sensitivity and the like. Therefore, the method has wide application in quantitative research of gene expression. Real-time fluorescence quantitative PCR is a powerful method for detecting gene expression profiles, and can analyze the expression difference of genes at different periods, the expression difference of genes among samples subjected to different treatments, and the like. The sensitivity and the repeatability of the method can be improved by selecting a proper internal reference gene to correct the expression quantity of the target gene in analysis. Since many real-time fluorescent quantitative studies of genes of interest are currently being compared in a number of different tissues; therefore, the experimental conditions are required to be as consistent as possible, but the expression difference in the experiment is large due to the possible differences in the yield, quality and reverse transcription efficiency of RNA in the samples. In order to reduce the difference in the experiment, a housekeeping gene is usually selected as an internal reference gene in the research to correct and standardize the target gene so as to correct the transcription efficiency and the cDNA dosage, and make up for the difference of the purity and concentration of the sample in the preparation process, thereby avoiding the high dynamics of mRNA transcription and the errors caused by the variability of sample operation and downstream processing steps. Therefore, the selection of proper reference genes becomes the key for accurate experimental results.

Thirdly, the invention content:

the technical problem to be solved by the invention is as follows: the reference gene RPS18 stably expressed in different development stages of the fasciolopsis sanguinea and the application thereof are provided, a basis is provided for selection of the reference gene in different development stages of the fasciolopsis sanguinea, and data reliability of gene expression levels in different development stages of the fasciolopsis sanguinea is guaranteed.

In order to solve the problems, the invention adopts the following technical scheme:

the invention provides a reference gene RPS18 stably expressed in different developmental stages of fasciolopsis sanguinea, the nucleotide sequence of which is as follows:

ATGTCGTTGGTTATTCCAGAGAAATTCCAGCATATCTTGCGTATCATGAATACGAACATCGATGGTAACCGCAAAGTTACCATTGCGATGACAGCAATCAAAGGTGTTGGTCGTCGTTATGCTAACATCGTGTTGAAAAAGGCCGATGTCGACTTGACCAAACGTGCTGGTGAATGCAGCGAAGAAGAAGTTGACAAAATTGTCACAATCATCTCAAATCCACGTCAATACAAAATCCCAAACTGGTTCTTGAACAGACAAAAGGACATCATCGATGGTAAATACCAACAATTGACCTCATCGAATTTGGATTCAAAATTGCGTGAAGATTTGGAACGCTTGAAGAAAATCCGTGCCCACCGTGGTATGCGTCACTACTGGGGTCTTCGTGTGCGTGGTCAACACACAAAAACTACTGGCCGTCGTGGACGTACTGTTGGCGTGTCGAAGAAGAAGTAA(SEQ ID NO:1)。

according to the internal reference gene RPS18 stably expressed by the fasciola gigantea in different development stages, the different development stages are a larval stage, an initial pupal stage, a post pupal stage, a male adult stage and a female adult stage.

According to the internal reference gene RPS18 stably expressed in different developmental stages of the fasciolopsis sanguinea, the primer sequence of the internal reference gene RPS18 is as follows:

the forward primer was TCGATGGTAACCGCAAAGTT (SEQ ID NO:7),

the downstream primer was ACATCGGCCTTTTTCAACAC (SEQ ID NO: 8).

In addition, the application of the stably expressed reference gene RPS18 in different developmental stages of the fasciolopsis sanguinea in the real-time quantitative PCR reference gene research of different genes of the fasciolopsis sanguinea in different developmental stage gene expression levels is provided.

The invention has the following positive beneficial effects:

1. the invention obtains 6 full-length genes or gene segments of reference genes (RPS18, GAPDH, RP II, SDHA, TBPII and 18S rRNA) of the fasciola gigantea for the first time.

2. The invention firstly verifies and compares the expression quantity of 6 common reference genes (RPS18, GAPDH, RP II, SDHA, TBP II and 18S rRNA) in different developmental stages of the fasciola tricuspidata.

3. The quantitative PCR primer designed by the invention has specificity and amplification efficiency of more than 96 percent, and can provide a solid foundation for accurate quantification.

4. The invention utilizes Real-time PCR technology to verify and screen out stable reference gene RPS18 of the fasciolopsis sanguinea at different development stages for the first time.

5. The screened reference gene RPS18 provides basis for selecting reference genes of the fasciolopsis sanguinea in different development stages, and provides guarantee for data reliability of gene expression levels of the fasciolopsis sanguinea in different development stages.

Fourthly, explanation of the attached drawings:

FIG. 1 is a real-time fluorescence quantitative PCR melting curve diagram of 6 candidate reference genes according to the present invention;

FIG. 2 is a standard graph of 6 candidate reference genes according to the present invention;

FIG. 3 is a graph showing the expression stability of 6 candidate reference genes analyzed by the geNorm program;

FIG. 4 shows the relative expression levels of the JHBP1 gene in larvae, pupae, adult females and adult males.

The fifth embodiment is as follows:

the present invention is further illustrated by the following specific examples, which are not intended to limit the scope of the invention. Modifications and substitutions in detail and form may be made to the present invention without departing from the spirit and scope thereof, and it is intended that all such modifications and substitutions fall within the scope of the present invention. Unless otherwise specified, the raw materials and chemical reagents used in the examples are all conventional commercial products, and the technical means used are conventional technical means known to those skilled in the art.

Example 1: preparation of samples

Picking soil with the trematodes in spring, selecting the trematodes overwintering larvae, and feeding the selected overwintering larvae in an incubator at a feeding temperature of 20 +/-1 ℃, a humidity of 70 +/-5% and a photoperiod of 14 h: 10h (the time ratio is the time ratio of illumination to darkness), taking five samples of the wheat red blotch larva, the initial pupa, the later pupa, the male adult and the female adult in different development stages respectively in the feeding process, carrying out liquid nitrogen quick freezing on each selected sample respectively, and placing at-80 ℃ for later use after quick freezing.

Example 2: extraction of sample RNA

Taking 50-100 mg of each of the five fasciola tricuspidata sample tissues of different development stages prepared in example 1, adding 0.5-1 mL of liquid nitrogen into each sample tissue, adding 1000 mu L of TRIZOL reagent into each sample tissue for grinding (firstly adding 200 mu L of TRIZOL reagent into the sample tissues, grinding by using a grinding rod matched with a centrifuge tube until no obvious tissue can be seen, adding 800 mu L of TRIZOL reagent, shaking uniformly), grinding, and standing at room temperature for 5 min; then adding 200 mu L of chloroform respectively, shaking up, and standing at room temperature for 2-3 min; placing in a refrigerated centrifuge respectively, and centrifuging at 4 deg.C and 12000g for 15 min; respectively removing the supernatant, adding 500 μ L isopropanol, shaking, standing at room temperature for 10min, centrifuging at 4 deg.C and 12000g for 10min, respectively, removing the supernatant, adding 1000 μ L ethanol and 75% ethanol, centrifuging at 4 deg.C and 7600g for 5 min; after centrifugation, respectively removing supernatant by using a pipette gun, drying the centrifuge tube containing each sample in air for 5min, respectively adding 40 mu L of DEPC water to dissolve RNA, respectively placing in a refrigerated centrifuge, centrifuging at 4 ℃ for 15sec, and finally placing at-80 ℃ for later use.

Example 3: reverse transcription

(1) Removal of DNA:

mu.l of the RNA extracted in example 2 (200 ng/. mu.l) was placed on ice, and 5 × g of DNA Eraser buffer 2.0. mu.l, gDNA Eraser 1.0. mu.l, and RNase Free dH were added thereto₂O2 mu l; after mixing uniformly, the mixture was reacted at 42 ℃ for 2min to obtain a DNA-removed RNA solution, which was then placed on ice for further use.

(2) Reverse transcription reaction:

the reaction system of the reverse transcription is 5 × Prime Script Buffer 2(for Real Time)4 muL, Prime Script Enzyme Mix I1 muL, RT Primer Mix 1 muL, RNA solution 10 muL for removing DNA and RNase Free dH₂O4 mu L, so that the total amount of the reaction system is 20 mu L (the reaction system is prepared on ice); mixing various reaction liquids in the reaction system, and then carrying out reverse transcription reaction under the reaction conditions of 37 ℃ and 15min, then 85 ℃, 5sec, 4 ℃ and 10 min;

after reverse transcription, cDNA samples were obtained, and 180. mu.L of dH was added to each of the differently treated cDNA samples₂And O, storing in a refrigerator at the temperature of 20 ℃ below zero for later use.

Example 4: acquisition of real-time fluorescent quantitative PCR reference gene and primer design

Obtaining an internal reference gene sequence: selecting 6 genes of plasmodium macranthum ribosomal protein S18(RPS18), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), RNA polymerase subunit II (RP II), Succinate dehydrogenase complex, subnitrate A (SDHA), TATA-Box binding protein II (TBP II) and 18S-ribosomal RNA (18S rRNA) as candidate internal reference genes, wherein the gene sequences are obtained by transcriptome sequencing, and the specific process is as follows: taking a fasciola gigantica round cocoon, a larva, a pupa and an adult sample as materials, sequencing a fasciola gigantica transcriptome by using an Illumina HiSeq2000 sequencing platform, carrying out systematic biological analysis and annotation on a sequencing result, and excavating candidate genes of 6 reference genes from the transcriptome by using a bioinformatics method; and the nucleotide sequences of RPS18, GAPDH, RP II, SDHA, TBP II and 18S rRNA were determined by BLAST alignment with the database, see SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6.

Designing a specific fluorescent quantitative primer: based on the sequence of the internal reference gene of the fasciola gigantea, quantitative PCR primers (detailed in Table 1) of 6 internal reference genes are respectively designed by using Primer 3(http:// frodo.wi.mit.edu/Primer3/) software according to the design principle of the quantitative PCR primers, and the design conditions of the primers are as follows: the annealing temperature is 60 ℃, the GC content is 42-55%, and the primer length is 19-21 bp.

TABLE 1 primers for 6 candidate reference genes of the present invention

Internal reference gene	Upstream primer	Downstream primer
			RPS18	TCGATGGTAACCGCAAAGTT	ACATCGGCCTTTTTCAACAC
GAPDH	GACGCACCGATGTTTGTATG	CTTTAGCCAATGGAGCCAAG
			RPⅡ	CACTGTGTTCGACCATGACC	CCATTCAACACATCCAGACG
SDHA	TGGTATGCCATTCTCACGAA	TCTATGCGCTTGTCCTCCTT
			TBPⅡ	GGGTGCGAAGAGTGAAGAAG	GCAACTGCCGACCATATTTT
18SrRNA	GCATTTGCCAAAGGTGTTTT	CCAATTGCTAGCTGACATCG

Example 5: real-time fluorescence quantitative PCR amplification dissolution curve of internal reference gene and determination of primer amplification efficiency thereof

Preparation of DNA samples for determining amplification efficiency: each 5. mu.L of the cDNA samples of the larvae, the initial pupae, the post pupae, the male adults and the female adults of example 3, which were stored in a refrigerator at-20 ℃, were taken and placed in the same centrifuge tube to obtain a total amount of 25. mu.L of a mixed cDNA sample.

5. mu.L of the mixed cDNA sample prepared above was diluted 10-fold to give a concentration of 10^-2、10^-3、10^-4、10^-5And 10^-6Doubling the dilution of the cDNA mixed sample; respectively at a concentration of 10^-2、10^-3、10^-4、10^-5And 10^-6The diluted mixed cDNA sample is used as a reaction template to perform fluorescence quantitative PCR reaction so as to judge the specificity and the amplification efficiency of the 6 candidate reference gene amplification primers. In order to ensure the reliability of the experimental result, two groups of parallel experiments are arranged; meanwhile, the fluorescent quantitative PCR of each internal reference gene comprises two parallel single negative controls, and the negative controls take buffer solution which is added with the same amount as the DNA sample as a reaction template to verifyThe presence or absence of dimers in the gene primers.

The real-time fluorescent quantitative PCR system comprises 10 muL SYBR Premix Ex Taq II (2 ×), 0.8 muL upstream primer (10 muL/mol), 0.8 muL downstream primer (10 muL/mol), 0.4 muL ROX Reference Dye (50 ×), 2 muL DNA template, dH₂O6 mu L, 20 mu L in total;

negative control experiment system including SYBR Premix Ex Taq II (2 ×) 10. mu.L, PCR Forward Primer (10. mu.L/mol) 0.8. mu.L, PCR Reverse Primer (10. mu.L/mol) 0.8. mu.L, ROX Reference Dye (50 ×) 0.4. mu.L, dH₂O8 mu L, 20 mu L in total;

the conditions of the fluorescent quantitative PCR amplification reaction are as follows: pre-denaturation at 95 ℃ for 10min, followed by 40 cycles at 95 ℃ for 15sec, 60 ℃ for 30 sec. And (3) analyzing and drawing a melting curve after the real-time fluorescent quantitative PCR amplification cycle is finished, and analyzing the melting curve to determine the specificity of the amplified product. The temperature was slowly increased from 60 ℃ to 95 ℃ and the fluorescence intensity of the sample was continuously measured to obtain a dissolution curve. The dissolution curve analysis steps are as follows: 95 deg.C, 15sec, 60 deg.C, 1min, then starting to increase by 0.3 deg.C per cycle, slowly increasing from 60 deg.C to 95 deg.C. The alternative internal reference genes in the fasciola gigantea adopted by the real-time fluorescent quantitative PCR amplification are RPS18, GAPDH, RP II, SDHA, TBPII and 18S rRNA.

The real-time fluorescence quantitative PCR amplification dissolution curves of the 6 candidate internal reference genes are shown in the attached figure 1 in detail, and as can be seen from the attached figure 1, the real-time fluorescence quantitative PCR amplification dissolution curves of the 6 candidate internal reference genes are all single peaks. Therefore, it is demonstrated that the amplification primers for the 6 candidate reference genes designed by the present invention are specific.

Drawing a standard curve: through analysis of StepOne Software V2.1 system Software, the concentration is respectively calculated to be 10^-2、10^-3、10^-4、10^-5And 10^-6The circulation threshold value (Ct value) of each internal reference gene in the real-time fluorescence quantitative PCR reaction with the multiplied cDNA mixed sample diluent as a reaction template, the initial template concentration and the Ct value of each dilution gradient are in a linear relation, and the larger the original copy number contained in the initial template is, the smaller the Ct value is; obtaining the amplification of each internal reference gene primer by drawing a graph through logarithmic fitting in Excel according to the Ct valueAnd (3) increasing a standard curve (see the detailed graph in figure 2), determining the amplification efficiency Y of each pair of primers according to the slope of the standard curve [ 10A (-1/slope) -1 ] × 100, wherein Y is the amplification efficiency, and slope is the slope of the curve, and the amplification efficiencies of 6 candidate reference genes are detailed in the table 2.

TABLE 2 Standard Curve equation, regression coefficient R2 and amplification efficiency of 6 candidate reference genes of the present invention

Example 6: real-time fluorescent quantitative PCR reaction of candidate reference gene

The 6 candidate reference genes (RPS18, GAPDH, RP II, SDHA, TBP II and 18S rRNA) were subjected to real-time fluorescent quantitative PCR amplification using five different developmental stage Fasciola major cDNA samples obtained after reverse transcription in example 3 as templates, and three sets of parallel experiments were set up.

The reaction system of the real-time fluorescent quantitative PCR comprises 10 mu L of SYBR Premix Ex Taq II (2 ×), 0.8 mu L of upstream primer (10 mu L/mol), 0.8 mu L of downstream primer (10 mu L/mol), 0.4 mu L of ROX Reference Dye (50 ×), 2 mu L of DNA template, dH₂O6 mu L, 20 mu L in total; the conditions of the fluorescent quantitative PCR amplification reaction are as follows: pre-denaturation at 95 ℃ for 10min, followed by 40 cycles at 95 ℃ for 15sec, 60 ℃ for 30 sec.

Through analysis of Step One Software V2.1 system Software, fluorescence quantitative PCR circulating Ct values of the candidate reference genes in the fasciola aurantiaca samples processed at different development stages are obtained.

Calculating the average value M of the expression stability of each candidate internal reference gene by using a geonorm software program according to the obtained fluorescence quantitative PCR circulation Ct value of each candidate internal reference gene in the fluke sample processed at different development stages; the expression stability of each reference gene was ranked (the smaller the value of M, the more stable the expression).

After the data analysis results of the fluorescent quantitative PCR and analysis treatment of geNorm software, the average values M of the expression stability of RPS18, GAPDH, RP II, SDHA, TBP II and 18S rRNA in the wheat midges at different growth and development stages are 0.3055, 1.115913, 0.575597, 1.367129, 0.532419 and 0.81292 (see the detailed attached figure 3); the expression stability is sequentially RPS18 > TBPII > RP II > 18S rRNA > GAPDH > SDHA from high to low. Therefore, the RPS18 gene with the highest stability is selected as an internal reference gene to detect the transcription expression of different target genes in the plasmodium macranthum at different developmental stages so as to improve the mRNA expression quantitative detection accuracy of the different target genes of the plasmodium macranthum.

Example 7: application of reference gene RPS18

RPS18 is used as an internal reference gene for detecting genes of the fasciola major Binding Proteins (JHBs) in different developmental stages.

Taking malus red sucking plasmapha of different development stages (larva, pupa, female imago and male imago) as an experimental sample, taking RPS18 as an internal reference gene, and detecting the expression level of the gene JHBP1 of the malus red sucking plasmapha by using real-time fluorescent quantitative PCR.

The real-time fluorescent quantitative PCR reaction system comprises 10 mu L of SYBR Premix Ex Taq II (2 ×), 0.8 mu L of upstream primer (10 mu L/mol), 0.8 mu L of downstream primer (10 mu L/mol), 0.4 mu L of ROX Reference Dye (50 ×), 2 mu L of DNA template, dH₂O6 mu L, 20 mu L in total;

the system of negative control experiment includes SYBR Premix Ex Taq II (2 ×) 10. mu.L, upstream primer (10. mu.L/mol) 0.8. mu.L, downstream primer (10. mu.L/mol) 0.8. mu.L, ROX Reference Dye (50 ×) 0.4. mu.L, dH₂O8 mu L, 20 mu L in total;

the real-time fluorescence quantitative PCR reaction conditions comprise that pre-denaturation is carried out at 95 ℃ for 10min, then 40 cycles are carried out at 95 ℃ for 15sec and 60 ℃ for 30', analysis is carried out after the real-time fluorescence quantitative PCR amplification cycle is finished, a dissolution curve is drawn, dissolution curve analysis is carried out to determine the specificity of an amplification product, the temperature is slowly increased from 60 ℃ to 95 ℃, the fluorescence intensity of a sample is continuously measured to obtain the dissolution curve, the dissolution curve analysis steps comprise that the temperature is 95 ℃ for 15sec, the temperature is 60 ℃ for 1min, then each cycle is increased by 0.3 ℃, the temperature is slowly increased from 60 ℃ to 95 ℃ and is finished, the relative expression quantity of the gene is obtained by utilizing a formula 2A- △△ Ct, wherein △ Ct is a target gene-an internal reference gene Ct, and △△ Ct is a target gene △ -a control △ Ct.

The experimental results are as follows: the statistical analysis result shows that the expression quantity of the JHBP1 gene is greatly different in different development stages, the gene expression quantity is in an up-regulation trend in a pupal stage, a female adult stage and a male adult stage, and particularly the expression quantity is the highest in the male adult stage (see the detailed figure 4). Up-regulated by 16.4-fold, 24.8-fold and 408-fold, respectively, compared to the control larval stage. Therefore, it can be seen that the RPS18 gene has stable expression in different development stages of the fasciolopsis aurantiaca, can reflect the change of functional genes in different development stages, and can be used as an internal reference gene for quantifying the genes in different development stages of the fasciolopsis aurantiaca.

SEQUENCE LISTING

<110> institute of plant protection of academy of agricultural sciences of Henan province

<120> reference gene RPS18 stably expressed in different developmental stages of fasciolopsis sanguinea and application thereof

<130> detection

<160>8

<170>PatentIn version 3.5

<210>1

<211>459

<212>DNA

<213>Artificial Sequence

<220>

<223>RPS18

<400>1

atgtcgttgg ttattccaga gaaattccag catatcttgc gtatcatgaa tacgaacatc 60

gatggtaacc gcaaagttac cattgcgatg acagcaatca aaggtgttgg tcgtcgttat 120

gctaacatcg tgttgaaaaa ggccgatgtc gacttgacca aacgtgctgg tgaatgcagc 180

gaagaagaag ttgacaaaat tgtcacaatc atctcaaatc cacgtcaata caaaatccca 240

aactggttct tgaacagaca aaaggacatc atcgatggta aataccaaca attgacctca 300

tcgaatttgg attcaaaatt gcgtgaagat ttggaacgct tgaagaaaat ccgtgcccac 360

cgtggtatgc gtcactactg gggtcttcgt gtgcgtggtc aacacacaaa aactactggc 420

cgtcgtggac gtactgttgg cgtgtcgaag aagaagtaa 459

<210>2

<211>1246

<212>DNA

<213>Artificial Sequence

<220>

<223>GAPDH

<400>2

ccttgatgtg acactcgtct tctgaaagcg gttgtgttaa gtcatatccc atcaaagcaa 60

gcaagaaggt aaaaaaatgt cgaaaattgg aatcaacggt tttgggcgta tcggtcgtct 120

tgtgctccgt gctgctgttg agaagggagc tcaagttgtt gccgtgaatg acccatttat 180

tggagtcgat tacatggtgt atttattcaa gtatgattcc acccatggtc gtttcaaagg 240

aactgtcagt gctgaaggtg gttttttggt tgtcaatggg caaaagataa ctgttttttc 300

ggaacgcgat ccaaaggaca tcaaatgggc atcagctgga gctgaataca tcgtcgaatc 360

gactggtgta tttacaacta ttgaaaaggc tagcactcac ttggctggtg gtgcaaagaa 420

agtaatcata agtgctccat cagctgacgc accgatgttt gtatgcggag taaatttgga 480

tgcctatgat ccaaaatatc aagttatttc gaatgcttca tgtacaacca attgcttggc 540

tccattggct aaagtaattc atgacaattt tgagattgtc gaaggtttga tgacaacggt 600

gcatgctaca accgcaaccc aaaaaactgt tgatggtcca tctggcaaat tgtggcgcga 660

cggtcgcggg gctgctcaga atataattcc agccgcaact ggcgctgcta aagccgtcgg 720

gaaggttatt ccgtctttga acggtaaatt gactggtatg gctttccgtg taccaactgc 780

aaatgtttct gttgttgatc tcacttgccg ccttggcaaa ccagccaagt acgatgaaat 840

caagcagaaa atcaaggagg ctgccgaagg cccattgaaa ggaattctcg attacaccga 900

agatgaagtg gtttcatcag acttcattgg ttctactcat tcgtcagtct ttgacgcaaa 960

ggccggaatc caactttcgg acacctttgt caagctcatt tcttggtacg acaatgagta 1020

cggttatagc aaccgtgtca ttgacctcat caaatacgtt caaaccaaag attaaacgtt 1080

ttgttttgaa ttcagtcata taagtcacat tgaatgtaac taaatactaa attcacaata 1140

aaatattata tcccagaaca aaaatttgtc cacgcactac atgtagaaat aattttgcag 1200

taatgtatca ttgaaatgcg tcttttttaa taacactgca caacac 1246

<210>3

<211>4320

<212>DNA

<213>Artificial Sequence

<220>

<223>RPII

<400>3

tcagcgtgtg acgcggcatc catgagcaca tcaaccgttt cttcgaatga gcatctcatc 60

agtgcaccag tatcttgtcg attgataccg tgacgtgtga tggccatcaa atggccctta 120

gccgtcatca catcgcacaa caaggctaaa tgccgatagt tgacgtacaa tccgtagaat 180

tgcaacacgg cattcatttc tttttcaacg gattttcgca ccgcttcgat tccaagcact 240

tggaaaatct cacaaatatc gttactgtac gtacgaaccg gatccacatc acgttcgctc 300

aatactttca tcattgaagt accgtccgtt tccaatagcc attcgccaat ggccttgaat 360

tcaccggtgt cagtgattga aatccgtttc ttactgtctg tttgtggcaa atgcatgtac 420

actttgctaa tggcttcgat accttgcagt gtcatatcgg acaacatgtt cgcttcaatg 480

caacgcaaga acatatcgtc ttccatttta tcaacggtgt cctcttcatt gtcttggaat 540

ttactgtctt cactgttcat gatacgaata cgtagtacca atttgtcagc gttatcatcg 600

ttgaagatac aattcaaatc ctcaccaaaa ccggcattaa tcttctccgc aatctgttcc 660

atggtcaatt tcttatcagt catacgtttg cgatccaatt caatacgcaa cagccatggt 720

gaaattcgtg ttggatcgaa atccggcatt tcatagtaaa cgttaacgaa ttcttgatct 780

tcggcgataa cagttcgttg tggatcggga tcatagtaga tggccgtgtt tgcggtgacc 840

ttacgcaaag tggtgtgttc caagcgacac agtacatttt tggctttttc agcatcacgt 900

gcagcaccgc cggtcaagaa aacggtcaac gatggagctt tcggtttctt tgaaatgttg 960

ataatttcct ttaaacgagg cacacccagc gttacgttct tcgatgacac accagcaaaa 1020

tggaaagtgt tcagtgtcat ctgagtggcc ggttcaccga gtgactgagc ggccaaagcg 1080

ccaaccattt cacctgggtt ggcttgagcc tgttggaaac gtgattcaat ttcacccacc 1140

aaccattcaa acgcttcgct ggtcaaacga tgatcttcgg ccacatattt ggtgcacagt 1200

gttgaacgca ccaaacactg gaacagcaat gttgcatttt cattggcttg cttcgaaatt 1260

cgatcgttac ccgctacaat tacacatttt tgtagcaatt ctttgacacc attgatcact 1320

ttgattggac tcaaatcggt tggcacacgt ttgttaatgt ggaaaatctt ctgtacattc 1380

caaatcatac gctgtaaatt gcatggcaat acgacttttg attcaccact tgggaaaatc 1440

tgacgcaatg cctcacgatc acggcacaat tgatcccatt caccttccag ttcttggatt 1500

acgaaacccg attccgtcaa ttcttttaca acatcttcat tgaaaatgcg tcgcaagtaa 1560

cgttcattgg acatatcgaa tttgaaacgt ttctcaaatg ttttgtgcga caatttaatc 1620

gtcggcaaac tttggaattc gaccgtttca ccgcacagac catcctcacc gtaccgcaat 1680

tgaatcaatt gtccaaccga attacgaacg gttccatcgt agttcaccat caccgactcc 1740

atagctttga tcaaacgacg ttggatataa ccagtttcgg cggtttttac agcagtatcg 1800

ataagacctt cacgacctcc catagcgtgg aaatagaatt cagacggtgt caaaccggcc 1860

agatatgaat tttcaacgaa acctcttgaa tccggaccgt aatcgtcttt aatgaaatgt 1920

ggcaacgttc gcttacggaa cccgaacgga atacgtttac cttcaacgtt ttgttgacct 1980

acacaagcaa taacttgaga aatgttgatg ttggaacctt ttgaacccga aacgaccata 2040

gcctttagat tattgtattc agtcaatgat ttcttcgcag agccaccagt tttatcacga 2100

gcatcgttca aaatacgatt tacttgattt tcgaaagtct gacgcaacgt attaccgggt 2160

gtgggttcca attccatgtt gtgagccttt tgaataacgc caatgacatc ttctttggct 2220

ttcctaatgg actgttggat ttcgtgatat gtctgcggat cagcaattgt gtcaccaata 2280

cccatactgt gaccttccaa cagcaaccaa ttgttaaccg ttgtctgaat attaccgtag 2340

aatcgaccgg ctatctcgtg gcccaattca aggaacacaa tgtgcaacag tgaaccagcc 2400

gatgttccca gtgttttctt acataaaatg cccataatca attcactgtg ttcgaccatg 2460

acctttgtgt caccgggcga gatccatttg tatggcccgt catcctcttc gtctggatgt 2520

gttgaatggg ttcgaatcag gttcacattg ccgggaataa tgagggtgaa caattgcttt 2580

ccggtccata gtggctttgg ttttaaaata catggttgtg gcattttacc gtcccaagtt 2640

ggcaaaaaca tgagcaaatt catcatttgc tccttctcaa taaaaacatc acgtttggtc 2700

atttttcgta ctgcggtcaa tgtatcttgc acaataccca taaccggttt gtttgcttgc 2760

ggtgtgataa tttggcgcgg tgttatgtga atattttcca cttcggcacg cgtttccatc 2820

gattgtggca cgtgcaagtt catttcgtca ccgtcgaaat cggcattgta aggcgatgta 2880

caactgaggt tcattcgaaa ggttgaccaa ggcaacactt tgactctgtg acccatcata 2940

ctcatcttgt gcagcgttgg ttgtcgattg aaaatgacca aatcatcgtc gcgcaaatgt 3000

cgttcaactt tgtagcccca ttgcaaatgc aaatcactgg gtttcggatg gaatcttaaa 3060

tcgatacgtt caccattgtc acgaacgata tatttggcgc cgggatattg tgaatgtcca 3120

cgcttaacca gctcttgcat gcgatcgatg ttgaatggtg tgacgagttc ggggaacgtt 3180

aaattttgtg caatcgaacg tggaacgccg acttgatcga tacgcaaatt tggatcaggt 3240

gtgatgaccg tacgtgcgga gaaatcgaca cgttttccca tcaaattacc acgaatacga 3300

ccttctttac ctttgagccg agccttgacc gcttttaatg gtttgccgga tttttgtgtt 3360

gcacgcggca taccgggcat atcattgtct gtgaatgtgg ccacatgaaa ttgtagcatt 3420

ttaatatttt cggcgataac atgggcggcc gcaccaatcg cttcgttctt tttcagttca 3480

ttgtttgctt tgataatgtc ggccagtttg tgcgttaaat cgtcttgatt tttagccgaa 3540

ccgaacataa caacggctgg tcgtaccgac aacggtggca ccggcatcac ggtgacaatc 3600

atccaatcgg gccgcgcata tttcggatcc ataccaagta tgtaacattc ttcgtcggtg 3660

atatgcttga aaatttccca cacccgttcg gctgtcacca caatcttttt ctcctgtgaa 3720

ttttcattga catttttcca ttcggcggtt aattccaatc cgcttcgttt aattgacggt 3780

tgataatgac cgcaaccgcc atgaccttgt ttctttgtcg gatcagcttg ggcagcgtct 3840

tttgccaaat ccatatcttc accaccctca caaatctttt tacctttaca caaatcatac 3900

acatatgtca aacgtttacg tggttgtcct tttgttttca taacaacttc tttgattttc 3960

ggattcgttg agctaaccag cattttcgaa cagtagaagc acacgcagcg cagaattttc 4020

atggtttttg tcaagaaacc gacgtggtaa acgggtttgc ataattcaat gtgaccaaag 4080

tgaccgggac attcagtcat attgccggca caagtttgac atcgggatgt acgttcgatc 4140

acaccttgac gcggatccat taaaccgcca agctttggtc gaccaccttc catcgtctcg 4200

ggatactgaa ttccaccttc cgtaactgac atacgacgga tttcatcggg tgatagaata 4260

ccgaattgca cacgcttcac cgtgcgcaac gttgccttgg agtcactcat agccattttg 4320

<210>4

<211>2299

<212>DNA

<213>Artificial Sequence

<220>

<223>SDHA

<400>4

tgcttgtcag tttgcctgtt ctcaaagcat tttttaccca attgtcgatg tattctagat 60

gtttctacgt gtatgcatcg taaactacac gaaagcgaca gacacacaga tccatactaa 120

agcagatgaa cagttttatg tgcgtgataa atacgagcga aacgaaatcg catgaaataa 180

gaaaaacacg gaaactttat ttttcccaca ttgctgaaat agtgaatatt ttgaataaga 240

actcttggtg cggattttag gtgattccat catgagtgca ctgatgagga tttctcaagt 300

tcttagcaaa aatgctaagt caatgatcaa tgcaagttcg gtcggtgcca agagtttaca 360

ttattcctct ggtcaacaaa atgcaaaagt ctcttctgat gccatttcca atgagtacaa 420

agtcgttgac catgctttcg acgccattgt cgttggtgct ggtggtgcag gtttgcgagc 480

tgcattcgga ttagtcgctg aaggcttcaa aactgccgtc atcacaaaat tgttcccaac 540

tcgttcacat accattgctg ctcaaggcgg tatcaatgcc gcattgggaa acatggaacc 600

agacgattgg aaattccatt gttacgacac agttaaaggt tcagattggc tcggtgatca 660

ggatgccatt cattatatga cacgtgaagc gccaaaggct gtcattgagt tggagaacta 720

tggtatgcca ttctcacgaa caaaagaagg taaaatctat caacgtgcct tcggtggtca 780

gagttataac tatggcaaag gaggacaagc gcatagatgt tgtgccgtcg ctgacagaac 840

tggacattca ctgttgcaca cattgtatgg ccagtcattg aactatgact gccactattt 900

catcgaatat ttcgcacttg atttgcttat ggaaaatgga aaatgcgtcg gtgtcattgc 960

catttgcctt gaagacggct ctattcatcg attccgtgca aacagcacag ttttggcgac 1020

gggtggttac ggtcgtgcat acttttcatg tacatcggct cacacttgca ccggtgacgg 1080

aacagcaatg gttgcccgac aaaatttacc atgcgaagat cttgaattcg tgcaattcca 1140

tccgacgggt atttatggtg ctggatgttt gattacagaa ggttgtcgcg gtgaaggtgg 1200

ttacttggtc aatgctaaag gtgaacgttt tatggagcga tacgccccgg ttgccaaaga 1260

tttggcatct cgtgatgttg tctcacgttc gatgacaatg gaaatccgag agggacgtgg 1320

tgttggacca ctcgaagatc acgttttctt gcaattgcat catttaccac ccgagcaatt 1380

ggcaatgcgt ttgccaggta tttcggaaac ggccatgatc tttgccggcg ttgatgtgac 1440

ccgtgaacca atccccgtta tacccaccgt acattataat atgggaggcg ttccaacgaa 1500

ttggcgaggc gaatgcttaa ccatcgatca aaatggtaac gataacgttg ttgagggatt 1560

gtatgcagct ggagaagcag gttgttcatc ggtgcatggt gccaatcgtt tgggtgctaa 1620

ttcattgttg gatttggttg tttttggccg tggatgcgct aaaacaattg cagctaaaca 1680

taagccagga gaaaaagtac ctgagttacc ggatagtgct ggtgaatcgt ccgtagccaa 1740

tttagattat ttgttgcaca aaaatggcac agtttcaacg gctgatcttc gcttgagaat 1800

gcaacgcacg atgcaaaatc atgcagctgt attccgtgat ggccctgtac ttaaagaagg 1860

ttgcgagaaa atgtccgaaa tcttcaaaga attcgccgat attaaagtta ccgataaatc 1920

tcttgtttgg aattcagatt tgattgaaac attagagtta caaaatctgt tgcaaaatgc 1980

tctgatgacc atttatggtg ccgaaaatcg taaggaatct cgtggtgctc acgctcgcga 2040

agactacaaa actcgtatcg atgaatacga ttattcgaaa ccaattgaag gacaacagaa 2100

gaaatcaatc gacgaacact ggcgcaaaca cactctgctt tggatcaacg aatctggaga 2160

tgttagcatt aaatatagac cagttatcga taagacactc gacgaagaaa tgcacacggt 2220

gccgccagcc attcgttcct actaaagcaa ttttttgttt ttatttatca acaataacaa 2280

caacaacaac agcaacaac 2299

<210>5

<211>846

<212>DNA

<213>Artificial Sequence

<220>

<223>TBPII

<400>5

caatgacacc gatgacaccc ggctcacaag atcccgctat tttgcctcaa ttacaaaaca 60

ttgtgtcaac ggtgaattta aattgtaagc ttgatcttaa gaaaattgca ttacatgccc 120

gtaacgctga gtacaatcca aaacgttttg ctgccgtaat tatgcgaata cgtgaaccga 180

ggacgactgc cttgatcttt tcatcgggga aaatggtgtg tacgggtgcg aagagtgaag 240

aagattcccg tttggccgcc cgcaaatatg ctcgaattat acaaaagctc ggttttacgg 300

cgaaattttt agattttaaa atacaaaata tggtcggcag ttgcgacgtt aaatttccaa 360

ttcgattgga gggtttagtt ttaacacact ctaagttcag ttcgtatgag ccagaattgt 420

ttccgggtct tatttatcgt atggtcaaac caagaattgt gctgttgatt tttgtgtcgg 480

gcaaagtcgt acttaccggt gccaaagttc gtcaagaaat ctacgatgca ttcgacaaca 540

tttatccaat tttgaagagc ttcaagaaac aataggaaaa gtaaaaatga catcggtgat 600

ttggtgcggc taacatatga cacacacgca aacaaaacaa aaccaaacac atcaacattt 660

cgattagact aaataaggag ttcccttagc agtacacaca cacatcggtc ttttttgact 720

taatcatcat taatttttat ctcgtaatgt cgtttagttt gattattaaa attacaaaaa 780

caacaaaaaa tggaataaat gattatttca cgaagaaaat tcccatgcaa gaaaaaaaaa 840

acgaac 846

<210>6

<211>473

<212>DNA

<213>Artificial Sequence

<220>

<223>18S rRNA

<400>6

tgttcactta agctcatttc agtgctcttc atcgagtgtt gttgtgggcc gatacaaatt 60

actttgaaca aattagagtg cttaaagcag gcttgtaatg cctgaatatt ttgtgcatgg 120

aataatgtaa tgggacatct gttctacttt cattggtttt ttagatcaag atgtaatgat 180

taatggaggc aattgggggc attagtatta caacgcgaga ggtgaaattc ttagaccgta 240

gtaagactaa ctaaagcgaa agcatttgcc aaaggtgttt tcatttaatc aagaacgaaa 300

gttagaggtt cgaaggcgat cagataccgc cctagttcta accataaacg atgtcagcta 360

gcaattgggt ggagctacta ctatggctct ctcaggcgct tctcgggaaa ccaaagcttt 420

tgggctccgg gggaagtatg gttgcaaagc tgaaacttaa aggaattgac gga 473

<210>7

<211>20

<212>DNA

<213>Artificial Sequence

<220>

<223> primer

<400>7

tcgatggtaa ccgcaaagtt 20

<210>8

<211>20

<212>DNA

<213>Artificial Sequence

<220>

<223> primer

<400>8

acatcggcct ttttcaacac20

Claims

1. A reference gene RPS18 stably expressed in different developmental stages of fasciolopsis sanguinea has a nucleotide sequence of SEQ ID NO: 1;

the primer sequence of the reference gene RPS18 is as follows:

the upstream primer is TCGATGGTAACCGCAAAGTT, the upstream primer is,

the downstream primer is ACATCGGCCTTTTTCAACAC.

2. The reference gene RPS18 stably expressed in the different developmental stages of fasciolopsis sanguinea according to claim 1, wherein the reference gene RPS18 comprises: the different development stages are a larval stage, an initial pupal stage, a post pupal stage, a male adult stage and a female adult stage.

3. The use of the reference gene RPS18 of claim 1 as a reference gene in real-time quantitative PCR to study the expression levels of different genes of Pieris mallotorum at different developmental stages.