CN107245534A - RT LAMP primers group, kit and the detection method detected for zika virus - Google Patents
RT LAMP primers group, kit and the detection method detected for zika virus Download PDFInfo
- Publication number
- CN107245534A CN107245534A CN201710699361.3A CN201710699361A CN107245534A CN 107245534 A CN107245534 A CN 107245534A CN 201710699361 A CN201710699361 A CN 201710699361A CN 107245534 A CN107245534 A CN 107245534A
- Authority
- CN
- China
- Prior art keywords
- primer
- zika virus
- seq
- nucleotide sequence
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of zika virus genetic marker of the nucleotide sequence containing as shown in SEQ ID NO.1, and provide one group of LAMP primer according to the genetic marker, including positive outer primer F3, reverse outer primer B3, positive inner primer FIP, reverse inner primer BIP, forward direction ring primer LF and reverse ring primer LB, its nucleotide sequence is as shown in SEQ ID NO.2 to SEQ ID NO.7.The present invention further provides the zika virus detection kit containing the primer, and use the method for the primer quick detection zika virus.Primer of the present invention can specifically expand zika virus target sequence, and detection method of the present invention has higher sensitivity and faster reaction speed, can significantly shorten detection time, rapidly and accurately obtain testing result.
Description
Technical field
The present invention relates to a kind of method for detecting virus, and in particular to a kind of RT-LAMP quick determination methods of zika virus.
Background technology
Zika virus belongs to flaviviridae, Flavivirus, single strand plus RNA virus, diameter 20nm, is that one kind is entered by mosquito
The arboviruse that row is propagated, host is indefinite, main raw primate out of office and perches mosquito in the tree, such as aedes africanus
Middle circulation.The virus is most sent out earlier than nineteen forty-seven accidentally by yellow fever monitoring network in the rhesus macaque of stockaded village of Uganda card jungle
It is existing, found with after nineteen fifty-two in Uganda and Tanzania crowd.The viral activity compares concealment always, only all under the line
Africa, America, the Asia-pacific region enclosed have zika virus to infect Sporadic cases.An earliest outbreak of epidemic is 2007
Occur on Western Pacific Mi Keluoni subgroup Dao Yapu islands, bigger being once popular in -2014 years 2013 occurs in ocean
The French Polynesia in continent, has infected about 32000 people.Yellow-fever mosquito also propagates other three kinds of virus in flaviviridae, including steps on
Fever virus, chikungunya virus and yellow fever virus are removed from office, it is also main popular in subtropical and tropical zones.Decades ago, it is African
Researcher notice her mosquito-borne zika virus epidemic situation somehow or other follow yellow-fever mosquito propagate chikungunya virus epidemic situation after.
Similar rule starts from 2013, and when chikungunya virus is propagated from west to east, zika virus is closelyed follow.
In the prior art, detection zika virus often uses RT-PCR methods, and this method has to thermal cycle, right in detection practice
The dependence of thermal cycler instrument causes the increase of testing cost；RT-PCR methods detect the specific not ideal enough of zika virus simultaneously,
It is vulnerable to the influence of various different components in clinical sample, causes that testing result false positive rate is higher, sensitivity is also poor.
2000, Notomi etc. invented ring mediated constant temperature nucleic acid amplification technology (loop-mediated isothermal
Amplification of DNA, LAMP), nucleic acid amplification can be realized under isothermal conditions.The reaction principle of LAMP technology is,
Six on a pair of outer primers, a pair of inner primers and a pair of ring primer specificity identification target sequences designed according to sequence preservative area
Individual isolated area, causes in the presence of Bst Large fragment polymerases in self-loopa strand replacement reaction, 60~65 DEG C of scope 60min,
Magnesium pyrophosphate while a large amount of synthesis target dnas with accessory substance white, which is precipitated, to be produced.Because LAMP amplification procedures are relied on
Six isolated areas of target sequence are recognized, so atopic is very strong, and amplification process is carried out under constant temperature,
Detection time is greatly shortened, and quick sensitive.At present, LAMP technology is in bacterium and Viral diagnosis, drug resistant gene detection, parasitism
It is widely used in terms of worm detection, sex identification.But in the method for detecting virus of existing utilization LAMP technology, also deposit
The defect for easily causing false positive at some.
In order to increase the prevention and cure of viruses dynamics in zika virus fast propagation region, it is necessary to the further inspection of lifting zika virus
Degree of testing the speed, sensitivity, shorten detection time, it is therefore necessary to research and develop a kind of quick detection of the zika virus of utilization LAMP technology
Method.
The content of the invention
It is an object of the invention to：A kind of quick determination method of zika virus is provided, can significantly shorten detection time,
Rapidly and accurately obtain testing result.
The above-mentioned purpose of the present invention is achieved through the following technical solutions：
First, the present invention passes through NS5 genes (GenBank:KX421193.1) sequence analysis, and to this sequence in the U.S.
Ncbi database carries out gene order comparison, have found the conservative target sequence of zika virus NS5 genes, its nucleotide sequence is such as
Shown in SEQ ID NO.1.It will be appreciated by those skilled in the art that the specific fragment of the sequence can be used as detection zika virus
Genetic marker.
Conserved sequence of the present invention according to SEQ ID NO.1, devises the spy for detecting the genetic marker
Specific primer group, by positive outer primer (F3), reverse outer primer (B3), positive inner primer (FIP), reverse inner primer (BIP), just
To ring primer (LF) and reverse ring primer (LB) composition, its nucleotide sequence is as follows：
F3:GCAGAGCAATGGATGGGATA(SEQ ID NO.2)
B3:CCCATCCTTGAGGTACAGCT(SEQ ID NO.3)
FIP:AAGAACCTGAGGGCATGTGCAA-GACTCAAACGAATGGCGGT(SEQ ID NO.4)
BIP:CACAGGAGTGGAAACCCTCGAC-TGAAGTGGTGGGAGCAGA(SEQ ID NO.5)
LF:CACAACGCAGTCATCTCCAC(SEQ ID NO.6)
LB:TGGAGCAATTGGGAAGAAGTCC(SEQ ID NO.7)。
The present invention further provides the zika virus detection reagent containing primer shown in SEQID NO.2 to SEQID NO.7
Box.
In the currently preferred kit, the concentration of primer is as follows shown in SEQID NO.2 to SEQID NO.7：FIP
With BIP40pmol, F3 and B35pmol and LB and LF 20pmol.
In further preferred a kind of kit of the invention, in addition to the primer containing the concentration, further contain
20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH4)2SO4, 0.1% Tween 20,0.8M glycine betaine,
8mM MgSO4, 1.4mM each dNTP, 8U Bst archaeal dna polymerases and AMV reverse transcriptases.
In the further preferred another kit of the invention, in addition to the primer containing the concentration, further contain
There are Bst archaeal dna polymerases and AMV reverse transcriptases 8U, (NH4)2SO4 10mM、KCl 50mM、MgSO48mM, Tween 200.1%,
Each 1.4mM of glycine betaine 0.8M, dNTP, cresol red 2.0mM and phenol red 0.5mM.
The present invention also provides a kind of quick determination method of zika virus, based on ring mediated constant temperature nucleic acid amplification (LAMP) skill
Art, using the kit of the present invention containing primer shown in SEQID NO.2 to SEQID NO.7, comprises the following steps：
1) sample rna is extracted；
2) configuration primer and reaction system, carry out loop-mediated isothermal amplification；
3) detecting step 2) obtained amplified production, carry out result judgement.
Zika virus quick determination method of the present invention, it is a kind of preferred embodiment in, step 2) described in configuration
Primer and reaction system are according to following ratio：20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH4)2SO4、
0.1% Tween 20,0.8M glycine betaine, 8mM MgSO4, 1.4mM each dNTP, 8U Bst archaeal dna polymerases and AMV it is inverse
Transcriptase, FIP and BIP 40pmol, F3 and B3 5pmol and LB and LF 20pmol.
In zika virus quick determination method of the present invention, another preferred embodiment, step 2) described in match somebody with somebody
It is according to following ratio to put primer and reaction system：2.0mM cresol reds, 0.5mM phenol reds, 10mM KCl, 10mM (NH4)2SO4, 0.1% Tween 20,0.8M glycine betaine, 8mM MgSO4, 1.4mM each dNTP, 8U Bst archaeal dna polymerases and
AMV reverse transcriptases, FIP and BIP40pmol, F3 and B35pmol and LB and LF 20pmol.
In the currently preferred zika virus quick determination method, step 2) described in loop-mediated isothermal amplification reaction
Condition is：64~67 DEG C of 45~55min of isothermal reaction, using distilled water as negative control；Preferred reaction condition is：64 DEG C of perseverances
Temperature reaction 50min, using distilled water as negative control.
In the currently preferred zika virus quick determination method, step 3) described in the detection to amplified production adopt
Detected with real-time Turbidity measurement and/or fluorescence developing method, can so make step 2) loop-mediated isothermal amplification reaction after the completion of
It is covered, prevent air pollution well, effectively prevent false positive.
The present invention has been filtered out most preferably using the design of ring mediated constant temperature nucleic acid amplification method for zika virus specific gene
Primer, and kit is prepared into the primer, can delicately, rapidly detect zika virus.In addition, the present invention is also through excessive
Amount experiment sieving obtains optimal nucleic acid amplification reaction condition, and the detection method course of reaction finally given is quick, only need by
Reaction mixture keeps 50min to complete reaction under the conditions of 64 DEG C of constant temperature, can successfully detect concentration for 10 copies/
μ l STb gene and only special to zika virus target gene.In the prior art, researcher detect LAMP reaction results when often
Selection carries out electrophoresis to reaction result or adds SYBR Green I fluorescent dyes after completion of the reaction, and both approaches all make
Reaction product is exposed in air, pollutes environment, extremely easily causes false positive, and electrophoresis detection LAMP reactions are not
It can in real time reflect and real-time transmissometer and/or color developing detection are used in LAMP courses of reaction, preferred embodiments of the present invention so that reaction
After the completion of without uncapping, prevented well pollution, effectively prevent false positive, and LAMP courses of reaction can be reflected in real time.
Brief description of the drawings
Velocity contrast's experimental result of LAMP reactions occurs for the different primers that Fig. 1 is embodied described in embodiment 4.
The different samples that Fig. 2 is embodied described in embodiment 5 carry out the specific Turbidity measurement result of LAMP experiments.
The different samples that Fig. 3 is embodied described in embodiment 5 carry out the specific chromogenic testing result of LAMP experiments；In figure from
It is left-to-right to be respectively：Zika virus, chikungunya fever virus, dengue fever virus, yellow fever virus, H1N1 viruses, negative control.
Fig. 4 embodies the primer for using embodiment 1, the kit of embodiment 2 in condition described in embodiment 4 and comparative example 4-10
The result of lower progress LAMP reaction experiments.
Fig. 5 embodies the method sensitiveness Turbidity measurement experimental result of embodiment 4.
Fig. 6 embodies the method sensitiveness color developing detection experimental result of embodiment 4, and from left to right concentration is respectively：107Copy
Shellfish/μ l, 106Copy/μ l, 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102Copy/μ l, 101Copy/μ l, 100Copy
Shellfish/μ l, negative control.
Fig. 7 embodies PCR sensitivity experiments result described in comparative example 11, and template concentrations are followed successively by from right to left：107Copy
Shellfish/μ l, 106Copy/μ l, 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102Copy/μ l, 101Copy/μ l, 100Copy
Shellfish/μ l, negative control.DNA Marker are D2000.
Embodiment
The present invention is made below by way of the mode for enumerating specific embodiment and further being elaborated, but the model of the present invention
Enclose and should not be construed as limited to cited embodiment.
Instrument and reagent used in the embodiment of the present invention：
Commercialized viral RNA extracts kit；RNA amplification kit (RNA Amplification Kit), Japan is flourish
Grind KCC (EIKEN CHEMICAL CO., LTD, Tochigi, Japan)；LAMP reaction tubes (Reaction
Tube), Japanese Eiken Chemical；Chelex-100, glycine betaine, Sigma companies；Manganese chloride, magnesium sulfate, potassium chloride,
Sodium hydroxide, EDTA, ammonium sulfate, Chemical Reagent Co., Ltd., Sinopharm Group；Tris-HCl, the limited public affairs of Shanghai life section biotechnology
Department；Triton X-100, Beijing Mei Laibo medical science and technologies Co., Ltd；DNTP, Pharmacia company；NP-40, Fluka are public
Department；2 × Tap MIX kits, TIANGEN Biotech (Beijing) Co., Ltd.；Agarose, Amresco companies.Real-time transmissometer
La-320C, Japanese Eiken Chemical；Constant-temperature metal bath：Hangzhou BIOER Technology Co., Ltd；Spectrophotometer：
NanoDrop ND-1000；Gel imaging system, Bio-Rad companies.
The preparation of RNA templates
Sample is extracted by Tiangeng RNA virus nucleic acid extraction kit.
LAMP reacts the design of primer
By to zika virus NS5 genes (GenBank:KX421193.1) sequence carries out bioinformatic analysis, it is determined that
Target sequence, and blast is carried out in U.S.'s ncbi database to this target sequence, as a result show that the specificity of selected sequence is preferable, can
Using the target sequence designed as LAMP primer.
It is six independent regions by DNA to be amplified points, according to needed for this six regions separately design LAMP reactions
Primer (inner primer FIP and BIP, outer primer F3 and B3, ring primer LB, LF), designs 4 sets of LAMP primer amplification target genes altogether, point
Not as embodiment 1 (shown in SEQ ID No.2~No.7), comparative example 1 (shown in SEQ ID No.8~No.11), comparative example 2
(shown in SEQ ID No.12~No.16) and comparative example 3 (shown in SEQ ID No.17~No.20).
Embodiment 1
One group is used to detect the RT-LAMP primers of zika virus genetic marker, by positive outer primer (F3), reversely outer draws
Thing (B3), positive inner primer (FIP), reverse inner primer (BIP), positive ring primer (LF) and reverse ring primer (LB) composition, its
Nucleotide sequence is expressed as follows：
NS1-F3:GCAGAGCAATGGATGGGATA(SEQ ID NO.2)
NS1-B3:CCCATCCTTGAGGTACAGCT(SEQ ID NO.3)
NS1-FIP:AAGAACCTGAGGGCATGTGCAA-GACTCAAACGAATGGCGGT(SEQ ID NO.4)
NS1-BIP:CACAGGAGTGGAAACCCTCGAC-TGAAGTGGTGGGAGCAGA(SEQ ID NO.5)
NS1-LF:CACAACGCAGTCATCTCCAC(SEQ ID NO.6)
NS1-LB:TGGAGCAATTGGGAAGAAGTCC(SEQ ID NO.7)
Comparative example 1
One group is used to detect the RT-LAMP primers of zika virus genetic marker, by positive outer primer (F3), reversely outer draws
Thing (B3), positive inner primer (FIP), reverse inner primer (BIP) composition, its nucleotide sequence are expressed as follows：
NS2-F3:AGCCAGAGAAAGTGACCAGA(SEQ ID NO.8)
NS2-B3:CCCAATTGCTCCATCCAGT(SEQ ID NO.9)
NS2-FIP:CGATTGGCTTCACAACGCAGTC-GCAGAGCAATGGATGGGAT(SEQ ID NO.10)
NS2-BIP:TAGGTTTGCACATGCCCTCAGG-GAGGGTTTCCACTCCTGTG(SEQ ID NO.11)
Comparative example 2
One group is used to detect the RT-LAMP primers of zika virus genetic marker, by positive outer primer (F3), reversely outer draws
Thing (B3), positive inner primer (FIP), reverse inner primer (BIP), positive ring primer (LF) composition, its nucleotide sequence are represented such as
Under：
NS3-F3:CGACTGGATGGAGCAATTGG(SEQ ID NO.12)
NS3-B3:AAAGGAGCTGCCACATCTG(SEQ ID NO.13)
NS3-FIP:CGGCAAGGGACCACAATGGATC-TTCTGCTCCCACCACTTCA(SEQ ID NO.14)
NS3-BIP:TGAACTGATTGGCCGAGCTCG-GCAAGACAGGCAGTCTCC(SEQ ID NO.15)
NS3-LF:CCATCCTTGAGGTACAGCTTGT(SEQ ID NO.16)
Comparative example 3
One group is used to detect the RT-LAMP primers of zika virus genetic marker, by positive outer primer (F3), reversely outer draws
Thing (B3), positive inner primer (FIP), reverse inner primer (BIP) composition, its nucleotide sequence are expressed as follows：
NS4-F3:GGACCATTGGATGGGAAGAG(SEQ ID NO.17)
NS4-B3:TTAATCACGGCCAACGCC(SEQ ID NO.18)
NS4-FIP:ATCTTTCCTCCTGGTGCCCGAT-AGGTGGAGTCGAAGGGTTAG(SEQ ID NO.19)
NS4-BIP:GGCTGGGACACCCGCATTAG-GTGCCCTTCCTCCATTTGG(SEQ ID NO.20)
Embodiment 2
A kind of zika virus detection kit containing primer described in embodiment 1, the Tris-HCl (pH containing 20mM
8.8), 10mM KCl, 10mM (NH4)2SO4, 0.1% Tween 20,0.8M glycine betaine, 8mM MgSO4, 1.4mM it is each
DNTP, 8U Bst archaeal dna polymerases and AMV reverse transcriptases；The concentration of primer is as follows described in embodiment 1：FIP and BIP40pmol,
F3 and B35pmol and LB and LF 20pmol.
Embodiment 3.
A kind of zika virus detection kit containing primer described in embodiment 1, it is inverse containing Bst archaeal dna polymerases and AMV
Transcriptase 8U；(NH4)2SO410mM；KCl 50mM；MgSO48mM；Tween 20 0.1%；Glycine betaine 0.8M；dNTP(each)
1.4mM, cresol red 2.0mM, phenol red 0.5mM.Primer concentration be the same as Example 2, DNA profiling amount is 2.0 μ l, uses 1%KOH solution
Adjust pH to 8.8.
Embodiment 4.LAMP reaction speed contrast experiments
Respectively with 4 groups of primers described in embodiment 1, comparative example 1, comparative example 2 and comparative example 3 in the same way to stockaded village's card disease
Poison carries out LAMP amplifications, and specific method includes：
Take in 25 μ l reactant mixtures, the reactant mixture and also included in addition to primer：20mMTris-HCl (pH8.8),
10mMKCl, 10mM (NH4)2SO4, 0.1%Triton X-100,0.8M glycine betaines, 8mM MgSO4, 1.4mMdNTP, 8U Bst
Archaeal dna polymerase and AMV reverse transcriptases.Each primer concentration in reactant mixture is：FIP and/or BIP 40pmol, F3 and/or
B3 5pmol, LB and/or LF20pmol.
Mixture is placed in 65 DEG C of isothermal reaction 60min.Using distilled water as negative control.Reaction tube was determined every 6 seconds
Turbidity simultaneously is depicted as curve to judge the yin and yang attribute of reaction.Turbidity measurement result is shown, as shown in figure 1, drawing described in embodiment 1
Primer of the thing group compared to comparative example 1-3 all there occurs that LAMP reacts earlier.
Embodiment 5.LAMP atopic contrast experiments
Using the primer described in embodiment 1, respectively to zika virus, chikungunya fever virus, dengue fever virus, yellow fever
5 samples such as degree, H1N1 viruses carry out LAMP experiments, and Turbidity measurement and color developing detection are carried out to experimental result, as a result such as Fig. 2,3
It is shown.EP pipes in Fig. 3 from left to right are corresponded to respectively：Zika virus, chikungunya fever virus, dengue fever virus, yellow fever virus,
H1N1 viruses, negative control, wherein only showing yellow in the EP pipes of the corresponding zika virus of the leftmost side, show in other EP pipes
It is red.The primer shown in embodiment 1 is can be seen that from the result can specifically amplify zika virus target sequence, have
Good specificity.
Embodiment 6：
Using the method for LAMP reaction detection zika viruses, following steps are specifically included：
1) sample to be tested RNA is extracted；
2) according to the proportional arrangement primer and reaction system of kit described in embodiment 2, then take that 25 μ l have configured is anti-
Mixture is answered, 64 DEG C is placed in and carries out loop-mediated isothermal amplification 60min；
3) in step 2) turbidity of reaction tube was determined during amplified reaction every 6 seconds, virus is judged according to measurement result
Testing result.
Embodiment 7：
Using the method for LAMP reaction detection zika viruses, following steps are specifically included：
1) sample to be tested RNA is extracted；
2) according to the proportional arrangement primer and reaction system of kit described in embodiment 3, then take that 25 μ l have configured is anti-
Mixture is answered, 64 DEG C is placed in and carries out loop-mediated isothermal amplification 60min；
3) in step 2) after the completion of amplified reaction, color developing detection is carried out to reaction product, result judgement Viral diagnosis knot is determined
Really.
Comparative example 4-10：
Zika virus detection is carried out using method substantially the same manner as Example 6, it is differed only in, step 2) described in
Loop-mediated isothermal amplification temperature is respectively：60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 65 DEG C, 66 DEG C and 67 DEG C.
Comparative analysis：
The turbidimetric analysis turbidimetry result of embodiment 6 and comparative example 4-10 detection method is changed with time respectively and does curve
Figure, as a result as shown in Figure 4, it can be seen that LAMP reactions can occur earliest for the temperature that the detection method of embodiment 6 is used, and
And reaction effect is optimal.
Embodiment 8.LAMP reaction sensibilities are tested
In order to verify the detection sensitivity of LAMP method of the present invention, with zika virus NS5 gene clonings to carrier T, with
Plasmid containing NS5 genes is detection object, calculates copy number and carries out 10 times of dilutions so that final nucleic acid concentration difference
For 107Copy/μ l, 106Copy/μ l, 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102Copy/μ l, 101Copy/μ l,
100Copy/μ l, and negative control is used as using distilled water.Then LAMP reactions are carried out using the method for embodiment 4, be respectively adopted
Development process (addition pH indicator) and nephelometry carry out testing result.
The plasmid template of above-mentioned 10 times of gradient dilutions is reacted for LAMP, testing result is as shown in Figure 5,6.In Fig. 6 from
Left-to-right EP manages corresponding concentration：107Copy/μ l, 106Copy/μ l, 105Copy/μ l, 104Copy/μ l, 103Copy
Shellfish/μ l, 102Copy/μ l, 101Copy/μ l, 100Copy/μ l and negative control, wherein only rightmost side correspondence 100Copy/μ l
Red is shown in the EP pipes of concentration and negative control, equal displaing yellow in other EP pipes.As can be seen here, decoration method experimental result with it is turbid
Degree method is consistent, and LAMP minimal detectable concentrations are 10 copies/μ l.
Comparative example 11.PCR sensitivity experiments
The plasmid of above-mentioned 10 times of gradient dilutions is reacted for PCR, primer is NS1F3, NS1B3.25 μ l PCR reactions are mixed
The composition of compound cumulative volume：1 μ l templates, each 10pmol primers, 12.5 μ 2 × Taq of l MIX.Amplification cycles condition is：94 DEG C pre-
5min is denatured, afterwards 94 DEG C of denaturation 30s；55 DEG C of annealing 30s；72 DEG C of extension 30s, totally 40 circulations, finally extend 7min.Take
PCR primer 5 μ l, the 120V electrophoresis 35min on 1% agarose gel electrophoresis containing EB, take pictures detection under gel imaging system.Inspection
Result is surveyed as shown in fig. 7, template concentrations are followed successively by from right to left：107Copy/μ l, 106Copy/μ l, 105Copy/μ l, 104Copy
Shellfish/μ l, 103Copy/μ l, 102Copy/μ l, 101Copy/μ l, 100Copy/μ l, negative control, it is known that PCR minimal detectable concentrations
For 1000 copies/μ l.
As can be seen here, detection method of the invention is 100 times of PCR methods for the detection sensitivity of zika virus.
Sequence table
<110>China Inst. of Quarantine Inspection Sciences
<120>RT-LAMP primer sets, kit and the detection method detected for zika virus
<130> LP0156
<141> 2017-08-15
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1999
<212> DNA
<213>Stockaded village card NS5
<400> 1
tcagctcctc ctgggacgca tggatggccc caggaggcca gtgaaatatg aggaggatgt 60
gaacctcggc tcgggtacac gagctgtggc aagctgtgct gaggctccta acatgaaaat 120
catcggcagg cgcattgaga gaatccgcaa tgaacatgca gaaacatggt ttcttgatga 180
aaaccaccca tacaggacat gggcctacca tgggagctac gaagccccca cgcaaggatc 240
agcgtcttcc ctcgtgaacg gggttgttag actcctgtca aagccttggg acgtggtgac 300
tggagttaca ggaatagcca tgactgacac cacaccatac ggccaacaaa gagtcttcaa 360
agaaaaagtg gacaccaggg tgccagatcc ccaagaaggc actcgccagg taatgaacat 420
agtctcttcc tggctgtgga aggagctggg gaaacgcaag cggccacgcg tctgcaccaa 480
agaagagttt atcaacaagg tgcgcagcaa tgcagcactg ggagcaatat ttgaagagga 540
aaaagaatgg aagacggctg tggaagctgt gaatgatcca aggttttggg ccctagtgga 600
tagggagaga gaacaccacc tgagaggaga gtgtcacagc tgtgtgtaca acatgatggg 660
aaaaagagaa aagaagcaag gagagttcgg gaaagcaaaa ggtagccgcg ccatctggta 720
catgtggttg ggagccagat tcttggagtt tgaagccctt ggattcttga acgaggacca 780
ttggatggga agagaaaact caggaggtgg agtcgaaggg ttaggattgc aaagacttgg 840
atacattcta gaagaaatga atcgggcacc aggaggaaag atgtacgcag atgacactgc 900
tggctgggac acccgcatta gtaagtttga tctggagaat gaagctctga ttaccaacca 960
aatggaggaa gggcacagaa ctctggcgtt ggccgtgatt aaatacacat accaaaacaa 1020
agtggtgaag gttctcagac cagctgaagg aggaaaaaca gttatggaca tcatttcaag 1080
acaagaccag agagggagtg gacaagttgt cacttatgct ctcaacacat tcaccaactt 1140
ggtggtgcag cttatccgga acatggaagc tgaggaagtg ttagagatgc aagacttatg 1200
gttgttgagg aagccagaga aagtgaccag atggttgcag agcaatggat gggatagact 1260
caaacgaatg gcggtcagtg gagatgactg cgttgtgaag ccaatcgatg ataggtttgc 1320
acatgccctc aggttcttga atgacatggg aaaagttagg aaagacacac aggagtggaa 1380
accctcgact ggatggagca attgggaaga agtcccgttc tgctcccacc acttcaacaa 1440
gctgtacctc aaggatggga gatccattgt ggtcccttgc cgccaccaag atgaactgat 1500
tggccgagct cgcgtctcac caggggcagg atggagcatc cgggagactg cctgtcttgc 1560
aaaatcatat gcgcagatgt ggcagctcct ttatttccac agaagagacc ttcgactgat 1620
ggctaatgcc atttgctcgg ctgtgccagt tgactgggta ccaactggga gaaccacctg 1680
gtcaatccat ggaaagggag aatggatgac cactgaggac atgctcatgg tgtggaatag 1740
agtgtggatt gaggagaacg accatatgga ggacaagact cctgtaacaa aatggacaga 1800
cattccctat ctaggaaaaa gggaggactt atggtgtgga tcccttatag ggcacagacc 1860
ccgcaccact tgggctgaaa acatcaaaga cacagtcaac atggtgcgca ggatcatagg 1920
tgatgaagaa aagtacatgg actatctatc cacccaagtc cgctacttgg gtgaggaagg 1980
gtccacaccc ggagtgttg 1999
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
gcagagcaat ggatgggata 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
cccatccttg aggtacagct 20
<210> 4
<211> 41
<212> DNA
<213>Artificial sequence
<400> 4
aagaacctga gggcatgtgc aagactcaaa cgaatggcgg t 41
<210> 5
<211> 40
<212> DNA
<213>Artificial sequence
<400> 5
cacaggagtg gaaaccctcg actgaagtgg tgggagcaga 40
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
cacaacgcag tcatctccac 20
<210> 7
<211> 22
<212> DNA
<213>Artificial sequence
<400> 7
tggagcaatt gggaagaagt cc 22
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence
<400> 8
agccagagaa agtgaccaga 20
<210> 9
<211> 19
<212> DNA
<213>Artificial sequence
<400> 9
cccaattgct ccatccagt 19
<210> 10
<211> 41
<212> DNA
<213>Artificial sequence
<400> 10
cgattggctt cacaacgcag tcgcagagca atggatggga t 41
<210> 11
<211> 41
<212> DNA
<213>Artificial sequence
<400> 11
taggtttgca catgccctca gggagggttt ccactcctgt g 41
<210> 12
<211> 21
<212> DNA
<213>Artificial sequence
<400> 12
cgactggatg gagcaattgr g 21
<210> 13
<211> 19
<212> DNA
<213>Artificial sequence
<400> 13
aaaggagctg ccacatctg 19
<210> 14
<211> 41
<212> DNA
<213>Artificial sequence
<400> 14
cggcaaggga ccacaatgga tcttctgctc ccaccacttc a 41
<210> 15
<211> 39
<212> DNA
<213>Artificial sequence
<400> 15
tgaactgatt ggccgagctc ggcaagacag gcagtctcc 39
<210> 16
<211> 22
<212> DNA
<213>Artificial sequence
<400> 16
ccatccttga ggtacagctt gt 22
<210> 17
<211> 20
<212> DNA
<213>Artificial sequence
<400> 17
ggaccattgg atgggaagag 20
<210> 18
<211> 18
<212> DNA
<213>Artificial sequence
<400> 18
ttaatcacgg ccaacgcc 18
<210> 19
<211> 42
<212> DNA
<213>Artificial sequence
<400> 19
atctttcctc ctggtgcccg ataggtggag tcgaagggtt ag 42
<210> 20
<211> 39
<212> DNA
<213>Artificial sequence
<400> 20
ggctgggaca cccgcattag gtgcccttcc tccatttgg 39
Claims (10)
1. a kind of genetic marker for being used to detect zika virus, it is characterised in that：Contain the nucleosides as shown in SEQ ID NO.1
Acid sequence.
2. the specific primer for detecting zika virus, including：
Positive outer primer F3, its nucleotide sequence is as shown in SEQ ID NO.2；
Reverse outer primer B3, its nucleotide sequence is as shown in SEQ ID NO.3；
Positive inner primer FIP, its nucleotide sequence is as shown in SEQ ID NO.4；
Reverse inner primer BIP, its nucleotide sequence is as shown in SEQ ID NO.5；
Positive ring primer LF, its nucleotide sequence is as shown in SEQ ID NO.6；And,
Reverse ring primer LB, its nucleotide sequence is as shown in SEQ ID NO.7.
3. a kind of kit for detecting zika virus, it is characterised in that：Containing the primers F 3 described in claim 2, B3, FIP,
BIP, LF and LB.
4. the kit described in claim 3, it is characterised in that：Further contain Bst archaeal dna polymerases and AMV reverse transcriptases
8U、(NH4)2SO4 10mM、KCl 50mM、MgSO48mM, Tween 20 0.1%, each 1.4mM of glycine betaine 0.8M, dNTP, cresols
Red 2.0mM and phenol red 0.5mM.
5. any one kit described in claim 3 or 4, it is characterised in that：The concentration of described primer is as follows：FIP and
BIP40pmol, F3 and B35pmol and LB and LF 20pmol.
6. a kind of quick determination method of zika virus, based on ring mediated constant temperature nucleic acid amplification (LAMP) technology, usage right will
The kit described in 3 is sought, is comprised the following steps：
1) sample rna is extracted；
2) configuration primer and reaction system, carry out loop-mediated isothermal amplification；
3) detecting step 2) obtained amplified production, carry out result judgement.
7. the zika virus quick determination method described in claim 6, it is characterised in that：Step 2) described in configuration primer and anti-
It is according to following ratio to answer system：2.0mM cresol reds, 0.5mM phenol reds, 10mM KCl, 10mM (NH4)2SO4, 0.1%
Tween 20,0.8M glycine betaine, 8mM MgSO4, 1.4mM each dNTP, 8U Bst archaeal dna polymerases and AMV reverse transcriptases,
FIP and BIP40pmol, F3 and B35pmol and LB and LF 20pmol.
8. the zika virus quick determination method described in claim 6, it is characterised in that：Step 2) described in loop-mediated isothermal expand
Increasing reaction condition is：64~67 DEG C of 45~55min of isothermal reaction, using distilled water as negative control.
9. the zika virus quick determination method described in claim 6, it is characterised in that：Step 2) described in loop-mediated isothermal expand
Increasing reaction condition is：64 DEG C of isothermal reaction 50min, using distilled water as negative control.
10. the zika virus quick determination method described in claim 6, it is characterised in that：Step 3) described in amplified production
Detection use real-time Turbidity measurement and/or color developing detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710699361.3A CN107245534A (en) | 2017-08-15 | 2017-08-15 | RT LAMP primers group, kit and the detection method detected for zika virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710699361.3A CN107245534A (en) | 2017-08-15 | 2017-08-15 | RT LAMP primers group, kit and the detection method detected for zika virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107245534A true CN107245534A (en) | 2017-10-13 |
Family
ID=60012848
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710699361.3A Pending CN107245534A (en) | 2017-08-15 | 2017-08-15 | RT LAMP primers group, kit and the detection method detected for zika virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107245534A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107574265A (en) * | 2017-11-01 | 2018-01-12 | 张薇 | A kind of primer sets, kit and detection method for being used to detect zika virus |
| CN108754021A (en) * | 2018-06-12 | 2018-11-06 | 南阳师范学院 | A kind of ring mediated isothermal amplification detection reagent of duck hepatitis B virus |
| CN110628949A (en) * | 2019-10-10 | 2019-12-31 | 中国检验检疫科学研究院 | Kit for rapidly detecting Zika virus |
| CN110982934A (en) * | 2019-11-26 | 2020-04-10 | 广州迪澳生物科技有限公司 | Zika virus loop-mediated constant temperature fluorescence detection primer group and kit for eliminating false negative |
| CN112359138A (en) * | 2020-11-03 | 2021-02-12 | 西安交通大学 | Reverse transcription loop-mediated isothermal amplification rapid detection SARS-COV-2 kit based on color determination |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104937108A (en) * | 2012-08-23 | 2015-09-23 | 新英格兰生物实验室公司 | Detection of an amplification reaction product using ph-sensitive dyes |
| CN106244726A (en) * | 2016-08-19 | 2016-12-21 | 中检国研(北京)科技有限公司 | A kind of zika virus loop-mediated isothermal amplification detection kit and using method |
| CN106868217A (en) * | 2017-03-08 | 2017-06-20 | 海南医学院 | A kind of detection primer of zika virus and application |
| CN106884057A (en) * | 2017-03-22 | 2017-06-23 | 广州中医药大学 | A kind of visible detection method of zika virus |
| CN106884056A (en) * | 2017-02-08 | 2017-06-23 | 广州医科大学附属第三医院 | Detect primer, kit and the method for zika virus |
-
2017
- 2017-08-15 CN CN201710699361.3A patent/CN107245534A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104937108A (en) * | 2012-08-23 | 2015-09-23 | 新英格兰生物实验室公司 | Detection of an amplification reaction product using ph-sensitive dyes |
| CN106244726A (en) * | 2016-08-19 | 2016-12-21 | 中检国研(北京)科技有限公司 | A kind of zika virus loop-mediated isothermal amplification detection kit and using method |
| CN106884056A (en) * | 2017-02-08 | 2017-06-23 | 广州医科大学附属第三医院 | Detect primer, kit and the method for zika virus |
| CN106868217A (en) * | 2017-03-08 | 2017-06-20 | 海南医学院 | A kind of detection primer of zika virus and application |
| CN106884057A (en) * | 2017-03-22 | 2017-06-23 | 广州中医药大学 | A kind of visible detection method of zika virus |
Non-Patent Citations (3)
| Title |
|---|
| SHABMAN, R.等: "登录号：KX601169.1", 《GENBANK》 * |
| XUAN WANG等: "Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| 何国庆: "《食品微生物检验技术》", 30 November 2013 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107574265A (en) * | 2017-11-01 | 2018-01-12 | 张薇 | A kind of primer sets, kit and detection method for being used to detect zika virus |
| CN108754021A (en) * | 2018-06-12 | 2018-11-06 | 南阳师范学院 | A kind of ring mediated isothermal amplification detection reagent of duck hepatitis B virus |
| CN110628949A (en) * | 2019-10-10 | 2019-12-31 | 中国检验检疫科学研究院 | Kit for rapidly detecting Zika virus |
| CN110628949B (en) * | 2019-10-10 | 2022-11-15 | 中国检验检疫科学研究院 | Kit for rapidly detecting Zika virus |
| CN110982934A (en) * | 2019-11-26 | 2020-04-10 | 广州迪澳生物科技有限公司 | Zika virus loop-mediated constant temperature fluorescence detection primer group and kit for eliminating false negative |
| CN112359138A (en) * | 2020-11-03 | 2021-02-12 | 西安交通大学 | Reverse transcription loop-mediated isothermal amplification rapid detection SARS-COV-2 kit based on color determination |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107245534A (en) | RT LAMP primers group, kit and the detection method detected for zika virus | |
| CN105506188B (en) | For detecting the fluorescence RT-PCR primer and fluorescence probe, kit and detection method of Asian type zika virus | |
| CN111321249A (en) | Loop-mediated isothermal amplification detection primer group, kit and method for SARS-CoV-2 | |
| CN108330210B (en) | Zika virus, dengue virus and chikungunya virus nucleic acid detection kit and application thereof | |
| CN106244726A (en) | A kind of zika virus loop-mediated isothermal amplification detection kit and using method | |
| CN106868220A (en) | A kind of LAMP primer group and kit for expanding MERS CoV | |
| CN111621592A (en) | Primer composition for detecting novel coronavirus and detection method | |
| CN101178350B (en) | Detect the kit of rabies viruses | |
| CN110982916B (en) | Primer combination and detection kit for detecting shiga toxin-producing escherichia coli | |
| CN112458201A (en) | Fluorescent RT-RPA primer, probe and detection method for detecting novel coronavirus | |
| CN102952892B (en) | Loop-mediated isothermal amplification kit for detecting West Nile viruses, and its application | |
| Hrdy et al. | MOL-PCR and xMAP Technology: A Multiplex System for Fast Detection of Food-and Waterborne Viruses | |
| CN116949197A (en) | Establishment of four common cryptosporidium RAA detection methods | |
| ES2521018T3 (en) | Method for the specific detection of classical swine fever virus | |
| CN111206122A (en) | Novel coronavirus nucleic acid detection kit | |
| CN107400734B (en) | Loop-mediated isothermal amplification Zika virus detection kit | |
| CN106929601B (en) | High-sensitivity human papilloma virus 6,11 type nucleic acid detection kit | |
| WO2022107023A1 (en) | Systems for the detection of targeted gene variations and viral genomes and methods of producing and using same | |
| CN110093429B (en) | High-flux quantitative detection kit for diarrheal pathogenic bacteria | |
| KR102168400B1 (en) | Screening and qualitative methods of HPV types and type 16 related to oral cencer using Real-time PCR and Melting Curve Analysis | |
| CN107385116B (en) | Method for detecting type 1 human immunodeficiency virus and special reagent set thereof | |
| CN111139316B (en) | RT-LAMP kit for detecting yellow fever virus and special primer thereof | |
| KR101755037B1 (en) | Method for detection of HCV at the real time PCR with intercalating dye | |
| CN113249516B (en) | Primer group of 2019-nCoV and 2019-nCoV nucleic acid detection kit | |
| KR20200092653A (en) | Universal Primer Sets for Detecting Flavivirus and Use Thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171013 |
|
| RJ01 | Rejection of invention patent application after publication |