CN107254544B - Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology - Google Patents
Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology Download PDFInfo
- Publication number
- CN107254544B CN107254544B CN201710696645.7A CN201710696645A CN107254544B CN 107254544 B CN107254544 B CN 107254544B CN 201710696645 A CN201710696645 A CN 201710696645A CN 107254544 B CN107254544 B CN 107254544B
- Authority
- CN
- China
- Prior art keywords
- its2
- rhizoma atractylodis
- sequence
- standard
- atractylodes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for identifying seedlings of traditional Chinese medicine rhizoma atractylodis based on a DNA bar code technology, which provides a standard ITS2 bar code database of the traditional Chinese medicine rhizoma atractylodis and easily-mixed counterfeit products thereof, and identifies the authenticity of the traditional Chinese medicine rhizoma atractylodis seedlings by comparing an ITS2 sequence of a sample to be identified with a sequence in the standard ITS2 bar code database. The method can quickly and effectively identify the rhizoma atractylodis seedlings and the easily mixed counterfeit seedlings thereof, and ensure the production safety of the traditional Chinese medicine rhizoma atractylodis from the source.
Description
Technical Field
The invention relates to a traditional Chinese medicine identification method, in particular to a traditional Chinese medicine rhizoma atractylodis germchit identification method based on a DNA bar code technology.
Background
According to the record of Chinese pharmacopoeia of 2015 edition, rhizoma atractylodis is dry root of Atractylodes lancea (Thunb.) DC. or Atractylodes chinensis Koidz. of Compositae, and Atractylodes lancea and Atractylodes chinensis are revised to Atractylodes lancea (Thunberg) Candole by plant society of English (Flora of China). Cang Zhu is pungent, bitter and warm. It enters spleen, stomach and liver meridians. Dry dampness and invigorate spleen, dispel wind and cold, improve vision. Can be used for treating damp obstruction of middle warmer, abdominal distention, diarrhea, edema, tinea pedis atrophy 36484m, rheumatalgia, wind-cold type common cold, night blindness, dim eyesight, and astringency. The volatile oil components such as atractylodin and the like are considered as main pharmacological active components of the rhizoma atractylodis, and modern pharmacological research shows that the rhizoma atractylodis has the effects of inhibiting gastric acid secretion, resisting arrhythmia, inhibiting bacteria, resisting inflammation, reducing blood sugar, resisting anoxia and the like. The rhizoma atractylodis is an important component of famous Chinese patent medicines such as wrinkled gianthyssop herb vital qi water, ruyi golden yellow powder, Guogong wine and the like, the resource demand is large, wild medicinal materials are endangered and exhausted, the cultivation and planting scale is gradually enlarged, and the areas such as Hubei, Jiangsu, inner Mongolia and Hebei are main production areas of the medicinal materials. The rhizoma atractylodis is cultivated in two modes of seedling (division propagation and rhizome propagation) and seed propagation, and the seedling propagation is mainly used. In recent years, with the high price of rhizoma atractylodis, the cultivation area of rhizoma atractylodis is continuously enlarged, the source of quality rhizoma atractylodis seedlings is limited, and adulteration of rhizoma atractylodis seedlings occurs.
China still lacks of good variety production management specifications similar to those of crop species. In 2013, the 'notification about further strengthening of traditional Chinese medicine management' of departments such as the national food and drug administration indicates that 'seed seedling breeding bases are established in a unified way'. However, seeds and seedlings of traditional Chinese medicinal materials are mainly produced and sold, the quality of the seeds and seedlings is uneven, and particularly, the traditional Chinese medicinal material variety with short wild resources and high market value becomes a serious disaster area with adulterated seeds and seedlings. In recent years, as the price of the rhizoma atractylodis is continuously increased, wild resources are gradually exhausted, but the technology of changing the wild rhizoma atractylodis into the family is not completely mature, the yield of seedlings of the rhizoma atractylodis in north is limited, the seedlings collected in the field are not enough to meet the planting requirement, a considerable number of seedlings are purchased from the northeast of the region where the rhizoma atractylodis is cultivated for a long time, and the cultivated species of the rhizoma atractylodis in northeast of the north is mainly the local habit articles including the rhizoma atractylodis and the Korean rhizoma atractylodis, so that the current situation of the disordered seedlings of the rhizoma atractylodis is caused.
The DNA bar code technology utilizes a section of universal standard short sequence in a genome to identify species, does not depend on morphological characteristics of an identified object, is not influenced by the growth and development stages of the identified object, is a newly emerging seed seedling identification method in recent years, and is applied to identification research of seeds and seedlings of various traditional Chinese medicinal materials. At present, most of traditional Chinese medicinal materials are seriously deficient in wild resources, and artificial cultivation and planting of the traditional Chinese medicinal materials are important ways for guaranteeing the safety of the traditional Chinese medicines. The traditional Chinese medicine seed germchit is the source of traditional Chinese medicine cultivation and planting, how to ensure that the basic species of the traditional Chinese medicine seed germchit is the basic premise of traditional Chinese medicine production, and the hidden danger that the traditional Chinese medicine adulterant is buried in the traditional Chinese medicine seed germchit identification error and the market is flooded inevitably. The traditional method for identifying the seed seedlings of the traditional Chinese medicinal material seeds is based on the morphological characteristics of the seed seedlings, utilizes tools such as a magnifying glass, a body type microscope and the like to identify the microscopic characteristics of the seed seedlings, has extremely high requirements on the professional knowledge of an identifier, is easily influenced by the maturity, the storage state and the group difference of the seed seedlings of the traditional Chinese medicinal material seeds, and has strong subjectivity. The DNA bar code technology is used for researching the gene level of the Chinese medicinal material seed seedling, species distinguishing identification is carried out by comparing the difference on DNA sequences, the identification is not limited by morphological characteristics of samples, and the identification result is more accurate and reliable. The completed DNA bar code identification research of seeds and seedlings of the traditional Chinese medicinal materials of notopterygium root, rhizoma alismatis, paris polyphylla and the like shows that: the DNA bar code technology has unique advantages for discovering the counterfeit in the seedling market of the Chinese medicinal material seeds, and has important significance for ensuring the authenticity of the Chinese medicinal material seeds from the source, avoiding economic loss and ensuring the production safety of the Chinese medicinal material.
Therefore, the technicians in the field are dedicated to develop a method for identifying the seedlings of the traditional Chinese medicine rhizoma atractylodis based on a DNA bar code technology and a standard ITS2 bar code database for identifying the seedlings of the traditional Chinese medicine rhizoma atractylodis.
Disclosure of Invention
Traditionally, the seedling of the Chinese herbal medicine Rhizoma Atractylodis (Atractylodes rhizome) depends on the external morphology and the internal anatomical features of the seedling for identification, and the seedling is the initial stage of plant growth, and the typical features required by morphological taxonomic identification of flowers, fruits and the like are lacked, so that the species are difficult to accurately identify. In recent years, the Chinese medicinal material rhizoma atractylodis introduction error caused by the identification error not only brings huge economic loss, but also causes potential clinical medication safety risk. In order to overcome the defects, the invention provides a method for identifying the Chinese medicinal material rhizoma atractylodis seedlings based on a DNA bar code technology, which gets rid of the obstacle that the traditional identification method depends on morphological characteristics and has objective and accurate identification.
In a specific embodiment of the invention, the method provides a standard ITS2 bar code database of the traditional Chinese medicine Rhizoma Atractylodis (Atractylodes rhizome) and easily-mixed counterfeit products thereof, and the authenticity of the traditional Chinese medicine Rhizoma Atractylodis germchit is identified by comparing an ITS2 sequence of a sample to be identified with a sequence in the standard ITS2 bar code database.
Further, the standard ITS2 barcode database has standard ITS2 barcodes of Atractylodes (Atractylodes lancea (Thunberg) candel), Atractylodes Koreana (Nakai) Kitamura), Atractylodes macrocephala (Atractylodes macrocepha Koidz).
Further, the standard ITS2 bar code of the rhizoma atractylodis is 7, and the sequence of the bar code is shown as SEQ ID No. 10-16; the standard ITS2 bar code of the Atractylodes koreana is 9, and the sequence is shown in SEQ ID No. 1-9; the standard ITS2 bar code of the bighead atractylodes rhizome is 3, and the sequence of the bar code is shown in SEQ ID No. 17-19.
Further, the method comprises:
1) preprocessing a sample to be identified, extracting DNA of the sample to be identified, and performing PCR amplification, sequence determination and splicing to obtain an ITS2 sequence of the sample to be identified;
2) and comparing the ITS2 sequence of the sample to be identified with the standard ITS2 bar code in the standard ITS2 bar code database of the traditional Chinese medicine rhizoma atractylodis and the easily-mixed counterfeit thereof, thereby determining the authenticity of the sample to be identified.
Further, in step 2), one or more of NJ junction tree construction, BLAST alignment and genetic distance calculation comparison are carried out on the ITS2 sequence of the sample to be identified and the standard ITS2 barcode in the standard ITS2 barcode database of the Chinese herbal medicine rhizoma atractylodis and the easily-confused counterfeit product thereof, so as to determine the authenticity of the sample to be identified.
Further, the miscible and counterfeit products of the rhizoma atractylodis are korean rhizoma atractylodis and rhizoma atractylodis macrocephalae.
In another aspect of the present invention, a standard ITS2 barcode database for identification of the seedlings of the traditional Chinese medicine rhizoma atractylodis is provided, and in one embodiment, the database has standard ITS2 barcodes of rhizoma atractylodis, rhizoma atractylodis koraiensis and rhizoma atractylodis macrocephalae.
Further, the standard ITS2 barcode sequence of rhizoma Atractylodis is 7, and the sequence is shown in SEQ ID No. 10-16; the standard ITS2 barcode sequence of the Atractylodes koreana is 9, and the sequence is shown in SEQ ID No. 1-9; the standard ITS2 bar code sequence of the bighead atractylodes rhizome is 3, and the sequence is shown in SEQ ID No. 17-19.
In the research, an ITS2 sequence is used as a bar code, a standard ITS2 bar code database of the traditional Chinese medicine rhizoma atractylodis and easily-mixed products thereof is constructed by collecting a reference medicinal material sample of a Chinese medicine biological product verification institute and an authoritative morphological expert to identify an original plant sample, the sample to be identified is compared with a standard ITS2 bar code in the database, so that the authenticity of rhizoma atractylodis seedlings is determined, and finally, a novel traditional Chinese medicine rhizoma atractylodis seedling identification method based on a DNA bar code technology is established. Due to the high accuracy and the large base number of the medicinal material samples used for establishing the standard ITS2 bar code database, the standard ITS2 bar code in the database has wide coverage and high accuracy, and the accuracy of the subsequent identification of the rhizoma atractylodis seedlings serving as the Chinese medicinal material is improved.
The Korean rhizoma atractylodis and the rhizoma atractylodis have different chemical components and different pharmacological activities, and potential safety risks are brought to the market of rhizoma atractylodis medicinal materials and clinical application of the rhizoma atractylodis by introducing Korean rhizoma atractylodis seedlings in the cultivation process of the Chinese medicinal material rhizoma atractylodis. The method can quickly and effectively identify the rhizoma atractylodis seedlings and the seedlings of the easily mixed and counterfeit rhizoma atractylodis seedlings, and ensures the safety of the traditional Chinese medicinal materials.
The invention expands the application range of the DNA bar code to the field of seedling identification of Chinese medicinal material production, and the identified sample is the seedling of the Chinese medicinal material rhizoma atractylodis; and establishes the experiment and data analysis flow aiming at the rhizoma atractylodis seedlings. The invention provides more comprehensive and accurate sequence information of the rhizoma atractylodis and the adulterant thereof, and is rich and perfect for the traditional Chinese herbal medicine DNA barcode database.
Drawings
Fig. 1 is an NJ adjacency tree constructed based on a standard ITS2 barcode in a standard ITS2 barcode database of the traditional Chinese medicine atractylodes rhizome and ITS confusing counterfeits.
FIG. 2 is a table of genetic distances between the experimental sample SCZ006 of the seedling to be identified and the standard ITS2 bar code in the database according to one embodiment of the present invention.
FIG. 3 shows an NJ phylogenetic tree of the seedling experimental sample SCZ006 to be identified and the standard ITS2 barcode in the database according to an embodiment of the present invention.
FIG. 4 shows the BLAST alignment of the SCZ006 seedling test sample with the standard ITS2 barcode in the database according to one embodiment of the present invention.
Detailed Description
The present invention will be described in further detail below with reference to the following detailed description and the accompanying drawings, and the present invention is not limited to the following examples. Variations and points that may occur to those skilled in the art are included in the invention without departing from the spirit and scope of the inventive concept.
The methods, reagents and the like used in the embodiments are, unless otherwise specified, conventional in the art or may be directly purchased.
Example 1 construction of Standard ITS2 Bar code database of rhizoma Atractylodis and ITS easily-mixed counterfeit
1. Sample of standard ITS2 bar code database of Chinese medicinal material rhizoma atractylodis and easily-mixed counterfeit thereof
67 parts of rhizoma atractylodis serving as a traditional Chinese medicine and an easily-mixed counterfeit raw plant and medicinal material sample are collected together for constructing a standard ITS2 bar code database of the rhizoma atractylodis serving as the traditional Chinese medicine and the easily-mixed counterfeit thereof. The contrast medicinal material samples of rhizoma atractylodis and rhizoma atractylodis macrocephalae purchased from Chinese medicinal biological product certification are respectively 1 part and 2 parts in total. 65 parts of original plant samples identified by authoritative morphological experts are collected from the main producing area and the main distribution area of the traditional Chinese medicine rhizoma atractylodis, wherein the rhizoma atractylodis atratylodes lancea (Thunb.) DC. original plant samples 13 parts, the Korean rhizoma atractylodis atratylodes Koreana (Nakai) Kitamura original plant samples 20 parts, the rhizoma atractylodis atratylodes macrocephala Koidz original plant samples 32 parts, the original plant samples are identified by professor Chunyang of Chinese medicine research institute of Chengde medical institute, and the samples are stored in a focus laboratory of Chinese medicine research and development of Hezhou province of Chinese medicine research institute of Chengde medical institute.
2. Construction method of standard ITS2 bar code database of traditional Chinese medicine rhizoma atractylodis and easily-mixed counterfeit thereof
According to the Chinese medicinal material DNA barcode molecule identification guiding principle, ITS2 sequences of the 67 samples are obtained through DNA extraction, PCR amplification, bidirectional sequencing and sequence splicing, after quality evaluation and sequence checking, the 67 sequences are stored as a sequence database in a Fasta format, and then a BLAST software is used for generating a formatted BLAST database.
3. Standard ITS2 bar code database characteristic of Chinese herbal medicine rhizoma atractylodis and easily-mixed counterfeit thereof
The database sequences are derived from 2 parts of a Chinese medicinal material biological product verification institute reference medicinal material sample and 65 parts of an original plant sample identified by a morphological expert, in order to reduce the redundancy of the database, completely consistent sequences are combined and sequenced according to the sequence richness, so that 19 standard ITS2 barcodes of Chinese medicinal materials rhizoma atractylodis and easily-mixed counterfeit products thereof are obtained, the sequence length is 229bp, and the standard ITS2 barcode of the Korean rhizoma atractylodis is 9: atraftylodes _ koreana _ H01(SEQ ID No.1), Atraftylodes _ koreana _ H02(SEQ ID No.2), Atraftylodes _ koreana _ H03(SEQ ID No.3), Atraftylodes _ koreana _ H04(SEQ ID No.4), Atraftylodes _ koreana _ H05(SEQ ID No.5), Atraftylodes _ koreana _ H06(SEQ ID No.6), Atraftylodes _ koreana _ H07(SEQ ID No.7), Atraftylodes _ koreana _ H08(SEQ ID No.8), Atraftylodes _ koreana _ H09(SEQ ID No.9), average intraspecies genetic distance 0.0051, maximum within species genetic distance 0.0132, average intervarietal distance 0.0132, Atractylodes macrocephala minimum species genetic distance, and Atractylodes macrocephala minimum intraspecies average genetic distance 010. 0.0230; atractylodes standard ITS2 bar code 7 bars: atraftylodes _ lancea _ H01(SEQ ID No.10), Atraftylodes _ lancea _ H02(SEQ ID No.11), Atraftylodes _ lancea _ H03(SEQ ID No.12), Atraftylodes _ lancea _ H04(SEQ ID No.13), Atraftylodes _ lancea _ H05(SEQ ID No.14), Atraftylodes _ lancea _ H06(SEQ ID No.15), Atraftylodes _ lancea _ H07(SEQ ID No.16), intra-species average genetic distance of 0.0053, intra-species maximum genetic distance of 0.0088, inter-species minimum genetic distance of 0.0177, inter-species average genetic distance of 0.0235 compared to Atractylodes lancea and Atractylodes macrocephala; the white Atractylodes standard ITS2 barcode 4 strips, Atractylodes _ macrophala _ H01(SEQ ID No.17), Atractylodes _ macrophala _ H02(SEQ ID No.18), Atractylodes _ macrophala _ H03(SEQ ID No.19), average interspecific genetic distance of 0.0017, and maximum interspecific genetic distance of 0.0044, compared with Atractylodes koreana and Atractylodes lancea, minimum interspecific genetic distance of 0.0178, and average interspecific genetic distance of 0.0254.
From the NJ adjacency tree (as shown in fig. 1): the Korean atractylodes rhizome, the atractylodes rhizome and the white atractylodes rhizome are homopolymerized into independent branches, have high support rate and can be distinguished from each other.
Example 2 identification of authenticity of rhizoma atractylodis seedling by using standard ITS2 barcode database of rhizoma atractylodis and ITS easily-mixed counterfeit
1. In order to investigate the species source condition of the rhizoma atractylodis seedling for production, 52 parts of rhizoma atractylodis seedlings are collected from the main production place of the traditional Chinese medicine rhizoma atractylodis in the research, the rhizoma atractylodis seedlings lack complete plant morphological characteristics and are difficult to identify by a morphological method, and a DNA bar code technology is adopted for identification in the research. The numbers and production site information of the seedling experimental samples are shown in table 1.
TABLE 1 Nursery stock experimental sample number and producing area information
2. DNA extraction, PCR amplification, sequence determination and sequence splicing
DNA extraction: and (3) quickly transporting the collected 52 parts of rhizoma atractylodis seedling living bodies to a laboratory, removing silt in the laboratory, cleaning, and completely drying in a 40 ℃ oven. Taking 20-30 mg of dried rhizoma atractylodis seedlings, grinding for 2min (30 times/s) by using a DNA extraction grinder (Retsch MM400, Germany), and extracting total DNA by using a plant DNA extraction kit (Tiangen Biochemical technology (Beijing) Co., Ltd.). DNA concentration and mass were determined using a NanoDrop 2000(ThermoFisher Scientific, USA).
And (3) PCR amplification: PCR amplification is carried out according to the guiding principle of DNA barcode molecular identification of traditional Chinese medicinal materials. ITS2 sequence amplification forward primer ITS2F:5'-ATGCGATACTTGGTGTGAAT-3' (SEQ ID No. 20); the reverse primer ITS3R:5'-GACGCTTCTCCAGACTACAAT-3' (SEQ ID No. 21). Amplification system (25 μ L): PCR mix 12.5. mu.L, forward and reverse primers 1. mu.L each, template 2. mu.L, ddH2O8.5. mu.L. The ITS2 sequence amplification program comprises pre-denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 45s for 40 cycles; extension at 72 ℃ for 10 min.
And (3) sequence determination: the sequence determination method is carried out according to the Chinese medicinal material DNA bar code molecular identification guiding principle, and specifically comprises the following steps: the PCR product was purified and subjected to two-way sequencing using ABI 3730XL sequencer (ThermoFisher Scientific, USA), and the quality of the sequencing peak was judged according to the guidelines for molecular identification of DNA barcodes of Chinese herbs and the guidelines of the Plant Working group of the International DNA barcode Association (e.g., 1, National Committee, pharmacopoeia of the people's republic of China, 2015 edition, four parts, Beijing: Chinese pharmaceutical science and technology Press, 2015.383-385.; 2, Vaseline, Yaohui, Hanjianping, etc., the guidelines for molecular identification of DNA barcodes of Chinese herbs, J, China 2013,38(2), 141-148.; 3, CBOL Plant work group. A DNA code for land plants, proceedings of the National Academy of Sciences USA,2009,106, 12797.).
And (3) sequence splicing: sequencing peak plots low-quality regions were removed, aligned for splicing, and primer sequence excision using CodonCode Aligner V7.0.1(CodonCode Co., USA); the ITS2 sequence was obtained based on a Hidden Markov model (Hidden Markov model) using HMMER v3.1 software to remove the 5.8S rRNA and 28S rRNA sections.
The DNA of 52 rhizoma atractylodis seedling samples obtained by the method has high quality and the DNA concentration is more than 100 ng.mu.L-1，A260/A280The sequences are all between 1.7 and 2.0, PCR amplification, sequence determination and sequence splicing can be successfully carried out, the conserved sequence of a 5.8S rRNA region is CGAGGGCACGTCTGCCT GGGCGT CA, the conserved sequence of a 28S rRNA region is CGACCCCAGGTCAGGCGGGACTACC, 5.8S rRNA and 28S rRNA segments can be successfully removed by HMMER v3.1b2 software based on a hidden Markov model to obtain an ITS2 sequence, and the length of the ITS2 sequence is 229 bp.
3. Identification of rhizoma atractylodis germchit primitive species based on ITS2 sequence
And identifying rhizoma atractylodis seedling experimental samples by using genetic distance calculation, NJ adjacent tree construction or BLAST. Wherein, the pretreatment steps of genetic distance calculation and NJ phylogenetic tree construction are firstly carried out, namely, multisequence comparison is carried out by utilizing muscle 3.8; then calculating the genetic distance between the seeds by using PUAP 4.0 software; constructing an NJ adjacent tree by using MEGA 7.0; BLAST identification was performed using NCBI BLAST 2.6.0.
3.1 identification based on genetic distance comparison method
The obtained 52 ITS2 sequences are respectively compared with the genetic distance of the standard ITS2 bar code in the standard ITS2 bar code database of the Chinese medicinal material rhizoma atractylodis and the easily mixed counterfeit product obtained in the example 1, and the specific parameters are as follows: a Variance Estimation Method, Bootstrap Method; no. of Bootstrap Replications 1000; Model/Method: kimura 2-parameter model; Gaps/Missing Data Treatment: pairwise delay.
Taking the seedling experimental sample SCZ006 as an example, the genetic distance between the sample and the standard ITS2 barcode in the database is shown in fig. 2. The identification results of all seedling experimental samples based on the genetic distance comparison method are shown in table 2.
TABLE 2 identification results based on genetic distance comparison method
3.2 identification based on NJ phylogenetic Tree construction method
The obtained 52 ITS2 sequences are respectively combined with the standard ITS2 barcode in the standard ITS2 barcode database of the Chinese medicinal material rhizoma atractylodis and the easily-mixed counterfeit product obtained in the example 1 to construct an NJ phylogenetic tree, and the specific parameters are as follows: test of phenyl, Bootstrap method; no. of Bootstrap Replication: 1000, parts by weight; Model/Method: kimura 2-parameter model; Gaps/Missing Data Treatment: pairwise delay.
Taking the seedling experimental sample SCZ006 as an example, the sample and the NJ phylogenetic tree of the standard ITS2 barcode in the database are shown in fig. 3. The results of the identification of all experimental germchit samples based on the NJ phylogenetic tree method are shown in Table 3.
TABLE 3 identification results based on NJ phylogenetic tree construction method
3.3 identification based on the BLAST alignment method
The 52 ITS2 sequences obtained were BLAST-aligned with the standard ITS2 barcode in the "Standard ITS2 barcode database of Atractylodes lancea and other easily-confused artifacts" obtained in example 1.
Taking the seedling experimental sample SCZ006 as an example, the BLAST comparison result of the sample with the standard ITS2 barcode in the database is shown in fig. 4. The identification results of all seedling experimental samples based on the BLAST alignment method are shown in Table 4.
TABLE 4 identification based on BLAST alignment method
Sequence listing
<110> Chengde medical college; institute of medicinal plants of the Chinese academy of medical sciences; harbin market food and drug inspection and detection center
<120> Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology
<160> 21
<170> PatentIn version 3.3
<210> 1
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 1
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgacg cttcgaccg 229
<210> 2
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 2
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcatc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgatg cttcgaccg 229
<210> 3
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 3
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccgcaa cgcgtcgcct cacgacgacg cttcgaccg 229
<210> 4
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 4
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcatc gggggcggag 60
attggtctcc cgtgcccacg gcacggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgatg cttcgaccg 229
<210> 5
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 5
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct caagacgacg cttcgaccg 229
<210> 6
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 6
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgatg cttcgaccg 229
<210> 7
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 7
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgacg cttcgaccg 229
<210> 8
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 8
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcatc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggacctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgatg cttcgaccg 229
<210> 9
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 9
cgcatcgtgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgacg cttcgaccg 229
<210> 10
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 10
cgcatcgcgt cgcccccaac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 11
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 11
cgcatcgcgt cgcccccaac cacgcctccc ccatggggac gcgtgtcgtc ggggacggag 60
attggtctcc cgtgcccacg gtacggttgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 12
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 12
cgcatcgcgt cgcccccaac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtacggttgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgtgtcgcct cgcgacgacg cttcgaccg 229
<210> 13
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 13
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgtgtcgcct cgcgacgacg cttcgaccg 229
<210> 14
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 14
cgcatcgcgt cgcccccaac catgcctccc ccacggggat gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 15
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 15
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc ggggacggag 60
attggtctcc cgtgcccacg gtacggttgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 16
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 16
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtgcggttgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 17
<211> 229
<212> DNA
<213> Atractylodes macrocephala
<400> 17
cgcatcgcgt cgcccccgac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaacggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta ttgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct tgcgacgacg cttcgaccg 229
<210> 18
<211> 229
<212> DNA
<213> Atractylodes macrocephala
<400> 18
cgcatcgcgt cgcccccgac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaacggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta ttgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 19
<211> 229
<212> DNA
<213> Atractylodes macrocephala
<400> 19
cgcatcgcgt cgcccccgac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaccgg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta ttgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct tgcgacgacg cttcgaccg 229
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> ITS2F
<400> 20
atgcgatact tggtgtgaat 20
<210> 21
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> ITS3R
<400> 21
gacgcttctc cagactacaa t 21
Claims (3)
1. A traditional Chinese medicine rhizoma atractylodis germchit identification method based on a DNA bar code technology is characterized in that a standard ITS2 bar code database of a traditional Chinese medicine rhizoma atractylodis and easily-mixed counterfeit products thereof is provided, and the truth of the traditional Chinese medicine rhizoma atractylodis germchit is identified by carrying out BLAST comparison on an ITS2 sequence of a sample to be identified and a sequence in the standard ITS2 bar code database; the easily-mixed counterfeit Chinese medicinal material rhizoma Atractylodis is Korean rhizoma Atractylodis and Atractylodis rhizoma;
the standard ITS2 barcode database is provided with rhizoma atractylodisAtractylodes lancea(Thunberg) Candolle, Atractylodes koreanaAtractylodes Koreana(Nakai) Kitamura, Largehead Atractylodes rhizomeAtractylodes macrocephalaStandard ITS2 barcode by koidz;
wherein the standard ITS2 barcode sequence of rhizoma Atractylodis is 7, and the sequence is shown in SEQ ID number 10-16; the standard ITS2 barcode sequence of the Atractylodes koreana is 9, and the sequence is shown as SEQ ID number 1-9; the standard ITS2 barcode sequence of the bighead atractylodes rhizome is 3, and the sequence is shown in SEQ ID number 17-19; the standard ITS2 barcode sequences of atractylodes, atractylodes koraiensis and atractylodes macrocephala were sorted according to sequence abundance, respectively.
2. The method for identifying the seedlings of the traditional Chinese medicine rhizoma atractylodis based on the DNA barcode technology as claimed in claim 1, wherein the method comprises the following steps:
1) preprocessing a sample to be identified, extracting DNA of the sample to be identified, and performing PCR amplification, sequence determination and splicing to obtain an ITS2 sequence of the sample to be identified;
2) and comparing the ITS2 sequence of the sample to be identified with the standard ITS2 bar code in the standard ITS2 bar code database of the traditional Chinese medicine rhizoma atractylodis and the easily-mixed counterfeit thereof, thereby determining the authenticity of the sample to be identified.
3. A standard ITS2 bar code combination for identifying Chinese medicinal material rhizoma Atractylodis seedling is characterized in that,
the standard ITS2 barcode sequence of the rhizoma atractylodis is 7, and the sequence is shown as SEQ ID number 10-16; the standard ITS2 barcode sequence of the Atractylodes koreana is 9, and the sequence is shown as SEQ ID number 1-9; the standard ITS2 barcode sequence of the bighead atractylodes rhizome is 3, and the sequence is shown in SEQ ID number 17-19; the standard ITS2 barcode sequences of Atractylodes lancea, Atractylodes koreana and Atractylodes macrocephala are respectively sorted according to sequence abundance; the easily-mixed counterfeit Chinese medicinal material rhizoma Atractylodis is Korean rhizoma Atractylodis and Atractylodis rhizoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710696645.7A CN107254544B (en) | 2017-08-15 | 2017-08-15 | Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710696645.7A CN107254544B (en) | 2017-08-15 | 2017-08-15 | Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107254544A CN107254544A (en) | 2017-10-17 |
| CN107254544B true CN107254544B (en) | 2021-11-05 |
Family
ID=60026754
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710696645.7A Active CN107254544B (en) | 2017-08-15 | 2017-08-15 | Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107254544B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107541521B (en) * | 2017-10-19 | 2018-08-31 | 中国科学院昆明植物研究所 | A kind of identification method of radix coniti coreani DNA bar code and radix coniti coreani based on big data |
| CN110747290B (en) * | 2019-11-29 | 2022-05-17 | 中国医学科学院药用植物研究所 | ITS2 sequence amplification universal primer, method for identifying traditional Chinese medicinal materials and kit |
-
2017
- 2017-08-15 CN CN201710696645.7A patent/CN107254544B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| 中药材DNA条形码分子鉴定指导原则;陈士林等;《中国中药杂志》;20130131;第38卷(第2期);第141页右栏第4段至第142页右栏第7段 * |
| 基于ITS2序列的茅苍术及其近缘种DNA分子鉴定;邵婧等;《中草药》;20150430;第46卷(第8期);第1209-1215页 * |
| 白术与苍术及其混伪品DNA条形码鉴定研究;余亚东等;《中国中药杂志》;20140630;第39卷(第12期);第2194页右栏第3段至第2195页右栏第3段、第2197页右栏第1段以及表1 * |
| 白术和苍术的鉴定研究;高岩等;《中国医药指南》;20160620;第14卷(第17期);第30、32页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107254544A (en) | 2017-10-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wilson | Phylogeny of Iris based on chloroplast matK gene and trnK intron sequence data | |
| Boršić et al. | Centaurea sect. Cyanus: nuclear phylogeny, biogeography, and life-form evolution | |
| CN103484558B (en) | Molecular identification method of Yunnan manyleaf Paris rhizome | |
| CN106011228A (en) | EST-SSR core primer group for identifying variety of Chinese wolfberry and identification method and application thereof | |
| CN107254544B (en) | Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology | |
| CN105838785B (en) | SSR molecular marker and application with sesame black seed coat gene close linkage | |
| Moore et al. | Phylogeny, biogeography, and chromosome evolution of the amphitropical genus Grindelia (Asteraceae) inferred from nuclear ribosomal and chloroplast sequence data | |
| Deniz et al. | Morphological and molecular data reveal a new species of Allium (Amaryllidaceae) from SW Anatolia, Turkey | |
| Punina et al. | Polymorphic sites in transcribed spacers of 35S rRNA genes as an indicator of origin of the Paeonia cultivars | |
| Singh et al. | Morphological and genetic diversity analysis of Citrullus landraces from India and their genetic inter relationship with continental watermelons | |
| CN108179200A (en) | A kind of microsatellite marker and application with the Procambius clarkii prolificacy linkage of characters | |
| CN108754018B (en) | Screening method and application of acanthopanax senticosus target gene SSR molecular marker | |
| CN107630102B (en) | PCR identification kit and identification method for radix paeoniae alba | |
| El-Banhawy et al. | DNA barcoding and phylogeny of Phlomis aurea (Lamiaceae) endemic to Sinai Peninsula, Egypt | |
| Zheng et al. | Molecular authentication of medicinal and edible plant Gnaphalium affine (cudweed herb,“Shu-qu-cao”) based on DNA barcode marker ITS2 | |
| CN114540205B (en) | Armillariella mellea strain and application thereof | |
| Kim et al. | Morphological characteristics and phylogenetic analysis of Polygonatum species based on chloroplast DNA sequences | |
| Park et al. | Plastid phylogenomic data offers novel insights into the taxonomic status of the Trichosanthes kirilowii complex (Cucurbitaceae) in south Korea | |
| Hantemirova et al. | Genetic differentiation and phylogenetic relationships of Glycyrrhiza glabra L., G. uralensis Fisch., and G. korshinskyi Grig. inferred from chloroplast DNA variation | |
| Floden | Molecular phylogenetic studies of the genera of tribe Polygonateae (Asparagaceae: Nolinoideae): Disporopsis, Heteropolygonatum, and Polygonatum. | |
| Fan et al. | Endangered Uyghur medicinal plant Ferula identification through the second internal transcribed spacer | |
| Riahi Rad et al. | Phylogenetic affinities of wild and cultivated Ornithogaloideae based on ITS and trnL–F DNA sequences by extended sampling from Iran | |
| CN105420365A (en) | Molecular method capable of identifying gynaikothrips ficorum and gynairothrips uzeli zimmerman | |
| He et al. | Classification of Chinese medicinal tree peony cultivars based on chloroplast DNA sequences | |
| Nazre et al. | Phylogenetic relationships of locally cultivated Garcinia species with some wild relatives |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |