CN107253983A - A kind of recombinant protein composition for detecting toxoplasma antibody and preparation method thereof - Google Patents
A kind of recombinant protein composition for detecting toxoplasma antibody and preparation method thereof Download PDFInfo
- Publication number
- CN107253983A CN107253983A CN201710507519.2A CN201710507519A CN107253983A CN 107253983 A CN107253983 A CN 107253983A CN 201710507519 A CN201710507519 A CN 201710507519A CN 107253983 A CN107253983 A CN 107253983A
- Authority
- CN
- China
- Prior art keywords
- mic2
- sag1
- recombinant protein
- amino acid
- protein composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
- C07K14/45—Toxoplasma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to Biological Detection technical field, a kind of recombinant protein composition for detecting toxoplasma antibody is specifically provided, recombinant protein composition is made up of the recombinant protein of SAG1 specific epitopes and the recombinant protein of MIC2 specific epitopes.Present invention also offers the preparation method of recombinant protein.Recombinant protein composition has high specific and high sensitivity in the present invention, uses it for detecting toxoplasma antibody, recall rate is greatly improved, while avoiding false positive and missing inspection problem.
Description
Technical field
The present invention relates to technique for gene engineering and diagnostic reagent field, and in particular to one kind is used to detect wind toxoplasma antibody
Recombinant protein composition and preparation method thereof.
Background technology
SAG1 and Microneme protein MIC2 are considered as having played important function in Infection of Toxoplasma Gondii infects host processes, immune
Aspect SAG1 and MIC2 are considered as a kind of preferable diagnostic antigen, can be accurately quick, sensitively detect the sense of Infection of Toxoplasma Gondii
Dye, so as to be furtherd investigate extensively.SAG1 is current most study and studies a kind of most deep memebrane protein, in the strain of different worms
In have it is well-conserved, SAG1 can be expressed in prokaryotic expression system, eukaryotic expression system and insect expression system, can
To be early diagnosed as diagnostic antigen.
MIC2 is that Infection of Toxoplasma Gondii invades the invasion factor that must exist during host cell, and place is connected in Infection of Toxoplasma Gondii
Played a significant role during chief cell.MIC2 genes are conserved sequences, it is impossible to be knocked, and can weaken polypide after missing to place
The invasive ability of chief cell.Although there is the recombinant protein for detecting toxoplasma antibody in currently available technology, still suffer from
False positive and missing inspection problem, for above-mentioned problem, according to SAG1 and Microneme protein MIC2 property, can develop one
The complex composition of the recombinant protein of SAG1 and Microneme protein MIC2 specificity epitopes is planted, for detecting toxoplasma antibody.
The content of the invention
It is an object of the invention to be：In view of the deficienciess of the prior art, providing a kind of high specificity, sensitivity is high,
Recall rate, the recombinant protein composition of the detection toxoplasma antibody of reduction missing inspection can be improved.
To achieve these goals, the technical scheme is that：
It is a kind of detect toxoplasma antibody recombinant protein composition, the recombinant protein by SAG1 specific epitopes restructuring egg
The recombinant protein composition of white and MIC2 specific epitopes.
As an improvement technical scheme, the recombinant protein of the SAG1 specific epitopes and the restructuring of MIC2 specific epitopes
Albumen is mixed in the recombinant protein composition according to same concentrations, same ratio.
As an improvement technical scheme, the SAG1 specific epitopes are the 48th amino acid of SAG1 albumen n ends to 316
Individual amino acid, the MIC2 specific epitopes are the 75th amino acid of MIC2 albumen n ends to 468 amino acid.
It is another object of the present invention to be：Resist in view of the deficienciess of the prior art, providing a kind of detection Infection of Toxoplasma Gondii
The preparation method of the recombinant protein composition of body.
To achieve these goals, the technical scheme is that：
A kind of preparation method for the recombinant protein composition for detecting toxoplasma antibody, the preparation method includes following step
Suddenly：
(1) screening of toxoplasma antibody diagnostic antigen epitope
Using on-line analysis instrument, analysis Infection of Toxoplasma Gondii SAG1 and MIC2 amino acid sequence total length filter out Infection of Toxoplasma Gondii
SAG1 protein-specifics antigen is located at the 48th amino acid to the 316th amino acid；Infection of Toxoplasma Gondii MIC2 protein-specifics antigen position
In the 75th amino acid to the 468th amino acid；
(2) gene cloning of Infection of Toxoplasma Gondii SAG1 and MIC2 Protein Epitopes
Using bow-shaped worm dna as template, the gene piece of Infection of Toxoplasma Gondii SAG1 Protein Epitopes is expanded with SAG1 upstream and downstream primer
Section；The genetic fragment of Infection of Toxoplasma Gondii MIC2 Protein Epitopes is expanded with MIC2 upstream and downstream primer；Electrophoresis glue reclaim purpose fragment ,-
20 DEG C freeze it is standby；
(3) SAG1 and MIC2 protein expression vectors are built respectively
PGEX-4T-1 and pGEX-4T-2 plasmids are extracted, pGEX-4T-1 and pGEX-4T-2 is distinguished after double digestion, electrophoresis
The plasmid fragments of glue reclaim double digestion；Glue reclaim double digestion after Infection of Toxoplasma Gondii SAG1 albumen and MIC2 albumen difference double digestion, electrophoresis
Purpose fragment；Double digestion plasmid and double digestion purpose fragment are pressed 1:3-10 ratios, with T4 ligases, 16 DEG C connect overnight, obtain
Recombinant plasmid.
As an improvement technical scheme, the preparation method also comprises the following steps：
The screening and identification of recombinant plasmid：
Recombinant plasmid transformed e. coli bl21 (DE3) is coated with the LB flat boards containing ampicillin, 37 DEG C of constant temperature trainings
Foster case is stayed overnight；Next day random picking conversion bacterium colony and control bacterium colony, extract plasmid, carry out double digestion, run electrophoresis, can see respectively
See corresponding purpose fragment and carrier segments, as construction of expression vector success, positive expression bacterium；
Protein engineering bacterium high efficient expression：
Identification positive expression bacterium and control bacterium are seeded in the LB culture mediums containing ampicillin, 37 DEG C of constant-temperature tables shake
Swing overnight, next day presses 1:100 inoculations, 37 DEG C of constant-temperature tables vibrate 4h, plus final concentration of 0.5-1mmol/l IPTG, 37 DEG C of continuation
Induce 2-6h；Centrifugation, collects precipitation thalline, then will precipitate bacterial cell disruption, and the supernatant precipitation of collection carries out SDS-PAGE respectively
Detection；It was found that the destination protein of pGEX-4T-1/SAG1 and pGEX-4T-2/MIC2 expression obtains respectively in supernatant
The engineering bacteria of the SAG1 and MIC2 anti-genic fragment albumen of height expression；
The purifying of expressing protein：
The recombinant protein engineering bacteria of high efficient expression is centrifuged, precipitation thalline is collected, then precipitation thalline is resuspended in former centrifugation
In 1/10 lysate of volume, bacterium solution supernatant is collected in ice-bath ultrasonic thalline, centrifugation；Take supernatant and 50% glutathione-sepharose
Resin homogenate is well mixed, and supernatant is abandoned in centrifugation, and the PBS mixing collected precipitation and 8-12 times of normal volume is added into precipitation is equal
It is even, centrifugation, then supernatant is abandoned, collect precipitation and the glutathione elution buffer of 1-3 times of volume is added into precipitation, mix, from
The heart, the supernatant of collection is dialysed 24-48h in PBS, and centrifuging and taking supernatant obtains the antigenic purpose eggs of SAG1 and MIC2 respectively
In vain, -20 DEG C it is standby.
As an improvement technical scheme, the amplification condition of step (2)：Stage I:94℃3min；Stage II:94℃
30s, 58 DEG C of 30s, 72 DEG C of 1min, 30 circulations；Stage III:72℃5min.
As an improvement technical scheme, SAG1 and MIC2 upstream and downstream primer has following institute respectively in step (2)
The sequence shown：
SAG1 upstream primer sequences are：5’-AA GAATTC TCGGATCCCCCTCTTG-3’
SAG1 downstream primer sequences are：5’-AT CTCGAG ACTGGCTGTTCCCGCA-3’
MIC2 upstream primer sequences are：5’-AT CCCGGG CTGGACATTTGCTTTCTTAT-3’
MIC2 downstream primer sequences are：5’-AA CTCGAG TGGACACGGTGAGGTATT-3’.
As an improvement technical scheme, the recombinant plasmid in step (3) is pGEX-4T-1/SAG1 and pGEX-4T-
2/MIC2。
The present invention uses above technical scheme, compared with prior art, with advantages below：
Present invention selection two representational antigen proteins of SAG1 and MIC2, analyze two kinds of protein amino acid sequences, select
The stronger partial segments of antigenicity, as the object of recombinant protein, substantially increase the yield and specificity of expression, by two kinds
The recombinant protein composition that recombinant protein compounding is obtained has preferably specificity and sensitiveness, uses it for diagnosis Infection of Toxoplasma Gondii and resists
Body, substantially increases clinical recall rate, efficiently solves the problems, such as false positive existing during detection and missing inspection.
Embodiment
In order to make the purpose , technical scheme and advantage of the present invention be clearer, the present invention is carried out further detailed
Explanation.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not intended to limit the present invention.
Embodiment 1
A kind of recombinant protein composition for detecting toxoplasma antibody, it is special by the recombinant protein and MIC2 of SAG1 specific epitopes
The recombinant protein of epitope mixes the recombinant protein of composition according to same concentrations, same ratio.Wherein SAG1 specific epitopes are SAG1
The 48th amino acid of albumen n end is to 316 amino acid, and MIC2 specific epitopes are the 75th amino acid of MIC2 albumen n ends to 468
Amino acid.
Embodiment 2
A kind of preparation method for diagnosing toxoplasma antibody recombinant antigen composition, comprises the following steps：
(1) screening of toxoplasma antibody diagnostic antigen epitope
Utilize the on-line analysis instrument such as ExPasy, TMHMM, SignalIP4.1, analysis Infection of Toxoplasma Gondii SAG1 and MIC2 amino
Acid sequence total length, filters out Infection of Toxoplasma Gondii SAG1 protein-specifics antigen positioned at the 48th amino acid to the 316th amino acid；Arch
Worm MIC2 protein-specifics antigen is located at the 75th amino acid to the 468th amino acid；
(2) gene cloning of Infection of Toxoplasma Gondii SAG1 and MIC2 Protein Epitopes
Design primer in SAG1 epitope DNA sequence dnas both sides
Sense primer 5-AA GAATTC TCGGATCCCCCTCTTG-3 '
EcoR I restriction enzyme sites
- AT CTCGAG the ACTGGCTGTTCCCGCA-3 ' of anti-sense primer 5 '
Xho I restriction enzyme sites
Design primer in MIC2 epitope DNA sequence dnas both sides
- AT CCCGGG the CTGGACATTTGCTTTCTTAT-3 ' of sense primer 5 '
Sma I restriction enzyme sites
- AA CTCGAG the TGGACACGGTGAGGTATT-3 ' of anti-sense primer 5 '
Xho I restriction enzyme sites
Using bow-shaped worm dna as template, the gene piece of Infection of Toxoplasma Gondii SAG1 Protein Epitopes is expanded with SAG1 upstream and downstream primers
Section；The genetic fragment of Infection of Toxoplasma Gondii MIC2 Protein Epitopes is expanded with MIC2 upstream and downstream primers；Amplification condition：Stage I:94℃
3min；Stage II:94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 30 circulations；Stage III:72℃5min；Electrophoresis glue reclaim purpose
Fragment, SAG1 purpose fragments be 823bp, MIC2 purpose fragments be 1198bp, -20 DEG C freeze it is standby；
(3) SAG1 and MIC2 protein expression vectors are built respectively
Extract pGEX-4T-1 and pGEX-4T-2 plasmids, pGEX-4T-1 EcoR I and Xho I double digestions, pGEX-4T-2
With Sma I and Xho I double digestions, the plasmid fragments of glue reclaim double digestion after electrophoresis；With EcoR I and Xho I double digestion Infection of Toxoplasma Gondii
Glue reclaim after SAG1 albumen, Sma I and Xho I double digestion MIC2 albumen, electrophoresis, -20 DEG C standby；
Double digestion plasmid and double digestion purpose fragment press 1:3-10 ratios, with T4 ligases, 16 DEG C connect overnight.After connection
Recombinant vector be pGEX-4T-1/SAG1 and pGEX-4T-2/MIC2 respectively；
(4) screening and identification of recombinant plasmid
By recombinant plasmid transformed e. coli bl21 (DE3), coating contains on ampicillin (50ug/ml) LB flat boards, and 37
DEG C constant incubator is stayed overnight.5 conversion bacterium colonies of next day random picking and 2 control bacterium colonies (plasmid PGEX-4T-1 and pGEX-4T-
2) plasmid, is extracted respectively, and pGEX-4T-1/SAG1 and pGEX-4T-2/MIC2 use EcoR I/Xho I and Sma I/Xho I respectively
Electrophoresis is run after double digestion, digestion.Corresponding purpose fragment and carrier segments can be seen, construction of expression vector success is sun
Property expression bacterium；And purpose fragment is not seen after compareing bacteria plasmid digestion；
(5) protein engineering bacterium high efficient expression
The bacterium and control bacterium that identify positive expression are seeded to the test tube of 2mlLB culture mediums (60ug/ml ampicillins)
In, 37 DEG C of constant-temperature table shaken overnights, next day presses 1:100 inoculations, 37 DEG C of constant-temperature tables vibration 4h, plus IPTG are (final concentration of
1mmol/l), 37 DEG C of induction 4h are continued；Bacterium solution is collected by centrifugation, supernatant precipitation carries out SDS-PAGE detections after crushing；It was found that
The destination protein of pGEX-4T-1/SAG1 and pGEX-4T-2/MIC2 expression is in supernatant；Compare in bacterium without destination protein bar
Band, illustrates the engineering bacteria for obtaining SAG1 the and MIC2 anti-genic fragment albumen of high expression respectively；
(6) purifying of expressing protein
(4 DEG C) of (10000rpm) low temperature centrifuges 10min to the recombinant protein engineering bacteria of high efficient expression at a high speed, by the thalline of precipitation
In 1/10 lysate (50mM Tris-Hcl, 10mM EDTA, 15mM NaCL, 10mM DTT) for being resuspended in former centrifugation volume, ice
The ultrasonic thalline 20min of bath, (4 DEG C) centrifugation 30min of (12000rpm) low temperature, collect bacterium solution supernatant at a high speed；
The homogenate of supernatant and 50% Glutathione-agarose resin is mixed, at room temperature jog 30min, mixture in 4 DEG C from
5min is centrifuged under 2100rpm/min rotating speeds in scheming, abandons in supernatant, the precipitation of collection and adds the PBS of 10 times of normal volumes, overturn
(washing away the albumen not with resin-bonded) is mixed for several times, mixture is centrifuged in 4 DEG C of centrifuges under 2100rpm/min rotating speeds
5min, is abandoned in supernatant, the precipitation of collection and adds the glutathione elution buffer of 1 times of volume, and ambient temperature with gentle agitation 10min (is washed
The albumen combined in deresination), 5min is centrifuged under 4 DEG C of 2100rpm/min rotating speeds, supernatant is moved in new pipe, is repeated 2 times, merge 3
Secondary supernatant, the dialysis 48h in PBS (10mM, PH7.4), centrifuging and taking supernatant obtains the antigenic purpose eggs of SAG1 and MIC2 respectively
In vain, -20 DEG C it is standby.
The positive expression bacterium recombinant plasmid of embodiment 3 is sequenced
Above-mentioned positive expression bacterium is extracted into plasmid with plasmid extraction kit to send in Shanghai life work sequencing.
The DNA sequence dna of SAG1 genetic fragments in recombinant plasmid is completely correct, as a result as follows：
TCGGATCCCCCTCTTGTTGCCAATCAAGTTGTCACCTGCCCAGATAAAAAATCGACAGCCGCGGTCATT
CTCACACCGACGGAGAACCACTTCACTCTCAAGTGCCCTAAAACAGCGCTCACAGAGCCTCCCACTCTTGCGTACTC
ACCCAACAGGCAAATCTGCCCAGCGGGTACTACAAGTAGCTGTACATCAAAGGCTGTAACATTGAGCTCCTTGATTC
CTGAAGCAGAAGATAGCTGGTGGACGGGGGATTCTGCTAGTCTCGACACGGCAGGCATCAAACTCACAGTTCCAATC
GAGAAGTTCCCCGTGACAACGCAGACGTTTGTGGTCGGTTGCATCAAGGGAGACGACGCACAGAGTTGTATGGTCAC
AGTGACAGTACAAGCCAGAGCCTCATCGGTCGTCAATAATGTCGCAAGGTGCTCCTACGGTGCAGACAGCACTCTTG
GTCCTGTCAAGTTGTCTGCGGAAGGACCCACTACAATGACCCTCGTGTGCGGGAAAGATGGAGTCAAAGTTCCTCAA
GACAACAATCAGTACTGTTCCGGGACGACGCTGACTGGTTGCAACGAGAAATCGTTCAAAGATATTTTGCCAAAATT
AACTGAGAACCCGTGGCAGGGTAACGCTTCGAGTGATAAGGGTGCCACGCTAACGATCAAGAAGGAAGCATTTCCAG
CCGAGTCAAAAAGCGTCATTATTGGATGCACAGGGGGATCGCCTGAGAAGCATCACTGTACCGTGAAACTGGAGTTT
GCCGGGGCTGCAGGGTCAGCAAAATCGGCTGCGGGAACAGCCAGT
The DNA sequence dna of MIC2 genetic fragments in recombinant plasmid is completely correct, as a result as follows：
CTGGACATTTGCTTTCTTATCGATTCGTCTGGAAGCATAGGAATACAGAATTTCCGTCTAGTAAAACAGTTCCTCCA
CACCTTTTTAATGGTGTTGCCCATTGGCCCAGAAGAAGTTAACAATGCAGTTGTTACTTACTCGACGGACGTTCACC
TGCAATGGGATCTACAGAGTCCGAACGCGGTTGACAAGCAGCTCGCGGCGCATGCGGTGCTAGACATGCCGTATAAA
AAGGGCAGTACCAACACCAGTGATGGACTGAAGGCCTGCAAACAAATTCTGTTTACAGGTTCGCGCCCAGGACGCGA
ACATGTGCCGAAGCTAGTGATTGGAATGACAGATGGCGAATCGGATTCTGATTTTCGCACCGTGAGAGCGGCAAAGG
AGATTCGTGAGCTTGGAGGCATCGTCACAGTCCTTGCAGTCGGTCATTACGTCAAACATAGTGAGTGCCGAAGCATG
TGTGGGTGCAGTGGTACGAGCGATGATGACAGTCCGTGTCCCCTGTATCTTCGGGCTGACTGGGGGCAGCTCGCGAC
GGCGATTAAACCGATGCTTAAAGAGGTTTGTAAGACACTCCCCCAGGATGCCATTTGCTCGGATTGGTCCGCATGGA
GCCCCTGCAGTGTATCCTGCGGTGACGGAAGCCAAATCAGGACGCGAACTGAGGTTTCTG
CTCCGCAACCTGGAACACCAACATGTCCGGACTGCCCTGCGCCCATGGGAAGGACTTGCGTGGAACAAGGCGGACTT
GAAGAAATTCGTGAATGCAGTGCGGGGGTATGTGCTGTTGACGCTGGATGTGGCGTCTGGGGAGAGTGGTCCGCCTG
GAGCGCGTCTTGCGGAAATGCCACAAGGAAGCGAGAGCGAACGCGTTACAATGACCCACCACCCCAGGGGGCAGGCC
GTCGGTGTGAAAATCAGGATCCGCCGGTGTTACAGGAGCAGACAGAAGAAGCAACTCTTGCTCCTTGCATAACTATA
CCGCCAACTCCCCCAGAATGGGCTGCATGGAGCGACTGCACTGTCACGTGTGGCGGTGGCAATCGGCATCGAGTGAG
AAACGCACTGCCACCAGGACTGGGGTCGCAGAACGGAGAAAGTGACGAATCGCTCGTGTCCAAACTGTGGCCTGGGA
CAGATCTACGACAGGAGGAAGCATGTAATACCTCACCGTGTCCA
The recombinant protein detection toxoplasma antibody of the purifying of embodiment 4
By 1 under 2 kinds of recombinant protein comparable sodiums of purifying:1 mixing, after being diluted with carbonate buffer solution (50mM, PH9.6)
100ul/ holes, the protein content coating elisa plate in 100ng/ holes, 4 DEG C overnight.Add the PBS of the calf serum of 200ul/ holes 10% after washing
2h are closed in 37 DEG C of water-baths, after washing 4 DEG C it is standby.
Dot-ELISA detects 5 parts of resisting toxoplasmosis positive serums and 5 portions of normal human serums.Surveyed using 450nm wavelength
Determine OD values.As a result display (being shown in Table 1) fusion protein compositions can react with 5 parts of resisting toxoplasmosis positive serums, not with 5 parts of normal persons
Seroreaction, illustrates that said composition has preferably antigenicity and specificity.
The Dot-ELISA experimental result of table 1 (A450 values)
| 1 | 2 | 3 | 4 | 5 | |
| Resisting toxoplasmosis IgM positive serums | 1.286 | 1.471 | 1.869 | 1.366 | 1.881 |
| Normal human serum | 0.021 | 0.019 | 0.035 | 0.028 | 0.033 |
This patent is not limited to above-mentioned specific embodiment, one of ordinary skill in the art from above-mentioned design,
Without performing creative labour, made a variety of conversion are all fallen within the protection domain of this patent.
SEQUENCE LISTING
<110>Weifang Hightop Biotech Co., Ltd.
<120>A kind of recombinant protein composition for detecting toxoplasma antibody and preparation method thereof
<130> 1
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 807
<212> DNA
<213>The gene order of SAG1 specific epitopes
<400> 1
tcggatcccc ctcttgttgc caatcaagtt gtcacctgcc cagataaaaa atcgacagcc 60
gcggtcattc tcacaccgac ggagaaccac ttcactctca agtgccctaa aacagcgctc 120
acagagcctc ccactcttgc gtactcaccc aacaggcaaa tctgcccagc gggtactaca 180
agtagctgta catcaaaggc tgtaacattg agctccttga ttcctgaagc agaagatagc 240
tggtggacgg gggattctgc tagtctcgac acggcaggca tcaaactcac agttccaatc 300
gagaagttcc ccgtgacaac gcagacgttt gtggtcggtt gcatcaaggg agacgacgca 360
cagagttgta tggtcacagt gacagtacaa gccagagcct catcggtcgt caataatgtc 420
gcaaggtgct cctacggtgc agacagcact cttggtcctg tcaagttgtc tgcggaagga 480
cccactacaa tgaccctcgt gtgcgggaaa gatggagtca aagttcctca agacaacaat 540
cagtactgtt ccgggacgac gctgactggt tgcaacgaga aatcgttcaa agatattttg 600
ccaaaattaa ctgagaaccc gtggcagggt aacgcttcga gtgataaggg tgccacgcta 660
acgatcaaga aggaagcatt tccagccgag tcaaaaagcg tcattattgg atgcacaggg 720
ggatcgcctg agaagcatca ctgtaccgtg aaactggagt ttgccggggc tgcagggtca 780
gcaaaatcgg ctgcgggaac agccagt 807
<210> 2
<211> 1182
<212> DNA
<213>The gene order of MIC2 specific epitopes
<400> 2
ctggacattt gctttcttat cgattcgtct ggaagcatag gaatacagaa tttccgtcta 60
gtaaaacagt tcctccacac ctttttaatg gtgttgccca ttggcccaga agaagttaac 120
aatgcagttg ttacttactc gacggacgtt cacctgcaat gggatctaca gagtccgaac 180
gcggttgaca agcagctcgc ggcgcatgcg gtgctagaca tgccgtataa aaagggcagt 240
accaacacca gtgatggact gaaggcctgc aaacaaattc tgtttacagg ttcgcgccca 300
ggacgcgaac atgtgccgaa gctagtgatt ggaatgacag atggcgaatc ggattctgat 360
tttcgcaccg tgagagcggc aaaggagatt cgtgagcttg gaggcatcgt cacagtcctt 420
gcagtcggtc attacgtcaa acatagtgag tgccgaagca tgtgtgggtg cagtggtacg 480
agcgatgatg acagtccgtg tcccctgtat cttcgggctg actgggggca gctcgcgacg 540
gcgattaaac cgatgcttaa agaggtttgt aagacactcc cccaggatgc catttgctcg 600
gattggtccg catggagccc ctgcagtgta tcctgcggtg acggaagcca aatcaggacg 660
cgaactgagg tttctgctcc gcaacctgga acaccaacat gtccggactg ccctgcgccc 720
atgggaagga cttgcgtgga acaaggcgga cttgaagaaa ttcgtgaatg cagtgcgggg 780
gtatgtgctg ttgacgctgg atgtggcgtc tggggagagt ggtccgcctg gagcgcgtct 840
tgcggaaatg ccacaaggaa gcgagagcga acgcgttaca atgacccacc accccagggg 900
gcaggccgtc ggtgtgaaaa tcaggatccg ccggtgttac aggagcagac agaagaagca 960
actcttgctc cttgcataac tataccgcca actcccccag aatgggctgc atggagcgac 1020
tgcactgtca cgtgtggcgg tggcaatcgg catcgagtga gaaacgcact gccaccagga 1080
ctggggtcgc agaacggaga aagtgacgaa tcgctcgtgt ccaaactgtg gcctgggaca 1140
gatctacgac aggaggaagc atgtaatacc tcaccgtgtc ca 1182
<210> 3
<211> 24
<212> DNA
<213>SAG1 upstream primer sequences
<400> 3
aagaattctc ggatccccct cttg 24
<210> 4
<211> 24
<212> DNA
<213>SAG1 downstream primer sequences
<400> 4
atctcgagac tggctgttcc cgca 24
<210> 5
<211> 28
<212> DNA
<213>MIC2 upstream primer sequences
<400> 5
atcccgggct ggacatttgc tttcttat 28
<210> 6
<211> 26
<212> DNA
<213>MIC2 downstream primer sequences
<400> 6
aactcgagtg gacacggtga ggtatt 26
Claims (8)
1. a kind of recombinant protein composition for detecting toxoplasma antibody, it is characterised in that：The recombinant protein composition is by SAG1
The recombinant protein of specific epitopes and the recombinant protein composition of MIC2 specific epitopes.
2. a kind of recombinant protein composition for detecting toxoplasma antibody according to claim 1, it is characterised in that：It is described
The recombinant protein of SAG1 specific epitopes and the recombinant protein of MIC2 specific epitopes are in the recombinant protein composition according to identical
Concentration, same ratio mixing.
3. a kind of recombinant protein composition for detecting toxoplasma antibody according to claim 1, it is characterised in that：It is described
SAG1 specific epitopes are the 48th amino acid of SAG1 albumen n ends to 316 amino acid, and the MIC2 specific epitopes are MIC2 albumen
The 75th amino acid of N-terminal is to 468 amino acid.
4. a kind of preparation method for the recombinant protein composition for detecting toxoplasma antibody, it is characterised in that the preparation method includes
The following steps：
(1) screening of toxoplasma antibody diagnostic antigen epitope
Using on-line analysis instrument, analysis Infection of Toxoplasma Gondii SAG1 and MIC2 amino acid sequence total length filter out Infection of Toxoplasma Gondii SAG1 eggs
White specific antigen is located at the 48th amino acid to the 316th amino acid；Infection of Toxoplasma Gondii MIC2 protein-specifics antigen is located at the 75th
Individual amino acid is to the 468th amino acid；
(2) gene cloning of Infection of Toxoplasma Gondii SAG1 and MIC2 Protein Epitopes
Using bow-shaped worm dna as template, the genetic fragment of Infection of Toxoplasma Gondii SAG1 Protein Epitopes is expanded with SAG1 upstream and downstream primer；
The genetic fragment of Infection of Toxoplasma Gondii MIC2 Protein Epitopes is expanded with MIC2 upstream and downstream primer；Electrophoresis glue reclaim purpose fragment, -20
DEG C freeze standby；
(3) SAG1 and MIC2 protein expression vectors are built respectively
PGEX-4T-1 and pGEX-4T-2 plasmids are extracted, pGEX-4T-1 and pGEX-4T-2 is distinguished into glue after double digestion, electrophoresis and returned
Receive the plasmid fragments of double digestion；Glue reclaim double digestion purpose after Infection of Toxoplasma Gondii SAG1 albumen and MIC2 albumen difference double digestion, electrophoresis
Fragment；Double digestion plasmid and double digestion purpose fragment are pressed 1:3-10 ratios, with T4 ligases, 16 DEG C connect overnight, are recombinated
Plasmid.
5. a kind of preparation method of recombinant protein composition for detecting toxoplasma antibody according to claim 4, its feature
It is that the preparation method comprises the following steps：
The screening and identification of recombinant plasmid：
By recombinant plasmid transformed e. coli bl21 (DE3), it is coated with the LB flat boards containing ampicillin, 37 DEG C of constant incubators
Overnight；Next day random picking conversion bacterium colony and control bacterium colony, extract plasmid, carry out double digestion, run electrophoresis, can see phase respectively
The purpose fragment and carrier segments answered, as construction of expression vector success, positive expression bacterium；
Protein engineering bacterium high efficient expression：
Identification positive expression bacterium and control bacterium are seeded in the LB culture mediums containing ampicillin, 37 DEG C of constant-temperature tables vibrated
Night, next day presses 1:100 inoculations, 37 DEG C of constant-temperature tables vibrate 4h, plus final concentration of 0.5-1mmol/l IPTG, and 37 DEG C are continued to induce
2-6h；Centrifugation, collects precipitation thalline, then will precipitate bacterial cell disruption, and the supernatant precipitation of collection carries out SDS-PAGE detections respectively；
It was found that the destination protein of pGEX-4T-1/SAG1 and pGEX-4T-2/MIC2 expression obtains high expression respectively in supernatant
SAG1 and MIC2 anti-genic fragment albumen engineering bacteria；
The purifying of expressing protein：
The recombinant protein engineering bacteria of high efficient expression is centrifuged, precipitation thalline is collected, then precipitation thalline is resuspended in former centrifugation volume
1/10 lysate in, ice-bath ultrasonic thalline, centrifugation, collect bacterium solution supernatant；Take supernatant and 50% Glutathione-agarose resin
Homogenate is well mixed, centrifugation, abandons supernatant, and the PBS for collecting precipitation and 8-12 times of normal volume being added into precipitation is well mixed, from
The heart, then supernatant is abandoned, collect precipitation and the glutathione elution buffer of 1-3 times of volume is added into precipitation, mix, centrifuge, receive
The supernatant of collection is dialysed 24-48h in PBS, centrifuging and taking supernatant, i.e., obtain the antigenic destination proteins of SAG1 and MIC2, -20 DEG C respectively
It is standby.
6. a kind of preparation method of recombinant protein composition for detecting toxoplasma antibody according to claim 4, its feature
It is：The amplification condition of step (2)：Stage I:94℃3min；Stage II:94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 30 are followed
Ring；Stage III:72℃5min.
7. a kind of preparation method of recombinant protein composition for detecting toxoplasma antibody according to claim 4, its feature
It is：SAG1 and MIC2 upstream and downstream primer has sequence as follows respectively in step (2)：
SAG1 upstream primer sequences are：5’-AA GAATTC TCGGATCCCCCTCTTG-3’
SAG1 downstream primer sequences are：5’-AT CTCGAG ACTGGCTGTTCCCGCA-3’
MIC2 upstream primer sequences are：5’-AT CCCGGG CTGGACATTTGCTTTCTTAT-3’
MIC2 downstream primer sequences are：5’-AA CTCGAG TGGACACGGTGAGGTATT-3’.
8. a kind of preparation method of recombinant protein composition for detecting toxoplasma antibody according to claim 4, its feature
It is：Recombinant plasmid in step (3) is pGEX-4T-1/SAG1 and pGEX-4T-2/MIC2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710507519.2A CN107253983A (en) | 2017-06-28 | 2017-06-28 | A kind of recombinant protein composition for detecting toxoplasma antibody and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710507519.2A CN107253983A (en) | 2017-06-28 | 2017-06-28 | A kind of recombinant protein composition for detecting toxoplasma antibody and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107253983A true CN107253983A (en) | 2017-10-17 |
Family
ID=60023423
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710507519.2A Withdrawn CN107253983A (en) | 2017-06-28 | 2017-06-28 | A kind of recombinant protein composition for detecting toxoplasma antibody and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107253983A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108503707A (en) * | 2018-03-23 | 2018-09-07 | 浙江省医学科学院 | The nano antibody and its encoding gene of a kind of resisting toxoplasmosis SAG1 and application |
| CN111116726A (en) * | 2020-01-14 | 2020-05-08 | 中国农业科学院北京畜牧兽医研究所 | Recombinant protein for detecting toxoplasma gondii and coding gene thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006094665A1 (en) * | 2005-03-08 | 2006-09-14 | Kenton Srl | Chimeric recombinant antigens of toxoplasma gondii |
| CN101865920A (en) * | 2010-06-21 | 2010-10-20 | 常州二十一世纪生物技术研究所有限公司 | Method for detecting toxoplasma antibody |
-
2017
- 2017-06-28 CN CN201710507519.2A patent/CN107253983A/en not_active Withdrawn
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006094665A1 (en) * | 2005-03-08 | 2006-09-14 | Kenton Srl | Chimeric recombinant antigens of toxoplasma gondii |
| CN101865920A (en) * | 2010-06-21 | 2010-10-20 | 常州二十一世纪生物技术研究所有限公司 | Method for detecting toxoplasma antibody |
Non-Patent Citations (1)
| Title |
|---|
| 郑斌等: "弓形虫微线体蛋白的研究进展", 《国外医学寄生虫病分册》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108503707A (en) * | 2018-03-23 | 2018-09-07 | 浙江省医学科学院 | The nano antibody and its encoding gene of a kind of resisting toxoplasmosis SAG1 and application |
| CN111116726A (en) * | 2020-01-14 | 2020-05-08 | 中国农业科学院北京畜牧兽医研究所 | Recombinant protein for detecting toxoplasma gondii and coding gene thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111217920B (en) | N-S dominant epitope fusion protein of new coronavirus, preparation method and application thereof, expression protein, microorganism, application thereof and kit | |
| CN104497137B (en) | The general monoclonal antibody of African swine fever virus strain and preparation method and application | |
| CN104086652B (en) | Resisting O-type foot and mouth disease virus specificity single domain antibody and recombinant expression carrier thereof | |
| CN105440132B (en) | The monoclonal antibody and its application of porcine epidemic diarrhea resisting viral N proteins | |
| CN106596966B (en) | A kind of ox aftosa 3ABC antibody chemical luminescence detection kit | |
| CN103487582A (en) | Porcine reproductive and respiratory syndrome virus antibody competitive AlphaLISA detection kit and detection method thereof | |
| CN105399827A (en) | Wasabi protein nano antibody as well as encoding sequence and application thereof | |
| CN104862285A (en) | Porcine epidemic diarrhea virus antibody capture based ELISA detection method and application | |
| CN107102148A (en) | A kind of porcine reproductive and respiratory syndrome virus antibody detection method and its application | |
| CN114957454B (en) | anti-CSFV E2 protein nano antibody, fusion protein, preparation method and application thereof | |
| CN107253983A (en) | A kind of recombinant protein composition for detecting toxoplasma antibody and preparation method thereof | |
| CN106589082A (en) | Screening and application of active tuberculosis diagnosis molecules | |
| CN102321179B (en) | Hepatitis C virus recombination protein and gene sequence | |
| CN101915848A (en) | Application of RBD protein to preparation of auxiliary diagnostic agent for SARS patients | |
| CN106771237B (en) | A kind of ELISA kit for detecting porcine sapelo virus antibody | |
| CN105153287B (en) | A kind of recombinant protein for being used to diagnose ovine coenurosis | |
| CN105137076B (en) | Small-fragment gG antigen and application of small-fragment gG antigen in detecting pseudorabies virus gG antibody | |
| CN107098955A (en) | It is a kind of to be used to diagnose recombinant antigen composition of toxoplasma antibody and preparation method thereof | |
| CN107664694B (en) | A kind of ELISA kit based on E2 Protein Detection pig atypia pestivirus antibody | |
| CN113512110B (en) | BVDV nano antibody and preparation method and application thereof | |
| CN108486069A (en) | A kind of virus isolation procedure of Porcine epidemic diarrhea virus low content sample | |
| CN107422117A (en) | A kind of kit for detecting Latex agglutination test antibody | |
| CN101509002B (en) | Recombinant rubella virus protein and uses thereof | |
| CN101979406B (en) | Multi-epitope protein for South Africa type II foot-and-mouth disease, and preparation method and application thereof | |
| CN104897834A (en) | Method for detecting toxoplasma acute infection and target protein thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20171017 |
|
| WW01 | Invention patent application withdrawn after publication |