CN111690762B - Internal reference gene combination for expression analysis of tuber genes of Polygonatum cyrtonema and application thereof - Google Patents

Internal reference gene combination for expression analysis of tuber genes of Polygonatum cyrtonema and application thereof Download PDF

Info

Publication number
CN111690762B
CN111690762B CN202010535853.0A CN202010535853A CN111690762B CN 111690762 B CN111690762 B CN 111690762B CN 202010535853 A CN202010535853 A CN 202010535853A CN 111690762 B CN111690762 B CN 111690762B
Authority
CN
China
Prior art keywords
gene
primer
genes
upstream
downstream
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010535853.0A
Other languages
Chinese (zh)
Other versions
CN111690762A (en
Inventor
李海波
杨阳
沈建军
叶碧欢
陈友吾
宋其岩
胡传久
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Academy of Forestry
Original Assignee
Zhejiang Academy of Forestry
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Academy of Forestry filed Critical Zhejiang Academy of Forestry
Priority to CN202010535853.0A priority Critical patent/CN111690762B/en
Publication of CN111690762A publication Critical patent/CN111690762A/en
Application granted granted Critical
Publication of CN111690762B publication Critical patent/CN111690762B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an internal reference gene combination for analysis of tuber gene expression of Polygonatum cyrtonema in different development periods, which consists of a UBQ-E2-10 gene and an EF-1 alpha 2 gene, wherein the sequence of the UBQ-E2-10 internal reference gene is shown as SEQ ID No.1, and the sequence of the EF-1 alpha 2 internal reference gene is shown as SEQ ID No. 2. The invention provides the reference gene combination of the polygonatum cyrtonema tubers in different development periods for the first time, solves the current situation of lack of the reference gene in the real-time fluorescence quantitative PCR analysis of the polygonatum cyrtonema tubers in different development periods, and compared with the use of a single reference gene, the invention uses the combination of UBQ-E2-10 and EF-1 alpha 2 genes, and the obtained result is more accurate and reliable.

Description

Internal reference gene combination for expression analysis of tuber genes of Polygonatum cyrtonema and application thereof
Field of the art
The invention relates to a group of internal reference gene combinations for analysis of tuber gene expression of Polygonatum cyrtonema Fabricius in different development periods and application thereof.
(II) background art
Rhizoma Polygonati is Liliaceae, polygonatum Mill. More than 60 species of perennial herb are distributed in the north temperate zone and the north subtropical zone, 31 species in China, and widely distributed in vast areas except the south tropical zone. Polygonatum kingianum Coll.et Hemsl, polygonatum kingianum P.sibiricum Red, and Polygonatum cyrtonemum Hua are recorded in Chinese pharmacopoeia (2015 edition) together, and are used as crude drugs of traditional medicinal materials with homology of medicine and food, and Polygonatum kingianum has potential medicinal values in resisting aging, regulating immunity, regulating blood lipid, improving memory, resisting tumor, resisting bacteria, etc. With the following. With the continuous deep and development of molecular biology research, gene expression analysis based on real-time fluorescence quantitative PCR (qPCR) is gradually applied to research for revealing the gene regulation mechanism of Polygonatum cyrtonema.
In qPCR experiments, to avoid possible differences in RNA yield, quality, reverse transcription efficiency, and amplification efficiency for different samples, data correction and normalization are typically performed using reference genes to reduce errors between samples, so selecting appropriate reference genes to correct data is critical to obtain reliable data.
Research shows that UBQ-E2-10 protein is involved in many important vital activities of eukaryotic cells, and a protease degradation system (ubiquitin/proteasome system, UPS) mediated by ubiquitin extension protein is the most important protein degradation pathway in eukaryotic organisms, and is involved in various important vital activity processes such as cell cycle regulation, growth and apoptosis, ion channel, DNA repair, signal transduction, transcriptional regulation, organism immunity and the like. Recent studies have shown that higher plant ubiquitin is a highly conserved protein, and that the conserved site of ubiquitin plays a key role in maintaining protein structure and function. Because of their high conservation and homology, and constant expression levels in different tissues and organs, they were used as reference genes for gene expression analysis in various higher plants, and the former findings have shown very high expression stability of ubiquitin during the growth and development of arabidopsis; related reports indicate that ubiquitin is an internal reference gene for researching optimum gene expression of various plants (such as grape, rice, cistanche, soybean and the like) in different development periods; in addition, she Youjie and the like find that the expression of ubiquitin different tissues is most stable when screening morinda officinalis reference genes; the jin navy et al considered that ubiquitin is the most stable gene of internal reference expressed in different stages (seedling stage and flowering stage) of the continuous root of Sichuan.
EF-1 alpha 2 is a protein which is widely existing in cells and is highly conserved, the content of which in cells is inferior to actin, furthermore, since it is abundant in cells and other cellular functions, it is the most part studied in translation mechanisms, EF-1 alpha 2 is also related to cell growth and proliferation rate, involved in signal transduction, associated with cell structure, associated with apoptosis, etc. The research shows that EF-1 alpha 2 has high expression stability in different tissues of rice, in traditional Chinese medicine dendrobium candidum and in potatoes; li Juan et al found that EF-1 alpha 2 was most stable in expression in different growth years and sites of Polygala tenuifolia; jing Li et al consider EF-1.alpha.2 as the most stable reference gene of mountain ginseng under different years.
However, at present, the research on the ubiquinin-conjugating enzyme E2 10 (UBQ-E2-10) and elongation factor-alpha isofam (EF-1 alpha 2) genes as reference genes of polygonatum cyrtonema tubers at different development periods has not been reported yet. The lack of the reference gene makes it difficult to realize correction and standardization of gene expression, which greatly hinders analysis and research of expression characteristics and functions of various genes in the polygonatum cyrtonema tuber.
(III) summary of the invention
Based on the defects in the prior art and market demands, the invention provides a group of reference genes for analysis of expression of polygonatum cyrtonema tuber genes in different development periods and application thereof.
The technical scheme adopted by the invention is as follows:
the reference gene combination for analysis of expression of tuber genes of Polygonatum cyrtonema in different development periods consists of UBQ-E2-10 gene and EF-1 alpha 2 gene.
The complete sequence of the Polygonatum cyrtonema UBQ-E2-10 gene is as follows:
ACTGGGCCAAGGGCCACTACACCGAGGGAGCGGAGCTGATTGACTCGGTTCTTGATGTCGTCAGGAAGGAGGCCGAGAATTGTGATTGCTTGCAAGGATTCCAAGTATGCCATTCTTTGGGAGGCGGCACCGGATCTGGTATGGGAACCCTTCTCATCTCAAAGATCCGAGAGGAGTACCCTGATCGCATGATGTTGACATTCTCTGTGTTCCCATCACCAAAGGTCTCAGACACTGTTGTGGAGCCATACAATGCCACTCTTTCTGTACATCAGCTTGTCGAAAATGCTGACGAGTGCATGGTTTTGGACAATGAAGCTTTGTATGATATTTGTTTCCGCACTCTGAAGCTAGCAACTCCTACCTTTGGGGACCTTAATCATCTGATCTCTGCCACCATGAGTGGTGTCACCTGCTGTCTCCGCTTCCCTGGTCAGCTCAACTCTGATCTCCGGAAGCTTGCAGTCAATCTGATCCCATTCCCCCGTCTCCACTTCTTCATGGTGGGATTTGCACCCTTGACCTCAAGGGGCTCGCAACAGTACCGCTCTCTCACTGTTCCAGAGCTCACCCAGCAAATGTGGGACTCTAAGAACATGATGTGTGCTGCTGACCCAAGGCACGGGCGCTACCTCACTGCCTCTGCCGTGTTCCGTGGGAAGATGAGCACAAAAGAAGTGGATGAGCAGATGATCAACGTCCAGAACAAGAACTCTTCCTACTTCGTCGAGTGGATTCCAAACAATGTCAAGTCCAGTGTGTGTGACATCCCACCAAAGGGTCTGAAGATGGCATCCACATTCATTGGAAACTCGACTTCCATTCAGGAAATGTTCAGGAGGGTCAGCGAACAGTTCACAGCCATGTTCAGGAGGAAGGCTTTCCTTCACTGGTATACAGGTGAGGGGATGGACGAGATGGAGTTCACCGAAGCCGAGAGTAATATGAATGATCTGGTGGCCGAGTACCAGCAATACCAGGATGCTACAGCTGATGAAGAGTATCAGGAGGAGGAAGAAGAGGAGATGGATGGTGCTTAAGGAGGGTTATGTCCTTTCCGACCGGGTTTTTATCCATTTCAGGTTTGCTTTGAGATGGTTAGTGAAGTGTTGTTCTTTATATCAAGAGACCAATTTGTATCATTGTATGACATGTATGAAAGTAATGTTTGTTGTTTGGAGAGCGAGCGAGCTTTAGATGTCTGTGACATCAGTCTATGGTGGCTGGTGACTTTTGTACCTTGTGAAATATTGGTAATTCATTTTCACCGGTGAGATTGCATTCGTTCCGGAATGCTTGTTTGTGGAATTGCTCTGT
the complete sequence of the EF-1 alpha 2 gene of Polygonatum cyrtonema is as follows:
TAGGTATGGTGATGATGGAAAAGGGACTACATTAACTTCAATCTATAGATTTTTTTTTGTATATAGATGACTCGTGTTGCTGTATAATGGTTGTTTTTTTTTGCTGATTTTTTTCTGTAATTAACATATGTACTGTAAATTTATGTTGGTCTTCATGTTGCAATCTTGTTGGATATGCAAGTCATGACTCTTTGACTCTGTTTCTAGTAAATACTTGCCAATTATCTTTATTCTGTAGTGTAATTTATTTTAAAGCTGTCCTATCTATCAATCTAATCAGGCTTATGCTCGGTTATCTTTAACATCATCTTGTATTTTTAAAATTTTCCGCTTATCTTTGTAATCTGTTTTTTTCATTATCACCGAGTCCTTTGTGTATTTTCTGCAACTTTACCAGCCATCATGGGTAAAGAGAAAATTCATATCAACATTGTCGTCATTGGGCATGTCGACTCTGGCAAGTCTACGACCACTGGTCATCTAATCTATAAGCTTGGAGGTATTGACAAGCGAGTCATTGAAAGATTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAATATGCCTGGGTTCTTGACAAGCTCAAGGCAGAGCGTGAACGTGGTATCACAATTGATATTGCTCTCTGGAAATTCGAGACCACAAAGTACTACTGCACTGTCATTGATGCCCCTGGACATCGTGACTTTATTAAGAACATGATCACGGGTACGTCCCAGGCTGATTGTGCTGTCCTCATCATTGACTCCACTACTGGTGGTTTTGAAGCTGGTATCTCTAAGGATGGACAGACCCGTGAGCACGCTCTGCTTGCTTTCACCCTTGGTGTGAAGCAAATGATTTGCTGCTGTAACAAGATGGATGCCACCACCCCCAAATATTCCAAGGCCAGGTATGATGAAATCGTCAAGGAAGTGTCTTCTTACCTTAAGAAGGTTGGTTACAACCCTGACAAGATTCCTTTTGTTCCCATCTCTGGGTTCGAAGGTGACAATATGATTGAGAGATCCTCCAACCTTGACTGGTACAAGGGTCCTACCCTTCTTGACGCTCTTGACCTGATCAATGAACCCAAGAGGCCCACAGATAAGCCTCTCCGTCTTCCACTTCAGGACGTGTACAAAATCGGTGGTATTGGAACTGTCCCTGTGGGTCGTGTTGAGACTGGTATCCTCAAGCCTGGTATGGTTGTCACCTTTGGACCCACTGGGCTGACAACTGAAGTTAAGTCTGTTGAGATGCACCATGAAGCTCTGCAGGAGGCTCTCCCCGGAGACAATGTTGGCTTCAATGTCAAGAATGTTGCCGTGAAGGATCTCAAGCGTGGTTTTGTTGCCTCCAACTCCAAGGATGATCCTGCAAAGGAGGCTGCCAACTTCACTTCTCAGGTTATCATCATGAACCATCCTGGTCAGATCGGCAATGGATATGCTCCAGTGCTTGACTGCCATACCTGCCACATTGCTGTGAAGTTTGCTGAGATCCTCACGAAGATCGACAGGCGATCTGGCAAGGAACTTGAGAAGGAGCCCAAGTTCTTGAAGAATGGTGATGCTGGTTTCGTTAAGATGATCCCCACCAAGCCCATGGTAGTGGAGACATTCTCTGAGTACCCACCATTGGGACGTTTTGCCGTGAGGGACATGAGGCAGACTGTTGCTGTGGGAGTTATCAAGAGCGTTGAGAAGAAGGATCCCACTGGTGCCAAAGTCACCAAGGCTGCTGCCAAGAAGAAGTGAGAAGTATGTCCGTCTGTTGTTGGTTACAAGTGCCTTTTGTGGAGGCAGCATTATGTATGGTTTTCTGTCAGTTACAAGGGTCTTTTGTGGAGGCAGCATTCAGTATGGTTTTCTGCTCTCTCCGGTGTCTGGATGTTGGGTGCGGCACAACTCAGAACTGGGTTCTTGACCGGAGGTGGCAGGCTCATTTTTGGTCTTGATTGCTTGGTTTTGTGAGGTGAGTTCCGGGTTCTAGTTAAAACTTTTTAATTCTAGTTTAAAAAACTGTTTTTATGATTACCTTTTGTTAAACTTGGAAGTTATGTTTGTTGTAGTTTTGTTACAGTGCCTGTTTAAGTTTTCAAAATTATGTCAAGTATGTTGGTGATGAATTTGTTTTGTCTTCAATTTGTTGCTGTGATTGATTGTTATGATAGTGTAGTCTGCATGTGATGTTGCTTCCAACCTGAAATTGATTGGTATATTGCTTGAAAGCTGATCTATTATGGATTTTGTTTACATCAGGTGCAGAATGGCTTGATTATATATATAGAGTTTAATTTATTTTTGTGTATAGTGTTTTTTGGAATGTATATGGAGGTGAAGCGTAAACTGTTTGTTTCCAGGTGAAAAACACG
the UBQ-E2-10 and EF-1 alpha 2 genes related by the invention are reference gene sequences found in a polygonatum cyrtome database established by the inventor, and are not referenced by reference gene sequences reported by other documents.
Specifically, the UBQ-E2-10 gene fragment used as the reference gene is shown as SEQ ID No.1, and the EF-1 alpha 2 gene fragment is shown as SEQ ID No. 2.
SEQ ID No.1 sequence is as follows:
GGACCCAGAAGTACGCAATGGGCTAGCCACAACAATGCGGTGGGCGGGGTAGATAGTTTGAGGTTACTTTCCTCTTCTATCTAGTTTCAAGGTTGGTGCTGTATCCCTGGTAATT
SEQ ID No.2 sequence is as follows:
CCCTTCTTGACGCTCTTGACCTGATCAATGAACCCAAGAGGCCCACAGATAAGCCTCTCCGTCTTCCACTTCAGGACGTGTACAAAATCGGTGGTATTGGAACTGTCCCTGTGGGTCGTGTTGAGACTGGTATCCTCAAGCCTGGTATGGTTGTCACCTTTGGACCCACTGGGCTGACAACTGAAGTTAAGTCTGTTGAGATGCACCATGAAGCTC
the gene fragment is the characteristic sequence of UBQ-E2-10 and EF-1 alpha 2 genes, and can be used for detecting the expression condition.
Experimental results show that UBQ-E2-10 and EF-1 alpha 2 are expressed most stably in different development periods of the Polygonatum cyrtonema tuber, and the expression conditions of the two reference genes are basically consistent, so that the method is the most suitable reference gene for the expression analysis of the Polygonatum cyrtonema tuber gene.
The invention also relates to application of the reference gene combination in qPCR detection of tuber gene expression of Polygonatum cyrtonema. The two reference genes UBQ-E2-10 and EF-1 alpha 2 selected by the invention have more reliable conclusion compared with a single reference gene.
Specifically, the reference gene combination can be used for qPCR analysis of the expression of related genes in steroid saponin synthesis pathways in polygonatum cyrtonema tubers in different development periods.
Specifically, the application is as follows: designing specific amplification primers aiming at relevant target genes FDFT1, SQLE, SMO1, DWF5, DWF1 and CYP710A in steroid saponin synthesis paths in Polygonatum cyrtonema tubers in different development periods, designing specific amplification primers according to characteristic sequences of internal reference genes UBQ-E2-1 and EF-1 alpha 2, respectively using Polygonatum cyrtonema tubers as experimental materials for amplification by adopting the primers, and calculating relative expression quantity according to CT values of the target genes and the internal reference genes; the specific amplification primer sequences are as follows:
FDFT1 gene:
an upstream primer: 5'-CCTCGGCACACCTCTATGAT-3'
A downstream primer: 5'-TAGGAATGGCAGGGTGAAAC-3'
SQLE gene:
an upstream primer: 5'-GAAAGGATGGACGCCAAGTA-3'
A downstream primer: 5'-CCTCCCAGCAACATCTGAAT-3'
SMO1 gene:
an upstream primer: 5'-GTCCAACTTGCCACTGGTTT-3'
A downstream primer: 5'-GCGGACAGAGCCAGAGTAAC-3'
DWF5 gene:
an upstream primer: 5'-GCTTTTCCCCAGATCAAACA-3'
A downstream primer: 5'-TTCTCCCGGGATGTATCTTG-3'
DWF1 gene:
an upstream primer: 5'-GGCTTCGAGAACAACCTGAC-3'
A downstream primer: 5'-GTGGTTACGGATCAGCCAGT-3'
CYP710A gene:
an upstream primer: 5'-CAGCTGGGGTGTTGATCTTT-3'
A downstream primer: 5'-GCCCTGTTGCTTAGATCTCG-3'
Internal reference UBQ-E2-10:
upstream: 5'-GGACCCAGAAGTACGCAATG-3'
Downstream: 5'-AATTACCAGGGATACAGCACC-3'
Internal reference EF-1 α2:
upstream: 5'-CCCTTCTTGACGCTCTTGAC-3'
Downstream: 5'-GAGCTTCATGGTGCATCTCA-3'.
The beneficial effects of the invention are mainly as follows: the invention provides the combination of the reference genes of the polygonatum cyrtonema tubers in different development periods for the first time, solves the current situation of lack of the reference genes in the real-time fluorescent quantitative PCR analysis of the polygonatum cyrtonema tubers in different development periods, and compared with the single reference gene, the invention uses the combination of UBQ-E2-10 and EF-1 alpha 2 genes, and the obtained result is more accurate and reliable.
(IV) description of the drawings
FIG. 1 shows qPCR solubilization curves of 8 candidate reference genes.
FIG. 2 is a graph showing CT value distribution of 8 candidate reference genes.
FIG. 3 shows the GeNorm analysis of the expression stability (A) and the optimal number (B) of 8 candidate reference genes.
FIG. 4 shows the expression stability of 8 candidate reference genes analyzed by NormFinder.
FIG. 5 shows the expression of 6 genes involved in steroid saponin synthesis (UBQ-E2-10 and EF-1. Alpha.2 as internal controls).
(fifth) detailed description of the invention
The present invention will be described in further detail with reference to the following specific examples, which are only for the purpose of illustrating the invention and are not to be construed as limiting the scope of the invention.
Example 1:
1.1 materials
The P.cyrtonem tissue culture seedling of Polygonatum cyrtonem cultivated in a forest tissue culture laboratory of the forest sciences laboratory of Zhejiang province is used as a research material. Taking out the tissue culture seedlings which are respectively cultured for 3 months, 6 months and 9 months from the tissue culture bottle, cutting off stem leaf buds, taking tuber samples, quick-freezing with liquid nitrogen, and storing at-80 ℃ for later use; 3 flasks were taken for each sample as 3 biological replicates.
1.2 extraction of tuber Total RNA and cDNA Synthesis at different developmental stages
And (3) pre-cooling the experimental devices such as a mortar, tweezers, a medicine spoon and the like by liquid nitrogen before the experiment, and grinding the sample under the condition of fully soaking by the liquid nitrogen. The ground sample was subjected to extraction of total RNA with Mini BEST Plant RNA Extraction Kit (TaKaRa, japan). The concentration and purity of RNA was checked with NanoDrop 2000 (Thermo Scientific) and the integrity of total RNA was checked using 1.5% agarose gel electrophoresis. Using Prime Script with RNA as template TM RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, japan) the first strand of cDNA was synthesized by reverse transcription, and the product was stored in a-20deg.C freezer for use. The reverse transcription reaction is carried out in two steps, and the first reaction system is as follows: 900ng of template RNA, 5× gDNA Eraser Buffer 2. Mu.L, gDNA Eraser 1. Mu.L; the reaction procedure is 42 ℃/2m and is preserved at 42 ℃; the second reaction system is as follows: 5 x Prime
Figure BDA0002536966860000081
Buffer(for Real-time)4μL，Prim/>
Figure BDA0002536966860000082
RT Enzyme Mix I 1μL，RT PrimerMix 1μL，RNase Free dH 2 O4.0. Mu.L system; the reaction procedure: storing at 37 ℃/15m,85 ℃/5s and 4 ℃.1.3 candidate reference Gene screening and primer design
Based on the laboratory pre-established Polygonatum cyrtonema transcriptome database and plant common reference genes reported in related literature, 8 genes of Unigene 0073856 (H2A 2), unigene 0092554 (GAPDH), actin, unigene 0083619 (beta-TUBULIN), unigene 0078415F (UBQ-E2-10), unigene 0077648 (EF-1 alpha 2), unigene 0007693 (18S) and Unigene 0001606 (alpha-TUBULIN) were selected as candidate reference genes, and specific primers were designed (Table 1) and sent to Beijing engine novel biological company for synthesis.
Table 1: primer sequence of internal reference gene and amplification efficiency
Figure BDA0002536966860000091
1.4 qPCR screening of reference genes
qPCR was performed on a LineGene 9600Plus (FQD-96A, hangzhou Bori technology) with a reaction system of 10. Mu.L: cDNA template 1. Mu.L, upstream primer 0.2. Mu.L, downstream primer 0.2. Mu.L, 2 XSYBR Green Mix (BioEasy Master Mix) 5. Mu.L, ddH 2 O 3.6μL。
The reaction procedure is: a constant temperature section of 95 ℃/2m; the circulation section carries out 95 ℃/15s,60 ℃/20s and 40 cycles; dissolution stage 95 ℃/15s,60 ℃/1m,95 ℃/15s. Each experiment was repeated with 3 techniques.
After the reaction, the amplification specificity of each gene was analyzed and CT values of 8 genes were obtained according to the lysis curve, and a CT value distribution map was drawn by using Origin 8 software (FIG. 1).
1.5 Standard Curve and Gene amplification efficiency
Sequentially diluting cDNA templates of Polygonatum cyrtonema Fabricius tubers in different development periods to 5 of template initial concentration 0 、5 -1 、5 -2 、5 -3 、5 -4 The total of 5 gradients, designated as D0, D1, D2, D3 and D4, was set up for 3 technical replicates per reaction. CT values for each candidate reference gene under 5 gradients were obtained by qPCR reactions. Log C of template concentration n Drawing a standard curve by taking a CT value as an ordinate and calculating to obtain a slope K and a correlation coefficient R, wherein n is more than or equal to 0 and less than or equal to 4 2 . By the formula e= (10 -1 /k -1 )×100％The amplification efficiency E was calculated.
1.6 data analysis
CT values of 8 candidate reference genes obtained by qPCR were analyzed using three statistical software, geNorm, normFinder and bestdeeper, to obtain reference genes stably expressed at different developmental stages. Wherein GeNorm and NormFinder are analyzed by using the relative expression of CT value conversion as initial data, and BestKeeper is analyzed by using the original CT value as initial data.
1.7 reliability verification of reference Gene
Based on the pre-established Polygonatum cyrtonema Fabricius transcriptome database, 6 metabolic genes (Table 2) in the steroid saponin biosynthesis pathway of Polygonatum cyrtonema Fabricius are selected, the Polygonatum cyrtonema Fabricius tubers for 3 months, 6 months and 9 months are respectively used as experimental materials, and the expression conditions of the 6 genes are analyzed by using the selected internal reference genes.
Table 2: polygonatum cyrtonema steroidal saponin biosynthesis pathway related gene for qPCR analysis
Figure BDA0002536966860000101
Figure BDA0002536966860000111
The reaction system:
qPCR was performed on a LineGene 9600Plus (FQD-96A, hangzhou Bori technology) with a reaction system of 10. Mu.L: cDNA template 1. Mu.L, upstream primer 0.2. Mu.L, downstream primer 0.2. Mu.L, 2 XSYBR Green Mix (BioEasy Master Mix) 5. Mu.L, ddH 2 O 3.6μL。
The reaction procedure is: a constant temperature section of 95 ℃/2m; the circulation section carries out 95 ℃/15s,60 ℃/20s and 40 cycles; dissolution stage 95 ℃/15s,60 ℃/1m,95 ℃/15s. Each experiment was repeated with 3 techniques.
In the experiment, 3 months of Polygonatum cyrtonema tubers are used as a control group, 6 months and 9 months of Polygonatum cyrtonema tubers are used as an experimental group, and 2 －ΔΔCT Calculation of genes for qPCR experimentsThe reliability of the two reference genes UBQ-E2-10 and EF-1. Alpha.2 was verified by the expression of 6 target genes (Table 2) by the method of relative expression. The gene expression levels of 6 target genes were analyzed using UBQ-E2-10 and EF-1. Alpha.2 as internal references, respectively.
The analysis process comprises the following steps:
by 2 －ΔΔCT The method calculates the relative expression quantity of genes in the qPCR test, and the calculation formula is as follows: relative expression level of gene=2 －ΔΔCT . The calculation formula of the delta CT is as follows: ΔΔΔΔ ct=Δ CT (test group) - Δct (control); the delta CT calculation formula of the test group or the control group is as follows: Δct=ct (gene of interest) -CT (reference gene). In order to verify the amplification efficiency of qPCR reaction, cDNA template concentration was diluted 5-fold gradient, and CT values were obtained by amplifying qPCR primers of the target gene and the reference gene, each template was repeated 3 times, to obtain a standard curve. Correlation coefficient R according to standard curve 2 And slope K, by the formula e= (10 -1 /k -1 ) The amplification efficiency E was calculated as X100%. Data analysis was performed using Excel 2010, origin 7.5 and SPSS 18.0 statistical analysis software.
2 results and analysis
2.1 analysis of amplification efficiency and amplification specificity of candidate reference genes
The total RNA concentration extracted from the Polygonatum cyrtonema Fabricius tubers in different development periods is high and is 200-450 ng/. Mu.L, and no genome DNA pollution exists. OD (optical density) 260 / 280 1.9-2.1, the RNA sample has better integrity and higher purity, and can be used for subsequent experiments.
The cDNA template after reverse transcription was diluted with 5-fold gradient dilution, qPCR analysis was performed, and standard curves of the candidate internal reference genes were drawn from the obtained data. The results show that the correlation coefficient R of each reference gene standard curve 2 And more than or equal to 0.98, which indicates good linearity. The amplification efficiency is between 90% and 110% (Table 1), the melting curves have only a single melting peak, and the non-specific amplification such as primer dimer is avoided, and the repeatability is good. It was demonstrated that the amplification efficiency and linearity of each reference gene were satisfactory (FIG. 1).
2.2 analysis of expression abundance of candidate reference genes
The smaller the number of cycles required to reach a preset threshold, i.e., the CT value, during qPCR amplification, the higher the template concentration of the starting gene. The average expression abundance of 8 candidate reference genes was assessed by performing a clean-up analysis of CT values in tuber samples at different developmental stages (fig. 2). The results show that the CT values of 8 candidate reference genes are between 16 and 28, most of the candidate reference genes are concentrated between 20 and 24, which indicates that the expression abundance is moderate. Wherein the CT value of UBQ-E2-10 is lowest, the range is between 16.43 and 18.57, and the expression abundance is highest; the CT value of 18S rRNA is highest, the range is between 26.28 and 28.84, and the expression abundance is lowest. This shows that the expression of different reference genes in the tubers of Polygonatum cyrtonema has obvious difference.
2.3 analysis of stability of candidate internal reference genes
And adopting three software of NormFinder, geNorm and Best-Keeper to analyze the expression stability of 8 candidate reference genes in the polygonatum cyrtonema tubers in different development periods, and screening out proper reference genes.
2.3.1 GeNorm analysis
GeNorm measures the stability of expression by calculating the stability of expression (expression stability value, M) of each candidate reference gene in different tissues. The software takes M=1.5 as a threshold value, the smaller the M value is, the higher the stability is, the more suitable as an internal reference gene is, and the M is>1.5 indicates that it is not suitable as a reference gene. The M values are arranged from big to small in sequence: ACTIN>β-Tubulin>H2A2>GADPH>α-Tubulin4>18S rRNA>EF-1α2>UBQ-E2-10. As can be seen from FIG. 3A, the M values of the 8 candidate reference genes are all less than 1.5, with the ACTIN being the largest, 0.456, and the EF2 and U11 being the smallest, and 0.303, thus demonstrating that the 8 candidate genes are all suitable as reference genes. Of these, UBQ-E2-10 and EF-1. Alpha.2 are optimal, followed by 18S rRNA, alpha-Tubulin 4, GADPH and H2A2, while beta-Tubulin and ACTIN expression are the least stable. In addition, geNorm determines the optimum number of reference genes by calculating the paired variation values (pairwisevariation value) to obtain accurate and reliable results. The program takes 0.15 as a threshold, when V n/n+1 <1.5, n reference genes can meet the purpose of correctionRequirement of gene expression level. From FIG. 3B, it can be seen that V 2/3 Is 0.119<1.5, the number of the most suitable internal reference genes is 2.
2.3.2 NormFinder analysis
NormFinder is similar to GeNorm, and the expression stability of the candidate reference gene is inversely related to the expression stability value M. That is, the smaller the M value, the more suitable as an internal reference gene. The analysis results show (fig. 4) that the 8 candidate reference genes are sequentially arranged from the large to the small according to the M value: ACTIN > H2A2> beta-Tubulin > GADPH > alpha-Tubulin 4>18S rRNA > EF-1 alpha 2> UBQ-E2-10. Wherein the stable values of UBQ-E2-10 and EF-1 alpha 2 are minimum and are respectively 0.167 and 0.161, namely the expression stability is the best; the largest are ACTIN and H2A2, 0.328 and 0.277, respectively, i.e.the expression stability is the worst. Therefore UBQ-E2-10 and EF-1. Alpha.2 are most suitable as reference genes, followed by 18S rRNA and. Alpha. -Tubulin.
2.3.3 BestKeeper analysis
BestKeeper calculates standard deviation (standard deviation, SD) according to the average CT value of candidate reference genes in different samples, and the expression is more stable when the SD value is smaller. The program takes SD=1 as a critical value, and when the SD value is larger than 1, the program indicates that the gene is unsuitable as an internal reference gene; on the contrary, the expression stability of the gene is good. As shown in Table 3, the SD values of all the 7 candidate reference genes except beta-Tubulin were less than 1, and were all suitable as reference genes, of which GADPH and UBQ-E2-10 were most stable in expression, and were most suitable as reference genes, followed by ACTIN and 18S rRNA.
Table 3: bestKeeper analysis of expression stability of 8 candidate internal reference genes
Figure BDA0002536966860000131
Therefore, according to the analysis results of the above three procedures, geNorm and Norm-Finder analysis show that the most stable gene combinations are UBQ-E2-10 and EF-1 alpha 2, and the combination of GADPH and UBQ-E2-10 analyzed by BestKeeper also meets the requirements of internal reference genes. From the above, the most suitable combination of internal reference genes is UBQ-E2-10 and EF-1. Alpha.2.
2.4 reliability verification of reference Gene
To verify the reliability of UBQ-E2-10 and EF-1. Alpha.2 as reference genes, qPCR analysis was performed on the expression of the relevant genes (Table 2) in the steroid saponin synthesis pathway in Polygonatum cyrtonema tubers at different developmental stages. The results showed that the expression of 6 steroid saponin synthesis genes in 3 parts of tuber material was approximately the same when UBQ-E2-10 and EF-1. Alpha.2 were used as reference genes, respectively, indicating that both UBQ-E2-10 and EF-1. Alpha.2 were used as suitable reference genes for qPCR analysis of Polygonatum cyrtonema tubers at different developmental stages (FIG. 5). In addition, 6 genes all show up-regulated expression with different degrees along with the continuous development and growth of tubers, wherein the expression of SQLE, SMO1, DWF1 and CYP710A genes is obviously up-regulated, which shows that the expression of genes related to a steroid saponin synthesis pathway is obviously positively correlated with the growth and development of the tubers, and lays a foundation for further research on finding key enzyme-genes for the synthesis of the steroid saponins and analyzing the intrinsic molecular mechanism of the synthesis pathway.
3. Conclusion(s)
Screening of reference genes suitable for testing is necessary before gene expression studies are performed. A large number of research results show that the expression stability of the reference gene under different plant types and different physiological environment conditions is not constant, and even the expression of the reference gene under different tissues, different physiological stages and different stress conditions of the same species has instability, so that the screening of proper reference according to experimental conditions is particularly important. Many software is used for screening of reference genes and stability evaluation, and the evaluation principle and mode of stability of each software are different, so that the final conclusion is different.
The qPCR analysis of the tubers of the polygonatum cyrtonema in different development periods further proves that UBQ-E2-10 and EF-1 alpha 2 can be used for researching the expression of the genes related to steroid saponin biosynthesis in the development process of the tubers of the polygonatum cyrtonema.
Sequence listing
<110> Zhejiang province forestry science institute
<120> internal reference gene combination for expression analysis of tuber gene of Polygonatum cyrtonema and application thereof
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1317
<212> DNA
<213> P. cyrtonema Hua.
<400> 1
actgggccaa gggccactac accgagggag cggagctgat tgactcggtt cttgatgtcg 60
tcaggaagga ggccgagaat tgtgattgct tgcaaggatt ccaagtatgc cattctttgg 120
gaggcggcac cggatctggt atgggaaccc ttctcatctc aaagatccga gaggagtacc 180
ctgatcgcat gatgttgaca ttctctgtgt tcccatcacc aaaggtctca gacactgttg 240
tggagccata caatgccact ctttctgtac atcagcttgt cgaaaatgct gacgagtgca 300
tggttttgga caatgaagct ttgtatgata tttgtttccg cactctgaag ctagcaactc 360
ctacctttgg ggaccttaat catctgatct ctgccaccat gagtggtgtc acctgctgtc 420
tccgcttccc tggtcagctc aactctgatc tccggaagct tgcagtcaat ctgatcccat 480
tcccccgtct ccacttcttc atggtgggat ttgcaccctt gacctcaagg ggctcgcaac 540
agtaccgctc tctcactgtt ccagagctca cccagcaaat gtgggactct aagaacatga 600
tgtgtgctgc tgacccaagg cacgggcgct acctcactgc ctctgccgtg ttccgtggga 660
agatgagcac aaaagaagtg gatgagcaga tgatcaacgt ccagaacaag aactcttcct 720
acttcgtcga gtggattcca aacaatgtca agtccagtgt gtgtgacatc ccaccaaagg 780
gtctgaagat ggcatccaca ttcattggaa actcgacttc cattcaggaa atgttcagga 840
gggtcagcga acagttcaca gccatgttca ggaggaaggc tttccttcac tggtatacag 900
gtgaggggat ggacgagatg gagttcaccg aagccgagag taatatgaat gatctggtgg 960
ccgagtacca gcaataccag gatgctacag ctgatgaaga gtatcaggag gaggaagaag 1020
aggagatgga tggtgcttaa ggagggttat gtcctttccg accgggtttt tatccatttc 1080
aggtttgctt tgagatggtt agtgaagtgt tgttctttat atcaagagac caatttgtat 1140
cattgtatga catgtatgaa agtaatgttt gttgtttgga gagcgagcga gctttagatg 1200
tctgtgacat cagtctatgg tggctggtga cttttgtacc ttgtgaaata ttggtaattc 1260
attttcaccg gtgagattgc attcgttccg gaatgcttgt ttgtggaatt gctctgt 1317
<210> 2
<211> 2363
<212> DNA
<213> P. cyrtonema Hua.
<400> 2
taggtatggt gatgatggaa aagggactac attaacttca atctatagat ttttttttgt 60
atatagatga ctcgtgttgc tgtataatgg ttgttttttt ttgctgattt ttttctgtaa 120
ttaacatatg tactgtaaat ttatgttggt cttcatgttg caatcttgtt ggatatgcaa 180
gtcatgactc tttgactctg tttctagtaa atacttgcca attatcttta ttctgtagtg 240
taatttattt taaagctgtc ctatctatca atctaatcag gcttatgctc ggttatcttt 300
aacatcatct tgtattttta aaattttccg cttatctttg taatctgttt ttttcattat 360
caccgagtcc tttgtgtatt ttctgcaact ttaccagcca tcatgggtaa agagaaaatt 420
catatcaaca ttgtcgtcat tgggcatgtc gactctggca agtctacgac cactggtcat 480
ctaatctata agcttggagg tattgacaag cgagtcattg aaagattcga gaaggaggct 540
gctgagatga acaagaggtc attcaaatat gcctgggttc ttgacaagct caaggcagag 600
cgtgaacgtg gtatcacaat tgatattgct ctctggaaat tcgagaccac aaagtactac 660
tgcactgtca ttgatgcccc tggacatcgt gactttatta agaacatgat cacgggtacg 720
tcccaggctg attgtgctgt cctcatcatt gactccacta ctggtggttt tgaagctggt 780
atctctaagg atggacagac ccgtgagcac gctctgcttg ctttcaccct tggtgtgaag 840
caaatgattt gctgctgtaa caagatggat gccaccaccc ccaaatattc caaggccagg 900
tatgatgaaa tcgtcaagga agtgtcttct taccttaaga aggttggtta caaccctgac 960
aagattcctt ttgttcccat ctctgggttc gaaggtgaca atatgattga gagatcctcc 1020
aaccttgact ggtacaaggg tcctaccctt cttgacgctc ttgacctgat caatgaaccc 1080
aagaggccca cagataagcc tctccgtctt ccacttcagg acgtgtacaa aatcggtggt 1140
attggaactg tccctgtggg tcgtgttgag actggtatcc tcaagcctgg tatggttgtc 1200
acctttggac ccactgggct gacaactgaa gttaagtctg ttgagatgca ccatgaagct 1260
ctgcaggagg ctctccccgg agacaatgtt ggcttcaatg tcaagaatgt tgccgtgaag 1320
gatctcaagc gtggttttgt tgcctccaac tccaaggatg atcctgcaaa ggaggctgcc 1380
aacttcactt ctcaggttat catcatgaac catcctggtc agatcggcaa tggatatgct 1440
ccagtgcttg actgccatac ctgccacatt gctgtgaagt ttgctgagat cctcacgaag 1500
atcgacaggc gatctggcaa ggaacttgag aaggagccca agttcttgaa gaatggtgat 1560
gctggtttcg ttaagatgat ccccaccaag cccatggtag tggagacatt ctctgagtac 1620
ccaccattgg gacgttttgc cgtgagggac atgaggcaga ctgttgctgt gggagttatc 1680
aagagcgttg agaagaagga tcccactggt gccaaagtca ccaaggctgc tgccaagaag 1740
aagtgagaag tatgtccgtc tgttgttggt tacaagtgcc ttttgtggag gcagcattat 1800
gtatggtttt ctgtcagtta caagggtctt ttgtggaggc agcattcagt atggttttct 1860
gctctctccg gtgtctggat gttgggtgcg gcacaactca gaactgggtt cttgaccgga 1920
ggtggcaggc tcatttttgg tcttgattgc ttggttttgt gaggtgagtt ccgggttcta 1980
gttaaaactt tttaattcta gtttaaaaaa ctgtttttat gattaccttt tgttaaactt 2040
ggaagttatg tttgttgtag ttttgttaca gtgcctgttt aagttttcaa aattatgtca 2100
agtatgttgg tgatgaattt gttttgtctt caatttgttg ctgtgattga ttgttatgat 2160
agtgtagtct gcatgtgatg ttgcttccaa cctgaaattg attggtatat tgcttgaaag 2220
ctgatctatt atggattttg tttacatcag gtgcagaatg gcttgattat atatatagag 2280
tttaatttat ttttgtgtat agtgtttttt ggaatgtata tggaggtgaa gcgtaaactg 2340
tttgtttcca ggtgaaaaac acg 2363
<210> 3
<211> 115
<212> DNA
<213> P. cyrtonema Hua.
<400> 3
ggacccagaa gtacgcaatg ggctagccac aacaatgcgg tgggcggggt agatagtttg 60
aggttacttt cctcttctat ctagtttcaa ggttggtgct gtatccctgg taatt 115
<210> 4
<211> 216
<212> DNA
<213> P. cyrtonema Hua.
<400> 4
cccttcttga cgctcttgac ctgatcaatg aacccaagag gcccacagat aagcctctcc 60
gtcttccact tcaggacgtg tacaaaatcg gtggtattgg aactgtccct gtgggtcgtg 120
ttgagactgg tatcctcaag cctggtatgg ttgtcacctt tggacccact gggctgacaa 180
ctgaagttaa gtctgttgag atgcaccatg aagctc 216
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 5
cctcggcaca cctctatgat 20
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 6
taggaatggc agggtgaaac 20
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 7
gaaaggatgg acgccaagta 20
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 8
cctcccagca acatctgaat 20
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 9
gtccaacttg ccactggttt 20
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 10
gcggacagag ccagagtaac 20
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 11
gcttttcccc agatcaaaca 20
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 12
ttctcccggg atgtatcttg 20
<210> 13
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 13
ggcttcgaga acaacctgac 20
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 14
gtggttacgg atcagccagt 20
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 15
cagctggggt gttgatcttt 20
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 16
gccctgttgc ttagatctcg 20
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 17
ggacccagaa gtacgcaatg 20
<210> 18
<211> 21
<212> DNA
<213> Artificial sequence (Unknown)
<400> 18
aattaccagg gatacagcac c 21
<210> 19
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 19
cccttcttga cgctcttgac 20
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence (Unknown)
<400> 20
gagcttcatg gtgcatctca 20

Claims (2)

1. A primer combination for analysis of expression of tuber genes of Polygonatum cyrtonema Fabricius at different developmental stages, comprising:
an upstream primer: 5'-CCTCGGCACACCTCTATGAT-3'
A downstream primer: 5'-TAGGAATGGCAGGGTGAAAC-3'
SQLE gene:
an upstream primer: 5'-GAAAGGATGGACGCCAAGTA-3'
A downstream primer: 5'-CCTCCCAGCAACATCTGAAT-3'
SMO1 gene:
an upstream primer: 5'-GTCCAACTTGCCACTGGTTT-3'
A downstream primer: 5'-GCGGACAGAGCCAGAGTAAC-3'
DWF5 gene:
an upstream primer: 5'-GCTTTTCCCCAGATCAAACA-3'
A downstream primer: 5'-TTCTCCCGGGATGTATCTTG-3'
DWF1 gene:
an upstream primer: 5'-GGCTTCGAGAACAACCTGAC-3'
A downstream primer: 5'-GTGGTTACGGATCAGCCAGT-3'
CYP710A gene:
an upstream primer: 5'-CAGCTGGGGTGTTGATCTTT-3'
A downstream primer: 5'-GCCCTGTTGCTTAGATCTCG-3'
Internal reference UBQ-E2-10:
upstream: 5'-GGACCCAGAAGTACGCAATG-3'
Downstream: 5'-AATTACCAGGGATACAGCACC-3'
Internal reference EF-1 α2:
upstream: 5'-CCCTTCTTGACGCTCTTGAC-3'
Downstream: 5'-GAGCTTCATGGTGCATCTCA-3'.
2. A method for analysis of tuber gene expression of polygonatum cyrtonema in different developmental stages, the method comprising: specific amplification primers are respectively designed aiming at relevant target genes FDFT1, SQLE, SMO1, DWF5, DWF1 and CYP710A in steroid saponin biosynthesis paths in Polygonatum cyrtonema tubers in different development periods, and specific amplification primers are designed according to characteristic sequences of internal reference genes UBQ-E2-1 and EF-1 alpha 2, the primers are adopted to amplify the Polygonatum cyrtonema tubers respectively by taking the Polygonatum cyrtonema tubers as experimental materials, and relative expression amounts are calculated according to CT values of the target genes and the internal reference genes, and the specific amplification primers have the following sequences:
FDFT1 gene:
an upstream primer: 5'-CCTCGGCACACCTCTATGAT-3'
A downstream primer: 5'-TAGGAATGGCAGGGTGAAAC-3'
SQLE gene:
an upstream primer: 5'-GAAAGGATGGACGCCAAGTA-3'
A downstream primer: 5'-CCTCCCAGCAACATCTGAAT-3'
SMO1 gene:
an upstream primer: 5'-GTCCAACTTGCCACTGGTTT-3'
A downstream primer: 5'-GCGGACAGAGCCAGAGTAAC-3'
DWF5 gene:
an upstream primer: 5'-GCTTTTCCCCAGATCAAACA-3'
A downstream primer: 5'-TTCTCCCGGGATGTATCTTG-3'
DWF1 gene:
an upstream primer: 5'-GGCTTCGAGAACAACCTGAC-3'
A downstream primer: 5'-GTGGTTACGGATCAGCCAGT-3'
CYP710A gene:
an upstream primer: 5'-CAGCTGGGGTGTTGATCTTT-3'
A downstream primer: 5'-GCCCTGTTGCTTAGATCTCG-3'
Internal reference UBQ-E2-10:
upstream: 5'-GGACCCAGAAGTACGCAATG-3'
Downstream: 5'-AATTACCAGGGATACAGCACC-3'
Internal reference EF-1 α2:
upstream: 5'-CCCTTCTTGACGCTCTTGAC-3'
Downstream: 5'-GAGCTTCATGGTGCATCTCA-3'.
CN202010535853.0A 2020-06-12 2020-06-12 Internal reference gene combination for expression analysis of tuber genes of Polygonatum cyrtonema and application thereof Active CN111690762B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010535853.0A CN111690762B (en) 2020-06-12 2020-06-12 Internal reference gene combination for expression analysis of tuber genes of Polygonatum cyrtonema and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010535853.0A CN111690762B (en) 2020-06-12 2020-06-12 Internal reference gene combination for expression analysis of tuber genes of Polygonatum cyrtonema and application thereof

Publications (2)

Publication Number Publication Date
CN111690762A CN111690762A (en) 2020-09-22
CN111690762B true CN111690762B (en) 2023-05-12

Family

ID=72480547

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010535853.0A Active CN111690762B (en) 2020-06-12 2020-06-12 Internal reference gene combination for expression analysis of tuber genes of Polygonatum cyrtonema and application thereof

Country Status (1)

Country Link
CN (1) CN111690762B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112126689B (en) * 2020-09-27 2024-07-09 浙江省林业科学研究院 Internal reference gene for analysis of gene expression of flammulina velutipes in bamboo forest during metarhizium anisopliae infection and application

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Shiqiang Wang等.De Novo Assembly and Analysis of Polygonatum sibiricum Transcriptome and Identification of Genes Involved in Polysaccharide Biosynthesis.《International Journal of Molecular Sciences》.2017,第18卷第1950页. *
Swati Upadhyay等.Recent advances in steroidal saponins biosynthesis and in vitro production.《Planta》.2018,第248卷第519-544页. *
杨阳等.多花黄精块茎发育和胁迫条件下qPCR内参基因的筛选与验证.《中国中药杂志》.2020,第45卷(第24期),第5976-5975页. *
王世强等.黄精实时荧光定量PCR内参基因的筛选.《基因组学与应用生物学》.2017,第36卷(第11期),第4770-4777页. *

Also Published As

Publication number Publication date
CN111690762A (en) 2020-09-22

Similar Documents

Publication Publication Date Title
Liu et al. Selection of reference genes for quantitative real-time PCR normalization in Panax ginseng at different stages of growth and in different organs
CN104789557B (en) A kind of musky gourd reference gene and its application
CN110452959B (en) Screening method of wild aconite root real-time quantitative PCR reference genes
Wang et al. Selection and validation of appropriate reference genes for real-time quantitative PCR analysis in Momordica charantia
CN116144819B (en) SNP molecular marker closely linked with main effect QTL of pumpkin pulp carotenoid and application of SNP molecular marker
Yi et al. Selection of reliable reference genes for gene expression studies in Rhododendron micranthum Turcz
CN111690762B (en) Internal reference gene combination for expression analysis of tuber genes of Polygonatum cyrtonema and application thereof
CN110724760B (en) Polymorphic primer of cinnamomum camphora nuclear genome SSR molecular marker and application thereof
CN113174445B (en) Internal reference gene for analyzing different tissues of arrowhead and screening method and application thereof
CN109022548B (en) Primer for screening wax gourd real-time fluorescent quantitative PCR (polymerase chain reaction) internal reference gene TUA
CN112592996B (en) Molecular marker ZMM1776 closely linked with sesame seed sesamin content major gene locus and application thereof
CN113046367A (en) Screening and application of internal reference gene in arrowhead corm development process
CN112239779A (en) Primer and kit for quickly identifying sex of egg-shaped pompano and application of primer and kit
CN108070673A (en) The fluorescent quantitation reference gene and its primer of two kinds of tree-like pears difference tree-crown location leaf textures and application
Yue et al. Selection and evaluation of reference genes for quantitative gene expression analysis in broomcorn millet (Panicum miliaceum L.)
CN113755497B (en) Screening of reference genes in development process of taro corms and application thereof
CN112481404B (en) Internal gene of cinnamomum camphora under saline-alkali cultivation condition, primer and screening method
Lin et al. Selection and Validation of Reference Genes for Normalization of RT-qPCR Analysis in Developing or Abiotic-Stressed Tissues of Loquat (Eriobotrya japonica).
CN114350776B (en) Asparagus male specific primer and biological sex identification method
CN113846108B (en) Screening and application of taro high-expression internal reference gene Ce047468
CN112941229B (en) Blueberry reference gene and primer and application thereof
CN108085409A (en) The application of the screening technique of China fir reference gene and screening-gene as reference gene in different tissues
CN107400718A (en) The primer sets and method of Dendrobidium huoshanness and maple bucket product are identified based on Real timeARMS qPCR
AU2015100028A4 (en) Application of snp in dammarenediolsynthase gene of panax ginseng
CN108823328B (en) Reference gene for fluorescence quantitative analysis of wild hemp and cultivated hemp and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Li Haibo

Inventor after: Yang Yang

Inventor after: Shen Jianjun

Inventor after: Ye Bihuan

Inventor after: Chen Youwu

Inventor after: Song Qiyan

Inventor after: Hu Chuanjiu

Inventor before: Yang Yang

Inventor before: Shen Jianjun

Inventor before: Li Haibo

Inventor before: Ye Bihuan

Inventor before: Chen Youwu

Inventor before: Song Qiyan

Inventor before: Hu Chuanjiu

GR01 Patent grant
GR01 Patent grant