CN107254544A - A kind of Chinese medicine rhizoma atractylodis seedling authentication method based on DNA bar code technology - Google Patents
A kind of Chinese medicine rhizoma atractylodis seedling authentication method based on DNA bar code technology Download PDFInfo
- Publication number
- CN107254544A CN107254544A CN201710696645.7A CN201710696645A CN107254544A CN 107254544 A CN107254544 A CN 107254544A CN 201710696645 A CN201710696645 A CN 201710696645A CN 107254544 A CN107254544 A CN 107254544A
- Authority
- CN
- China
- Prior art keywords
- rhizoma atractylodis
- its2
- standard
- bar code
- chinese medicine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Chinese medicine rhizoma atractylodis seedling authentication method based on DNA bar code technology, it this method provide the standard ITS2 bar code datas storehouse of Chinese medicine rhizoma atractylodis and its easily mixed adulterant, by the way that the ITS2 sequences of sample to be identified are compared with the sequence in the standard ITS2 bar code datas storehouse, to differentiate the Chinese medicine rhizoma atractylodis seedling true and false.The method of the present invention can fast and effectively identify rhizoma atractylodis seedling and its easily mixed adulterant seedling, ensure the security of Chinese medicine rhizoma atractylodis production from source.
Description
Technical field
The present invention relates to Materia Medica Identification method, and in particular to a kind of Chinese medicine rhizoma atractylodis kind based on DNA bar code technology
Seedling authentication method.
Background technology
Recorded according to 2015 editions Chinese Pharmacopoeias, rhizoma atractylodis are feverfew Atractylis lancea Atractylodes lancea (Thunb.)
DC. or Atractylis chinensis Atractylodes chinensis (DC.) Koidz. dry root, English edition flora (《Flora of
China》) Atractylis lancea and Atractylis chinensis are changed to rhizoma atractylodis Atractylodes lancea (Thunberg) Candolle.Rhizoma atractylodis
Pungent, hardship, temperature.Returns spleen, stomach, Liver Channel.It is drying damp and strengthening spleen, expelling wind and clearing away cold, improving eyesight.For damp retention in middle-jiao, abdominal fullness and distention, diarrhea, oedema,
Tinea pedis Wei lame, arthralgia pain due to rheumatism, anemofrigid cold, yctalopia, eyes dusk is puckery.The volatile oil components such as Atisine chloride Atractydin are considered as the main of rhizoma atractylodis
Pharmacological component, modern pharmacological research show rhizoma atractylodis have gastric acid secretion inhibiting, anti-arrhythmia, antibacterial anti-inflammatory, it is hypoglycemic,
Anti anoxia etc. is acted on.Rhizoma atractylodis are the important components of the well-known Chinese patent drug such as HuoXiangZhengQiShui, ruyi jinhuang powder, ruyi jinhuang san, guogong wine, and resource is needed
The amount of asking is big, and natural crude drugs are in imminent danger and exhaustion, and cultivating and growing scale gradually expands, and the ground such as Hubei, Jiangsu, the Inner Mongol, Hebei is
Its medicinal material main product.Rhizoma atractylodis cultivation have seedling (division propagation, Propagation of Rhizomes) and seminal propagation two ways, using sapling multiplication as
It is main.In recent years, as rhizoma atractylodis price is high, the cultivated area of rhizoma atractylodis constantly expands, and the certified products rhizoma atractylodis seedling source of goods is limited, rhizoma atractylodis kind
Seedling is adulterated to happen occasionally.
China still lacks the breeding production management specification similar with crop seeds., state food medicine prison in 2013
Superintend and direct and point out " uniformly to set up seed seedling and breed base in the departments such as management general bureau " notice on further strengthening Chinese medicine management "
Ground ".But current Chinese medicine seed seedling is still based on marketing one's own products, and seed seedling quality is uneven, particularly wild resource
It is in short supply, the high traditional Chinese medicinal materials assortment of market value, it has also become seed seedling mixes the severely afflicated area of puppet.Continue recently as rhizoma atractylodis price
High, wild resource is petered out, but rhizoma atractylodis " wild change man plants " technology not yet full maturity, and Atractylis chinensis itself seedling yield has
Limit, the seedling of field acquisition is insufficient for plantation demand, and a great deal of seedling cultivates more long the Northeast purchased from rhizoma atractylodis, and
Northeast rhizoma atractylodis cultivated species result in the chaotic feelings of current rhizoma atractylodis seedling based on local custom articles for use atractylodes japonica and Atractylodes koreana
Condition.
DNA bar code technology carries out species identification using the short sequence of one section of general standard in genome, independent of identification
The morphological feature of object, is not influenceed by identification object growth and development stage, is seed seedling authentication method emerging in recent years,
The identification research of several kinds of Chinese medicinal materials seed seedling has been applied to.Currently, most Chinese medicine wild resource wretched insufficiencies, Chinese medicine people
Work cultivating and growing is the important channel for ensureing Chinese medicine safety.Chinese medicine seed seedling is the source of Chinese medicine cultivating and growing how
It is correctly the basic premise of Producing medicinal herbs to ensure Chinese medicine seed seedling base species, and Chinese medicine seed seedling identification mistake must
Chinese medicine can so be buried and mix the hidden danger that adulterant floods market.Traditional Chinese medicine seed seedling authentication method is with seed seedling form
Foundation is characterized as, the microscopic feature of seed seedling is recognized by instruments such as magnifying glass, Stereo microscopes, the specialty to assessor is known
Knowledge requires high, and is easily influenceed by Chinese medicine seed seedling maturity, preservation state, population difference, subjective.DNA bars
Shape code technology is studied from the gene aspect of Chinese medicine seed seedling, and species area is carried out by the difference in comparison dna sequence
Divide identification, do not limited by sample morphology feature, qualification result is more accurately and reliably.The Chinese medicines such as completed notopterygium root, rhizoma alismatis, Paris polyphylla
Assortment, seedling DNA bar code identification research show：DNA bar code technology is to finding that adulterant is mixed in Chinese medicine seed seedling market
It is the authenticity for ensureing Chinese medicine seed seedling from source, it is to avoid economic loss with unique advantage, ensures Producing medicinal herbs peace
It is complete significant.
Therefore, those skilled in the art are directed to developing a kind of Chinese medicine rhizoma atractylodis seedling mirror based on DNA bar code technology
Determine method and the standard ITS2 bar code datas storehouse identified for Chinese medicine rhizoma atractylodis seedling.
The content of the invention
Traditionally, Chinese medicine rhizoma atractylodis (Atractylodis Rhizoma) seedling relies on the formalness and Interior Solutions of seedling
Cut open feature to be identified, due to the initial period that seedling is plant growth, still lack needed for the morphological taxonomies such as flower, fruit are identified
Characteristic feature, it is difficult to precise Identification to species.In recent years because Chinese medicine rhizoma atractylodis caused by identification error introduce a fine variety mistake not only band
Carry out huge economic loss, also result in potential clinical application security risk.In order to overcome drawbacks described above, the present invention is provided
A kind of Chinese medicine rhizoma atractylodis seedling authentication method based on DNA bar code technology, having broken away from conventional identification method, to rely on form special
The obstacle levied, it is objective, accurate to identify.
In the specific embodiment of the present invention, Chinese medicine rhizoma atractylodis (Atractylodis this method provide
Rhizoma) and its easily mixed adulterant standard ITS2 bar code datas storehouse, by by the ITS2 sequences of sample to be identified and the mark
Sequence in quasi- ITS2 bar code datas storehouse is compared, to differentiate the Chinese medicine rhizoma atractylodis seedling true and false.
Further, the standard ITS2 bar code datas storehouse has rhizoma atractylodis (Atractylodes lancea
(Thunberg) Candolle), Atractylodes koreana (Atractylodes Koreana (Nakai) Kitamura), the bighead atractylodes rhizome
The standard ITS2 bar codes of (Atractylodes macrocephala Koidz.).
Further, the standard ITS2 bar codes of the rhizoma atractylodis are 7, and its sequence is as shown in SEQ ID No.10-16；Institute
The standard ITS2 bar codes for stating Atractylodes koreana are 9, and its sequence is as shown in SEQ ID No.1-9；The standard ITS2 of the bighead atractylodes rhizome
Bar code is 3, and its sequence is as shown in SEQ ID No.17-19.
Further, methods described includes：
1) sample pre-treatments to be identified, the DNA of extraction sample to be identified, performing PCR of going forward side by side amplification, sequencing and splicing,
Obtain the ITS2 sequences of sample to be identified；
2) the standard ITS2 bars of adulterant are mixed by the ITS2 sequences of the sample to be identified and the Chinese medicine rhizoma atractylodis and its easily
Standard ITS2 bar codes in code data storehouse are compared, so that it is determined that the true and false of sample to be identified.
Further, step 2) in, by by the ITS2 sequences of the sample to be identified and the Chinese medicine rhizoma atractylodis and its
Standard ITS2 bar codes in the standard ITS2 bar code datas storehouse of easily mixed adulterant carry out NJ adjoining trees build, BLAST compare and
One or more in genetic distance calculating relatively, to determine the true and false of sample to be identified.
Further, the easily mixed adulterant of the rhizoma atractylodis is Atractylodes koreana and the bighead atractylodes rhizome.
The opposing party of the present invention provides a kind of standard ITS2 bar code datas storehouse identified for Chinese medicine rhizoma atractylodis seedling,
In a detailed embodiment, its standard ITS2 bar code with rhizoma atractylodis, Atractylodes koreana, the bighead atractylodes rhizome.
Further, the standard ITS2 bar code sequences of rhizoma atractylodis are 7, and its sequence is as shown in SEQ ID No.10-16；Institute
The standard ITS2 bar code sequences for stating Atractylodes koreana are 9, and its sequence is as shown in SEQ ID No.1-9；The standard of the bighead atractylodes rhizome
ITS2 bar code sequences are 3, and its sequence is as shown in SEQ ID No.17-19.
This research using ITS2 sequences as bar code, by collect Nat'l Pharmaceutical ＆ Biological Products Control Institute's control medicinal material sample and
The former plant sample of authoritative form expert appraisal builds Chinese medicine rhizoma atractylodis and its easily mixed product standard ITS2 bar code datas storehouse, by will
Sample to be identified is compared with the standard ITS2 bar codes in the database, so that it is determined that the true and false of rhizoma atractylodis seedling, finally builds
The Chinese medicine rhizoma atractylodis seedling new Identification Method of the DNA bar code that is based on technology.Due to setting up standard ITS2 bar code data places
The high degree of accuracy and larger radix of the medicinal material sample used so that standard ITS2 bar codes covering in the database is wide,
Accuracy is high, improves the follow-up accuracy identified Chinese medicine rhizoma atractylodis seedling.
The chemical composition of Atractylodes koreana and rhizoma atractylodis is had differences, with different pharmacological activity, and Chinese medicine rhizoma atractylodis were cultivated
Atractylodes koreana seedling is introduced in journey the clinical practice to rhizoma atractylodis medicinal material market and rhizoma atractylodis is brought into potential security risk.And pass through
Method of the invention, it is possible to fast and effectively identify the seedling of rhizoma atractylodis seedling and its easily mixed adulterant, it is ensured that the safety of Chinese medicine
Property.
The seedling that DNA bar code application expands to Producing medicinal herbs is identified field, certified sample by the present invention
It is the seedling of Chinese medicine rhizoma atractylodis；And establish the experiment for rhizoma atractylodis seedling and data analysis process.The invention provides more
Comprehensively, more accurately rhizoma atractylodis and its mixed adulterant sequence information, are to the abundant and complete of present " Chinese herbal medicine DNA bar code database "
It is kind.
Brief description of the drawings
Fig. 1 is the standard ITS2 bar shapeds based on Chinese medicine rhizoma atractylodis and its in the standard ITS2 bar code datas storehouse of easily mixed adulterant
The NJ adjoining trees that code is built.
Fig. 2 is the seedling laboratory sample SCZ006 to be identified and the standard ITS2 bars in database of one embodiment of the invention
The genetic distance table of shape code.
Fig. 3 is the seedling laboratory sample SCZ006 to be identified and the standard ITS2 bars in database of one embodiment of the invention
The NJ phylogenetic trees of shape code.
Fig. 4 is the seedling laboratory sample SCZ006 and the standard ITS2 bar codes in database of one embodiment of the invention
BLAST comparison results.
Embodiment
Below with reference to embodiment and accompanying drawing, the present invention is described in further detail, protection of the invention
Content is not limited to following examples.Under the spirit and scope without departing substantially from inventive concept, those skilled in the art it is conceivable that
Change and main points be all included in the present invention.
Method, reagent for being used in embodiment etc., if being this area conventional method or can be straight without specified otherwise
Purchase is connect to obtain.
The structure in the standard ITS2 bar code datas storehouse of the Chinese medicine rhizoma atractylodis of embodiment 1 and its easily mixed adulterant
1st, the sample in the standard ITS2 bar code datas storehouse of Chinese medicine rhizoma atractylodis and its easily mixed adulterant
To build the standard ITS2 bar code datas storehouse of Chinese medicine rhizoma atractylodis and its easily mixed adulterant, 67 parts of Chinese medicines are collected altogether grey
Art and its easily mixed former plant of adulterant and medicinal material sample.Rhizoma atractylodis and bighead atractylodes rhizome control medicinal material are bought from Nat'l Pharmaceutical ＆ Biological Products Control Institute
Each 1 part, totally 2 parts of sample.From Chinese medicine rhizoma atractylodis main product and main distributed area former planting of collecting through authoritative morphology expert appraisal
65 parts of thing sample, wherein rhizoma atractylodis Atractylodes lancea (Thunb.) DC. 13 parts of plant sample of original, Atractylodes koreana
Atractylodes Koreana (Nakai) Kitamura 20 parts of plant samples of original, bighead atractylodes rhizome Atractylodes
Macrocephala Koidz. 32 parts of plant samples of original, former plant sample is taught by Traditional Chinese Medicine Inst., Chengde Medical College Zhao Chun grain husks
Identification is awarded, sample deposits in research and develope of TCD key lab of Hebei province of Traditional Chinese Medicine Inst., Chengde Medical College.
2nd, the construction method in the standard ITS2 bar code datas storehouse of Chinese medicine rhizoma atractylodis and its easily mixed adulterant
According to Chinese medicine DNA bar code Molecular Identification guideline, extracted through DNA, PCR amplifications, two-way sequencing and sequence
Splicing obtains the ITS2 sequences of 67 parts of samples above, and through quality evaluation and Sequence kernel to after, 67 sequences are saved as into Fasta lattice
The sequence library of formula, and then format BLAST databases using BLAST Software Creates.
3rd, Chinese medicine rhizoma atractylodis and its standard ITS2 bar code data planting modes on sink characteristic of easily mixed adulterant
Database sequence reflects from 2 parts of Nat'l Pharmaceutical ＆ Biological Products Control Institute's control medicinal material sample and through morphology expert
65 parts of fixed former plant sample, to reduce the redundancy of database, completely the same sequence is merged, and according to sequence richness
It is ranked up, the standard ITS2 bar codes of 19 Chinese medicine rhizoma atractylodis and its easily mixed adulterant is obtained altogether, sequence length is 229bp,
Wherein Atractylodes koreana standard ITS2 bar codes 9：Atractylodes_koreana_H01(SEQ ID No.1)、
Atractylodes_koreana_H02(SEQ ID No.2)、Atractylodes_koreana_H03(SEQ ID No.3)、
Atractylodes_koreana_H04(SEQ ID No.4)、Atractylodes_koreana_H05(SEQ ID No.5)、
Atractylodes_koreana_H06(SEQ ID No.6)、Atractylodes_koreana_H07(SEQ ID No.7)、
Atractylodes_koreana_H08 (SEQ ID No.8), Atractylodes_koreana_H09 (SEQ ID No.9),
Average genetic 0.0051 in kind, plant in greatest genetic distance 0.0132, compared with the bighead atractylodes rhizome, rhizoma atractylodis, the minimum heredity of inter-species away from
From 0.0177, inter-species average genetic 0.0230；Rhizoma atractylodis standard ITS2 bar codes 7：Atractylodes_lancea_H01
(SEQ ID No.10)、Atractylodes_lancea_H02(SEQ ID No.11)、Atractylodes_lancea_H03
(SEQ ID No.12)、Atractylodes_lancea_H04(SEQ ID No.13)、Atractylodes_lancea_H05
(SEQ ID No.14)、Atractylodes_lancea_H06(SEQ ID No.15)、Atractylodes_lancea_H07
(SEQ ID No.16), plants interior average genetic 0.0053, interior greatest genetic distance 0.0088 is planted, with Atractylodes koreana, the bighead atractylodes rhizome
Compare, inter-species minimum genetic distance 0.0177, inter-species average genetic 0.0235；Bighead atractylodes rhizome standard ITS2 bar codes 4,
Atractylodes_macrocephala_H01(SEQ ID No.17)、Atractylodes_macrocephala_H02(SEQ
ID No.18), Atractylodes_macrocephala_H03 (SEQ ID No.19), plant in average genetic 0.0017,
Greatest genetic distance 0.0044 in kind, compared with Atractylodes koreana, rhizoma atractylodis, inter-species minimum genetic distance 0.0178, inter-species is averagely lost
Pass distance 0.0254.
From NJ adjoining trees (as shown in Figure 1)：Atractylodes koreana, rhizoma atractylodis, bighead atractylodes rhizome homopolymerization are independent branch, with higher
Supporting rate, can mutually be distinguished.
Using Chinese medicine rhizoma atractylodis and its easily, the standard ITS2 bar code datas storehouse of mixed adulterant differentiates Chinese medicine rhizoma atractylodis to embodiment 2
The seedling true and false
1st, seedling laboratory sample is investigates the source of species situation of rhizoma atractylodis production seedling, and this research is from Chinese medicine rhizoma atractylodis master
52 parts of rhizoma atractylodis seedling is collected in the place of production, because rhizoma atractylodis seedling lacks full plants morphological feature, it is difficult to using morphological method identification,
This research will be identified using DNA bar code technology.The numbering and place of production information of seedling laboratory sample are as shown in table 1.
The numbering and place of production information of the seedling laboratory sample of table 1
2nd, DNA extractions, PCR amplifications, sequencing, sequence assembly
DNA is extracted：By 52 parts of collected rhizoma atractylodis seedling live body fast transportations to laboratory, silt is removed in laboratory,
Clean up, be placed in 40 DEG C of baking ovens and thoroughly dry.20~30 milligrams of the rhizoma atractylodis seedling of drying is taken, beveller is extracted with DNA
(Retsch MM400, Germany) grinding 2min (30 times/s), uses plant DNA extraction kit (Tiangeng biochemical technology (north
Capital) Co., Ltd) extract STb gene.DNA is determined using NanoDrop 2000 (ThermoFisher Scientific, USA) dense
Degree and quality.
PCR is expanded：PCR amplifications are carried out according to Chinese medicine DNA bar code Molecular Identification guideline.ITS2 sequence amplifications are just
To primer I TS2F:5'-ATGCGATACTTGGTGTGAAT-3'(SEQ ID No.20)；Reverse primer ITS3R:5'-
GACGCTTCTCCAGACTACAAT-3'(SEQ ID No.21).Amplification system (25 μ L)：PCR mix 12.5 μ L, it is forward and reverse to draw
Each 1 μ L of thing, template 2 μ L, ddH2O 8.5μL.ITS2 sequence amplification programs are:94 DEG C of pre-degeneration 5min；94 DEG C are denatured 30s, 56
DEG C annealing 30s, 72 DEG C extension 45s, 40 circulation；72 DEG C of extension 10min.
Sequencing：Sequencing methods are carried out according to Chinese medicine DNA bar code Molecular Identification guideline, are specially：
Two-way sequencing is carried out using ABI 3730XL sequenators (ThermoFisher Scientific, USA) after PCR primer is purified,
Peak figure Quality estimation is sequenced according to Chinese medicine DNA bar code Molecular Identification guideline and international DNA bar code association plant work
Work group guideline (such as 1, Chinese Pharmacopoeia Commission's Pharmacopoeias of People's Republic of China, version in 2015, four Beijing：China
Medical Science Press, 2015.383-385.；2nd, Chen Shilin, Yao Hui, Han Jianping, wait Chinese medicine DNA bar code Molecular Identifications
Guideline CHINA JOURNAL OF CHINESE MATERIA MEDICAs, 2013,38 (2):141-148.；3、CBOL Plant Working Group.A DNA
barcode for land plants.Proceedings of the National Academy of Sciences USA,
2009,106,12794-12797.) carry out.
Sequence assembly：Peak figure is sequenced to remove using CodonCode Aligner V7.0.1 (CodonCode Co., USA)
Low quality region, check and correction splicing and primer sequence excision；Based on hidden Markov model (Hidden Markov model), make
5.8S rRNA and 28S rRNA sections, which are removed, with HMMER v3.1 softwares obtains ITS2 sequences.
The DNA of 52 parts of rhizoma atractylodis seedling samples is obtained according to preceding method, quality is higher, and DNA concentration is all higher than 100ng μ
L-1, A260/A280It is between 1.7~2.0, can successfully enters performing PCR amplification, sequencing and sequence assembly, 5.8S rRNA
The conserved sequence in area is " conserved sequence in CGAGGGCACGTCTGCCT GGGCGT CA ", 28S rRNA areas is
" CGACCCCAGGTCAGGCGGGACTACC ", can successfully be removed based on hidden Markov model using HMMER v3.1b2 softwares
5.8S rRNA and 28S rRNA sections obtain ITS2 sequences, and ITS2 sequence lengths are 229bp.
3rd, the identification of the rhizoma atractylodis seedling base species based on ITS2 sequences
Calculated using genetic distance, NJ adjoining trees build or BLAST identification rhizoma atractylodis seedling laboratory samples.Wherein, first carry out
The pre-treatment step that genetic distance is calculated and NJ phylogenetic trees are built, i.e., carry out Multiple Sequence Alignment using muscle 3.8；With
Application PUAP 4.0 softwares calculate kind of an interior, Genetic distance afterwards；NJ adjoining trees are carried out using MEGA 7.0 to build；Utilize NCBI
BLAST 2.6.0 carry out BLAST identifications.
3.1 identifications based on genetic distance comparative approach
52 ITS2 sequences will be obtained, respectively " the standard of Chinese medicine rhizoma atractylodis and its easily mixed adulterant with being obtained in embodiment 1
Standard ITS2 bar codes in ITS2 bar code datas storehouse " carry out genetic distance comparison, and design parameter is：Variance
Estimation Method:Bootstrap method；No.of Bootstrap Replications:1000；Model/
Method：Kimura 2-parameter model；Gaps/Missing Data Treatment：Pairwise
deletion。
By taking seedling laboratory sample SCZ006 as an example, the genetic distance of the standard ITS2 bar codes in the sample and database is such as
Shown in Fig. 2.All qualification results of the seedling laboratory sample based on genetic distance comparative approach are as shown in table 2.
Qualification result of the table 2 based on genetic distance comparative approach
3.2 identifications based on NJ systematic growth tree constructing methods
52 ITS2 sequences will be obtained, respectively " the standard of Chinese medicine rhizoma atractylodis and its easily mixed adulterant with being obtained in embodiment 1
Standard ITS2 bar codes in ITS2 bar code datas storehouse " carry out NJ phylogenetic tree structures, and design parameter is：Test of
Phylogeny:Bootstrap method；No.of Bootstrap Replication：1000；Model/Method：
Kimura 2-parameter model；Gaps/Missing Data Treatment：Pairwise deletion.
By taking seedling laboratory sample SCZ006 as an example, the NJ systematic growths of the sample and the standard ITS2 bar codes in database
Tree is as shown in Figure 3.Qualification result of all seedling laboratory samples based on NJ systematic growth tree methods is as shown in table 3.
Qualification result of the table 3 based on NJ systematic growth tree constructing methods
3.3 identifications based on BLAST comparison methods
52 ITS2 sequences will be obtained, respectively " the standard of Chinese medicine rhizoma atractylodis and its easily mixed adulterant with being obtained in embodiment 1
Standard ITS2 bar codes in ITS2 bar code datas storehouse " carry out BLAST comparisons.
By taking seedling laboratory sample SCZ006 as an example, the sample is compared with the BLAST of the standard ITS2 bar codes in database
As a result it is as shown in Figure 4.All qualification results of the seedling laboratory sample based on BLAST comparison methods are as shown in table 4.
Qualification result of the table 4 based on BLAST comparison methods
Sequence table
<110>Chengde Medical College；China Medical Sciences Academy Medical Plants Institute；Harbin City's food and medicine is examined in detection
The heart
<120>A kind of Chinese medicine rhizoma atractylodis seedling authentication method based on DNA bar code technology
<160> 21
<170> PatentIn version 3.3
<210> 1
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 1
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgacg cttcgaccg 229
<210> 2
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 2
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcatc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgatg cttcgaccg 229
<210> 3
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 3
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccgcaa cgcgtcgcct cacgacgacg cttcgaccg 229
<210> 4
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 4
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcatc gggggcggag 60
attggtctcc cgtgcccacg gcacggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgatg cttcgaccg 229
<210> 5
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 5
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct caagacgacg cttcgaccg 229
<210> 6
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 6
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgatg cttcgaccg 229
<210> 7
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 7
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgacg cttcgaccg 229
<210> 8
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 8
cgcatcgcgt cgccccctac cacgcctctc ccacggggac gcgtgtcatc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggacctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgatg cttcgaccg 229
<210> 9
<211> 229
<212> DNA
<213> Atractylodes koreana
<400> 9
cgcatcgtgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cacgacgacg cttcgaccg 229
<210> 10
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 10
cgcatcgcgt cgcccccaac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 11
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 11
cgcatcgcgt cgcccccaac cacgcctccc ccatggggac gcgtgtcgtc ggggacggag 60
attggtctcc cgtgcccacg gtacggttgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 12
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 12
cgcatcgcgt cgcccccaac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtacggttgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgtgtcgcct cgcgacgacg cttcgaccg 229
<210> 13
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 13
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgtgtcgcct cgcgacgacg cttcgaccg 229
<210> 14
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 14
cgcatcgcgt cgcccccaac catgcctccc ccacggggat gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtgcggctgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 15
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 15
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc ggggacggag 60
attggtctcc cgtgcccacg gtacggttgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 16
<211> 229
<212> DNA
<213> Atractylodes lancea
<400> 16
cgcatcgcgt cgccccctac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gtgcggttgg cctaaaaggg agtccccttc gacggacgca 120
cggcaagtgg tggttgtaat ggccctcgta tcgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 17
<211> 229
<212> DNA
<213> Atractylodes macrocephala
<400> 17
cgcatcgcgt cgcccccgac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaacggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta ttgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct tgcgacgacg cttcgaccg 229
<210> 18
<211> 229
<212> DNA
<213> Atractylodes macrocephala
<400> 18
cgcatcgcgt cgcccccgac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaacggg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta ttgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct cgcgacgacg cttcgaccg 229
<210> 19
<211> 229
<212> DNA
<213> Atractylodes macrocephala
<400> 19
cgcatcgcgt cgcccccgac cacgcctccc ccacggggac gcgtgtcgtc gggggcggag 60
attggtctcc cgtgcccacg gcgcggctgg cctaaaccgg agtccccttc gacggacgca 120
cggctagtgg tggttgtaat ggccctcgta ttgagccgtg cgtcgcgagc cgcaagggaa 180
gcgctcgaca aagaccccaa cgcgtcgcct tgcgacgacg cttcgaccg 229
<210> 20
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223> ITS2F
<400> 20
atgcgatact tggtgtgaat 20
<210> 21
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223> ITS3R
<400> 21
gacgcttctc cagactacaa t 21
Claims (7)
1. a kind of Chinese medicine rhizoma atractylodis seedling authentication method based on DNA bar code technology, it is characterised in that methods described is provided
The standard ITS2 bar code datas storehouse of Chinese medicine rhizoma atractylodis and its easily mixed adulterant, by by the ITS2 sequences of sample to be identified with it is described
Sequence in standard ITS2 bar code datas storehouse is compared, to differentiate the Chinese medicine rhizoma atractylodis seedling true and false；The standard ITS2 bars
Code data storehouse has rhizoma atractylodis (Atractylodes lancea (Thunberg) Candolle), Atractylodes koreana
(Atractylodes Koreana (Nakai) Kitamura), the bighead atractylodes rhizome (Atractylodes macrocephala Koidz.)
Standard ITS2 bar codes.
2. the Chinese medicine rhizoma atractylodis seedling authentication method as claimed in claim 1 based on DNA bar code technology, it is characterised in that
The standard ITS2 bar code sequences of the rhizoma atractylodis are 7, and its sequence is as shown in SEQ ID No.10-16；The Atractylodes koreana
Standard ITS2 bar code sequences are 9, and its sequence is as shown in SEQ ID No.1-9；The standard ITS2 bar code sequences of the bighead atractylodes rhizome
3 are classified as, its sequence is as shown in SEQ ID No.17-19.
3. the Chinese medicine rhizoma atractylodis seedling authentication method as claimed in claim 2 based on DNA bar code technology, it is characterised in that
Methods described includes：
1) sample pre-treatments to be identified, extract the DNA of sample to be identified, performing PCR of going forward side by side amplification, sequencing and splicing are obtained
The ITS2 sequences of sample to be identified；
2) the standard ITS2 bar codes of adulterant are mixed by the ITS2 sequences of the sample to be identified and the Chinese medicine rhizoma atractylodis and its easily
Standard ITS2 bar codes in database are compared, so that it is determined that the true and false of sample to be identified.
4. the Chinese medicine rhizoma atractylodis seedling authentication method as claimed in claim 3 based on DNA bar code technology, it is characterised in that
Step 2) in, by by the ITS2 sequences of the sample to be identified and the Chinese medicine rhizoma atractylodis and its easily mixed adulterant standard ITS2
In standard ITS2 bar codes progress NJ adjoining trees structure, BLAST comparisons and genetic distance calculating relatively in bar code data storehouse
One or more, to determine the true and false of sample to be identified.
5. the Chinese medicine rhizoma atractylodis seedling authentication method as claimed in claim 1 based on DNA bar code technology, it is characterised in that
The easily mixed adulterant of the Chinese medicine rhizoma atractylodis is Atractylodes koreana and the bighead atractylodes rhizome.
6. a kind of standard ITS2 bar code datas storehouse identified for Chinese medicine rhizoma atractylodis seedling, it is characterised in that the standard
ITS2 bar code datas storehouse has the standard ITS2 bar codes of rhizoma atractylodis, Atractylodes koreana, the bighead atractylodes rhizome.
7. a kind of standard ITS2 bar code datas storehouse as claimed in claim 6 identified for Chinese medicine rhizoma atractylodis seedling, it is special
Levy and be, the standard ITS2 bar code sequences of the rhizoma atractylodis are 7, and its sequence is as shown in SEQ ID No.10-16；The Korea
The standard ITS2 bar code sequences of rhizoma atractylodis are 9, and its sequence is as shown in SEQ ID No.1-9；The standard ITS2 bars of the bighead atractylodes rhizome
Shape code sequence is 3, and its sequence is as shown in SEQ ID No.17-19.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710696645.7A CN107254544B (en) | 2017-08-15 | 2017-08-15 | Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710696645.7A CN107254544B (en) | 2017-08-15 | 2017-08-15 | Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107254544A true CN107254544A (en) | 2017-10-17 |
| CN107254544B CN107254544B (en) | 2021-11-05 |
Family
ID=60026754
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710696645.7A Active CN107254544B (en) | 2017-08-15 | 2017-08-15 | Chinese medicinal material rhizoma atractylodis germchit identification method based on DNA bar code technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107254544B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107541521A (en) * | 2017-10-19 | 2018-01-05 | 中国科学院昆明植物研究所 | A kind of authentication method of radix coniti coreani DNA bar code and radix coniti coreani based on big data |
| CN110747290A (en) * | 2019-11-29 | 2020-02-04 | 中国医学科学院药用植物研究所 | ITS2 sequence amplification universal primer, method for identifying traditional Chinese medicinal materials and kit |
-
2017
- 2017-08-15 CN CN201710696645.7A patent/CN107254544B/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107541521A (en) * | 2017-10-19 | 2018-01-05 | 中国科学院昆明植物研究所 | A kind of authentication method of radix coniti coreani DNA bar code and radix coniti coreani based on big data |
| CN110747290A (en) * | 2019-11-29 | 2020-02-04 | 中国医学科学院药用植物研究所 | ITS2 sequence amplification universal primer, method for identifying traditional Chinese medicinal materials and kit |
| CN110747290B (en) * | 2019-11-29 | 2022-05-17 | 中国医学科学院药用植物研究所 | ITS2 sequence amplification universal primer, method for identifying traditional Chinese medicinal materials and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107254544B (en) | 2021-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wilson | Phylogeny of Iris based on chloroplast matK gene and trnK intron sequence data | |
| Zhang et al. | Coumarin content, morphological variation, and molecular phylogenetics of Melilotus | |
| Nejatzadeh-Barandozi et al. | Genetic diversity of accessions of Iranian Aloe vera based on horticultural traits and RAPD markers | |
| Deniz et al. | Morphological and molecular data reveal a new species of Allium (Amaryllidaceae) from SW Anatolia, Turkey | |
| CN107254544A (en) | A kind of Chinese medicine rhizoma atractylodis seedling authentication method based on DNA bar code technology | |
| Singh et al. | Morphological and genetic diversity analysis of Citrullus landraces from India and their genetic inter relationship with continental watermelons | |
| Samatadze et al. | Agro-morphological, microanatomical and molecular cytogenetic characterization of the medicinal plant Chelidonium majus L. | |
| Al-Juhani et al. | Identification and molecular study of medicinal Plectranthus species (Lamiaceae) from Saudi Arabia using plastid DNA regions and ITS2 of the nrDNA gene | |
| Samatadze et al. | Agro-morphological and cytogenetic characterization of colchicine-induced tetraploid plants of Polemonium caeruleum L.(Polemoniaceae) | |
| Pahlevani et al. | What is" Astragalus wiesneri"? Disentangling a new species from its relatives in section" Anthylloidei" | |
| CN107630102B (en) | PCR identification kit and identification method for radix paeoniae alba | |
| Zheng et al. | Molecular authentication of medicinal and edible plant Gnaphalium affine (cudweed herb,“Shu-qu-cao”) based on DNA barcode marker ITS2 | |
| KR100470379B1 (en) | Phytomics: a genomic-based approach to herbal compositions | |
| CN106755526B (en) | Functional molecular marker related to lipped and petal sepal character of cymbidium and identification method thereof | |
| Sadler et al. | A molecular phylogeny of Calenduleae (Asteraceae) supports the transfer of Dimorphotheca polyptera DC. to Osteospermum L. | |
| CN105400869A (en) | Method for detecting amaranthus palmeri through PCR primers | |
| Gholave et al. | Little known Curculigo brevifolia deserves a species rank: evidences from morphological, cytological and molecular data | |
| Gang et al. | Circumscriptions and phylogenetic relationships of Primula Sects. Auganthus and Ranunculoides: evidence from nrDNA ITS sequences | |
| Mohammadi et al. | Morphological, genetic and pigment diversity of Nerium indicum Mill in Iran | |
| Vidal et al. | RAPD based genetic diversity, agronomic characters, and nutrition content of Timor Leste kidney bean (Phaseolus vulgaris) genotypes | |
| Hanum et al. | The phylogenetic relationship among varieties of Lansium domesticum Correa based on ITS rDNA sequences | |
| CN107227367A (en) | Medical glycyrrhiza Relationship iden- tification method based on ITS2 sequences | |
| Riahi Rad et al. | Phylogenetic affinities of wild and cultivated Ornithogaloideae based on ITS and trnL–F DNA sequences by extended sampling from Iran | |
| CN105861495A (en) | Method for extracting genome DNA from taxus chinensis medicinal material | |
| Alaklabi | Ficus Species Genetic Diversity Based on Internal Transcribed Spacer (ITS) Region Analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |