CN102952892B - Loop-mediated isothermal amplification kit for detecting West Nile viruses, and its application - Google Patents
Loop-mediated isothermal amplification kit for detecting West Nile viruses, and its application Download PDFInfo
- Publication number
- CN102952892B CN102952892B CN201110241233.7A CN201110241233A CN102952892B CN 102952892 B CN102952892 B CN 102952892B CN 201110241233 A CN201110241233 A CN 201110241233A CN 102952892 B CN102952892 B CN 102952892B
- Authority
- CN
- China
- Prior art keywords
- primer
- west nile
- isothermal amplification
- mediated isothermal
- nile virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a loop-mediated isothermal amplification kit for detecting West Nile viruses, and its application. Special primers provided by the invention comprise a first primer, a second primer, a third primer and a fourth primer, and the nucleotide sequences of the first primer, the second primer, the third primer and the fourth primer are respectively represented by sequence 1, sequence 2, sequence 3 and sequence 4 in a sequence table. Experiments in the invention prove that the special primers are suitable for detecting the specificities of the West Nile viruses. The loop-mediated isothermal amplification kit has the advantages of performing of an amplification reaction at a constant temperature without special equipment, high specificity, rapidness and high efficiency to realize the completion of the amplification reaction within 35min, high sensitivity, and convenient and simple identification. The loop-mediated isothermal amplification kit is especially suitable for rapidly detecting clinic specimens and field onsite specimens.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of loop-mediated isothermal amplification kit and application thereof that detects west nile virus.
Background technology
The west Nile fever that West Nile virus infection causes is the zoonosis that mosquito matchmaker propagates.Most of patients is inferior clinical symptom, and west Nile fever can appear in approximately 20% the infected after 3-14d.Its illness may comprise fever, headache, physical distress, lymph gland swelling, sometimes has eruption symptom.Illness continues approximately one week conventionally.West Nile virus infection can cause viral encephalitis, causes high fever, headache, mental derangement, faint, sometimes also there will be paralysis, accidentally can cause death.
West nile virus 1999 in the past mainly in Africa, the Middle East, West Asia and Europe popular.Romania in 1996 break out Europe first west Nile fever be very popular.Popular 14 areas that concentrate on basin, Danube, viral infection rate is about 12,14/,100,000.Russian south in 1999 also breaks out that west nile encephalitis is popular on a large scale, approximately has 1000 cases, and at least 40 people are dead.Within 1999, U.S.'s the first explosion west Nile fever is popular, and this is that west Nile fever is popular first in the western hemisphere.Since then, it is popular that the U.S. all breaks out west Nile fever/west nile encephalitis over the years, and west nile virus distributes and from 4 states in 1999, to spread to 2004 and be close on 50 states, and propagate into the Canadian middle and south and Caribbean.Even to this day, West Nile virus infection has become global serious public health health problem.
The main dependence of west nile encephalitis diagnosis detected virus and antibody thereof, and during due to viremia, virus load is low, and decubation virus be eliminated, therefore isolated viral difficulty comparatively from blood or cerebrospinal fluid.New diagnostic techniques comprises by ELISA method to be surveyed antigen or measures west nile virus nucleic acid by PCR and PCR in real time.Wherein PCR in real time is the most responsive in these diagnostic techniques methods, but still can not detect all west nile encephalitis patients.These traditional methods etc. often need to take a long time or need specific instrument, are difficult to meet the needs of epidemic outbreaks quick diagnosis.
Ring mediated isothermal amplification method (loop-mediated isothermal amplification, LAMP) method has the advantages that under isothermal condition, to get final product high speed, quick, high special, high-sensitive amplified target sequence.When nucleic acid synthesizes in a large number, dNTP can separate out a large amount of pyrophosphate ions, the Mg in pyrophosphate ion and LAMP system
2+(or Mn
2+) combination, produce magnesium pyrophosphate or manganese pyrophosphate precipitation, thereby the turbidity of the liquid that induces reaction changes, and is highly susceptible to judgement.In addition, utilize some fluorochromes, as SYBR green I dyestuff or with fluorexon indication LAMP, react.SYBRgreen I dyestuff can be combined with double-stranded DNA product, and when having product to increase in a large number, reaction system presents significant fluorescent signal and changes.Fluorexon is in reaction when initial and Mn
2+in conjunction with, it is orange that reaction solution shows transparency, and when having nucleic acid product to synthesize in a large number, can generate by product pyrophosphate, makes Mg
2+dissociate out, be combined with fluorexon, finally make reaction solution show micro-turbid yellow-green colour.Because LAMP method test requirement condition is low, result is easy to judgement, and the investigation of very suitable basic unit virus, carries out animal health prevention and control timely.
Summary of the invention
An object of the present invention is to provide a kind of primer special that detects west nile virus.
Primer special provided by the invention, comprises primer 1, primer 2, primer 3 and primer 4, and the nucleotide sequence of described primer 1, described primer 2, described primer 3 and described primer 4 is respectively sequence 1, sequence 2, sequence 3 and the sequence 4 in sequence table.
Described primer special also comprises primer 5, and the nucleotides sequence of described primer 5 is classified the sequence 5 of sequence table as.
Described primer special is comprised of described primer 1, described primer 2, described primer 3, described primer 4 and described primer 5;
Described west nile virus is specially west nile virus Chin-01 strain.
In described primer special, 5 ' end and/or the 3 ' end of F3, B3, FIP, BIP, LB also can extend according to target sequence; In described primer special, F3, B3, FIP, BIP, LB also can carry out replacement and/or the replacement of base, keep the homology of 6 bases 100% of 3 ' end sequence.TTTT in FIP and BIP (underscore person) is catenation sequence, and its length is generally 4, and number can corresponding shortening and prolongation.
Second object of the present invention is to provide a kind of ring mediated isothermal amplification (LAMP) reagent that detects west nile virus.
Reagent provided by the invention, comprises RNA reversed transcriptive enzyme, Bst archaeal dna polymerase, 2 * ring mediated isothermal amplification damping fluid, described primer special.
Described amplifing reagent also comprises fluorexon;
Described amplifing reagent is comprised of RNA reversed transcriptive enzyme, Bst archaeal dna polymerase, 2 * ring mediated isothermal amplification damping fluid, described primer special and fluorexon;
Primer 1 in described primer special and the primer 2 final concentration in the described ring mediated isothermal amplification reagent of correspondence is 5pmol/L; Primer 3 in described primer special and primer 4 final concentration in the described ring mediated isothermal amplification reagent of correspondence is 40pmol/L; The final concentration of primer 5 in described primer special in the described ring mediated isothermal amplification reagent of correspondence is 20pmol/L;
Described primer 5 can be combined with loop-stem structure that to start strand displacement synthetic, improves amplification efficiency.The final product of amplification is the loop-stem structure with different numbers, the mixture of different lengths DNA, more than its output can reach 10 μ g, is at least 50 times of common PCR reaction DNA productive rate.
The concentration of described RNA reversed transcriptive enzyme in described ring mediated isothermal amplification reagent is 0.004U/ μ L;
Described RNA reversed transcriptive enzyme is specially AMV reversed transcriptive enzyme;
The concentration of described Bst archaeal dna polymerase in described ring mediated isothermal amplification reagent is 0.32U/ μ L;
The concentration of described fluorexon in described ring mediated isothermal amplification reagent is 50 μ mol/L;
Described 2 * ring mediated isothermal amplification damping fluid is prepared as follows: by Repone K (KCl), magnesium sulfate (MgSO
4), ammonium sulfate ((NH
4)
2sO
4), polysorbas20 (Tween-20), trimethyl-glycine (Betaine), Manganous chloride tetrahydrate (MnCl
2) and dNTPs (deoxynucleoside triphosphate mixture: dATP, dCTP, dGTP and dTTP) to be dissolved in concentration be that the Tris hydrochloride damping fluid that 40mmol/L, pH value are 8.8 obtains;
In described 2 * ring mediated isothermal amplification damping fluid, the concentration of described Repone K is 20mmol/L, the concentration of described magnesium sulfate is 16mmol/L, the concentration of described ammonium sulfate is 20mmol/L, the concentration of described polysorbas20 is 0.2% (quality percentage composition), the concentration of described trimethyl-glycine is 1.6mol/L, and the concentration of described Manganous chloride tetrahydrate is 1mmol/L, and the concentration of every kind of described deoxynucleoside triphosphate is 2.8mmol/L.
Described west nile virus is specially west nile virus Chin-01 strain.
The 3rd object of the present invention is to provide a kind of test kit that detects west nile virus.
Test kit provided by the invention, comprises described ring mediated isothermal amplification reagent;
Described west nile virus is specially west nile virus Chin-01 strain.
Described primer special or described ring mediated isothermal amplification reagent or described test kit identify and/or assistant identification west nile virus in application be also the scope of protection of the invention.
Described west nile virus is specially west nile virus Chin-01 strain.
The 4th object of the present invention is to provide the method for west nile virus in a kind of evaluation and/or assistant identification testing sample.
Method provided by the invention, comprises the steps:
With the described primer special in described primer special or described ring mediated isothermal amplification reagent or described test kit, testing sample is carried out to ring mediated isothermal amplification, detection ring mediated isothermal amplification product;
In described ring mediated isothermal amplification, the RNA of testing sample of take is template;
Described loop-mediated isothermal amplification condition is: first 60 ℃-65 ℃ are reacted 35-60min, then 75 ℃ of 2min termination reactions.
Described loop-mediated isothermal amplification condition is: first 63 ℃ are reacted 45min or 60min, then 75 ℃ of 2min termination reactions;
Described sample to be tested is the brain of mouse.
Detected object of the present invention is not limited to mouse brain tissue samples, also can relate to mosquito sample, animal or human serum, cerebrospinal fluid, cerebral tissue or organs and tissues etc. become celestial;
Described west nile virus is west nile virus Chin-01 strain.
The method of described detection ring mediated isothermal amplification product is following 1)-4) at least one:
1) observe described loop-mediated isothermal amplification product, if described product is yellow-green colour under natural light, and under UV-light, have glassy yellow fluorescence, in sample to be tested, contain or candidate is contained west nile virus; If described product is orange-yellow under natural light, and under UV-light without fluorescence, in sample to be tested, do not contain or candidate is not contained west nile virus;
2) with real-time turbidimeter, detect described loop-mediated isothermal amplification product, if there is specific amplified curve, in sample to be tested, contain or candidate is contained west nile virus; If without specific amplified curve, in sample to be tested, do not contain or candidate is not contained west nile virus;
3) loop-mediated isothermal amplification product described in electrophoresis detection, obtains the amplified reaction product of gradient batten band, in sample to be tested, contains or candidate is contained west nile virus; If loop-mediated isothermal amplification product is not gradient batten band, in sample to be tested, do not contain or candidate is not contained west nile virus;
The size of described gradient batten band is 200bp-2000bp, and the size of described gradient batten band is mainly distributed between 200bp-2000bp;
4) with Sca I enzyme, cut described loop-mediated isothermal amplification product, enzyme is cut product described in electrophoresis detection, if described enzyme is cut product, is 244bp product and 164bp product, in sample to be tested, contains or candidate is contained west nile virus; If described enzyme is cut product not for 244bp product and 164bp product, in sample to be tested, do not contain or candidate is not contained west nile virus.
Described detection ring mediated isothermal amplification product adopts the variation of visual inspection turbidity, visual inspection fluorescence dye to change or turbidimeter detection in real time, specific as follows:
1) visual inspection turbidity
If visual inspection turbidity increases, loop-mediated isothermal amplification is positive, shows to contain in sample or candidate is contained west nile virus; Otherwise negative.
Be specially nucleic acid when synthetic in a large number, dNTP can separate out a large amount of pyrophosphate ions, the Mg in pyrophosphate ion and LAMP system
2+(or Mn
2+) combination, produce magnesium pyrophosphate or manganese pyrophosphate precipitation, thereby the turbidity of the liquid that induces reaction changes; Based on this principle, directly naked-eye observation, changes and judged whether that specific amplification occurs and specific nucleic acid is synthetic in a large number, thereby whether judge templet is target sequence according to the turbidity of reaction solution.
2) visual inspection fluorescence dye changes
When adopting fluorexon fluorescence dye to react, if LAMP reaction product under natural light from start orange become yellow-green colour and under UV-light aobvious fluorescence, LAMP reacting positive, shows that sample to be tested contains or candidate is contained west nile virus.
Be specially: when application fluorescence dye colour-change is judged, can adopt SYBR green I dyestuff or fluorexon.SYBR green I dyestuff can be combined with double-stranded DNA, but while having a large amount of products to produce in reaction, reaction system color becomes yellow-green colour.When nucleic acid synthesizes in a large number, can generate by product pyrophosphate, the existence of pyrophosphate ion, makes Mg
2+dissociate out, fluorexon and Mg
2+in conjunction with, reaction solution presents micro-turbid yellow-green colour.Based on this principle, can judge whether that nucleic acid is synthetic in a large number according to the colour-change of reaction solution, thereby whether judge templet is target sequence.Also can, according to reaction principle, select other fluorescence dyes of this area to carry out the judgement of LAMP reaction.
3) turbidimeter detects in real time
Adopt the turbidity of real-time turbidimeter and the real-time detection reaction liquid of supporting program software thereof to change, if observe typical amplification curve on turbidimeter in real time, LAMP reacting positive, shows that sample to be tested contains or candidate is contained west nile virus.
Can also detect with the following method:
4) electrophoresis:
LAMP reaction product is cut with Sca I enzyme, obtain enzyme and cut product, agarose gel electrophoresis detects LAMP reaction product and enzyme is cut product; If LAMP reaction product presents scalariform banding pattern (200～2000bp), and enzyme cuts the biobelt that product is 244bp and 164bp, and LAMP reacting positive, shows that sample to be tested contains or candidate is contained west nile virus.
5) when adopting SYBR green I dyestuff, can judge by the fluorescence of PCR in real time instrument and the real-time detection reaction liquid of supporting program software thereof, when fluorescent signal being detected, show that LAMP reaction is positive.
Of the present invention experimental results show that, primer special provided by the invention and method, be applicable to west nile virus (WNV) to carry out specific detection and quantitative analysis, its advantage is as follows: (1) only need, in steady temperature with regard to energy amplified reaction, not need specific installation; (2) specificity is high; (3) rapidly and efficiently, amplified reaction can complete in 35 minutes; (4) highly sensitive; (5) identify convenient and simple.The present invention is specially adapted to the rapid detection of clinical samples.
Accompanying drawing explanation
Fig. 1 is in natural light (A) and lower each sample LAMP result of ultraviolet lamp (B)
Fig. 2 is that LAMP reaction product and enzyme are cut product agarose gel electrophoresis
Fig. 3 is real-time turbidimeter amplification curve
Fig. 4 is the real-time turbidimeter amplification curve that virus-specific detects
Fig. 5 is the real-time turbidimeter amplification curve of sample
Fig. 6 is that RT-PCR detects sample results
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Inorganic chemical reagent used and organic reagent all meet the requirement of molecular biology experiment.
Primer synthesizes AMV reversed transcriptive enzyme (Avian Myeloblastosis Virus Reverse Transcriptase) by Shanghai Ying Jun technology company: Pu Luomaige (Beijing) Bioisystech Co., Ltd (Promega), cat.No.M5101.Dezyribonucleoside phosphate mixt (dNTPs): Pu Luomaige (Beijing) Bioisystech Co., Ltd (Promega), cat.No.U1515.BstDNA polysaccharase: NEB (Beijing) company limited, cat.No.M0275.RNA extracts test kit: RNeasy Mini Kit, QIAgen company product, Cat No.74014.RNA enzyme inhibitors (Ribonuclease inhibitor): precious biological (TAKARA) company in Dalian product, cat.No.D2310.Tris hydrochloride (Tris-HCl) pH8.8:Sigma company, cat.No.T9443.Repone K (KCl): Sigma company, cat.No.P9514.Magnesium sulfate (MgSO
4): Sigma company, cat.No.M3409, ammonium sulfate ((NH
4)
2sO
4): Sigma company, cat.No.A4418.Polysorbas20 (Tween20): Sigma company, cat.No.P9416.Trimethyl-glycine (Betaine): Sigma company, cat.No.B0300.Manganous chloride tetrahydrate (MnCl
2): Sigma company, cat.No.M3634.Fluorexon: Sigma company, cat.No.17783.DMEM substratum: Shanghai Ying Jun Bioisystech Co., Ltd, Cat No.C11885.The real-time turbidimeter of LA-320C, Japanese Rong Yan company product.% in following embodiment, if no special instructions, is quality percentage composition.
West nile virus Chin-01 strain is documented in: Jiang Tao, and Deng Yongqiang, Fan Baochang, etc.West nile virus Chin-01 pnca gene group coding region sequence is measured and is analyzed.Institute of Military Medical Science Institute periodical.2003.27 (6): 401-403, public Ke Cong Inst. of Epidemiology and Microbiology, Academy of Military Medical Sciences, PL obtains, this institute guarantees, can meet under country's Biosafety management regulation relevant to army, the backward unit that has qualification to be engaged in more than Equations of The Second Kind viral pathogen of approval of Qie Jing relevant departments provides.
West nile virus is identified in embodiment 1, LAMP reaction
One, the design of primer special and the preparation of each primer special
As follows according to west nile virus virogene group sequences Design specific primer sequence, synthetic:
F3 (sequence 1, primer 1): CTGTGACAGCAGCTAGTGC;
B3 (sequence 2, primer 2): TTTTCACGCTCTGGTTGGTA;
FIP (sequence 3, primer 3): TCTTCATTCGTGTGCCCCCC
tTTTaCGTGGACGCATCGGTAG;
BIP (sequence 4, primer 4): GACTCGAACTTCGCCCATTGGA
tTTTaATTGAGCGATCAGTCCGTT;
LB (sequence 5, primer 5): CTGAGGCACGAATCATGCTGGA;
Two, the preparation of Virus Sample
1, the preparation of Virus Sample
The virus liquid of west nile virus Chin-01 strain, by plaque experiment calculation plaque titre (plaque forming unit/milliliter, PFU/ml).Use DMEM substratum that virus liquid is carried out to gradient dilution, obtain the virus liquid (concentration is respectively 1000PFU/ml, 1000PFU/ml, 1OOPFU/ml, 10PFU/ml, 1PFU/ml, 0.1PFU/ml and 0.01PFU/ml) of 7 kinds of different concns.
2, the extraction of virus genome RNA (adopting RNA to extract test kit)
210 μ l Virus Samples are added in 1.5ml centrifuge tube, add 700 μ l RLT solution and 7 μ l beta-mercaptoethanols, after vibration mixes, add 490 μ l dehydrated alcohols, after thermal agitation, add at twice in silicagel column, carry out silicagel column filtration.
Silicagel column filters: by the silicagel column after application of sample 10, and the centrifugal 15s of 000g; Add 700 μ l RW1 damping fluids, the centrifugal 15s of 10,000g; μ l RPE damping fluid is centrifugal washes silicagel column twice with 500; Silicagel column is gone in new centrifuge tube to the centrifugal 2min of 10,000g; Silicagel column is gone in new centrifuge tube, add 50 μ l nuclease free water, the standing 2min of room temperature, then 10, the centrifugal 2min of 000g, collects elutriant; In elutriant, add 1 μ l RNA enzyme inhibitors, be RNA to be measured ,-80 ℃ of preservations.
Using 7 kinds of viral RNAs that obtain as 7 samples, for following detection.
Sample 1: the RNA that the Chin-01 virus liquid that is 10000PFU/ml from concentration extracts.
Sample 2: the RNA that the Chin-01 virus liquid that is 1000PFU/ml from concentration extracts.
Sample 3: the RNA that the Chin-01 virus liquid that is 100PFU/ml from concentration extracts.
Sample 4: the RNA that the Chin-01 virus liquid that is 10PFU/ml from concentration extracts.
Sample 5: the RNA that the Chin-01 virus liquid that is 1PFU/ml from concentration extracts.
Sample 6: the RNA that the Chin-01 virus liquid that is 0.1PFU/ml from concentration extracts.
Sample 7: the RNA that the Chin-01 virus liquid that is 0.01PFU/ml from concentration extracts.
Three, primer special is applied to the detection of west nile virus
The testing sample that the primer special first detecting step two obtaining by step 1 obtains carries out LAMP reaction respectively in 7 0.2ml reaction tubess.
The concentration of LAMP reaction system 25 μ l:F3 and B3 is 5pmol/L, the concentration of BIP and FIP is 40pmol/L, the concentration of LB is 20pmol/L, AMV reversed transcriptive enzyme 0.004U/ μ L, Bst archaeal dna polymerase 0.32U/ μ L, fluorexon 50 μ mol/L, 2 * ring mediated isothermal amplification damping fluid of 12.5ul, 2.5 μ l RNA to be measured, the deionized water of nuclease free and DNAzyme is supplied 25 μ l; Above concentration is the final concentration in system.
2 * ring mediated isothermal amplification damping fluid is prepared as follows: by Repone K (KCl), magnesium sulfate (MgSO
4), ammonium sulfate ((NH
4)
2sO
4), polysorbas20 (Tween-20), trimethyl-glycine (Betaine), Manganous chloride tetrahydrate (MnCl
2) and deoxynucleoside triphosphate mixture (dNTPs:dATP, dCTP, dGTP and dTTP) to be dissolved in concentration be that the Tris hydrochloride damping fluid that 40mmol/L, pH value are 8.8 obtains;
In described 2 * ring mediated isothermal amplification damping fluid, the concentration of described Repone K is 20mmol/L, the concentration of described magnesium sulfate is 16mmol/L, the concentration of described ammonium sulfate is 20mmol/L, the concentration of described polysorbas20 is 0.2% (quality percentage composition), the concentration of described trimethyl-glycine is 1.6mol/L, and the concentration of described Manganous chloride tetrahydrate is 1mmol/L, and the concentration of every kind of described deoxynucleoside triphosphate is 2.8mmol/L.
LAMP reaction system is at 63 ℃ of reaction 35min.Isothermal reaction can be undertaken by this area ordinary method, the real-time turbidimeter of LA320C for example, and regular-PCR instrument, controllable temperature water-bath etc.,
After termination reaction, under natural light, Figure 1A is shown in by the photo of reaction tubes, and 1 to 7 is followed successively by sample 1 to sample 7, and the positive is yellow-green colour, and feminine gender is orange-yellow; Can find out, pipe 1 is to pipe 5 (being that sample 1 is to sample 5) positive (yellow-green colours), and pipe 6 is to pipe 7 (being that sample 6 is to sample 7) negative (orange-yellow).
After termination reaction, under ultra violet lamp, Figure 1B is shown in by the photo of reaction tubes, and 1 to 7 is followed successively by sample 1 to sample 7, and the positive is yellow-green fluorescence, negative without fluorescence; Can find out, pipe 1 is to pipe 5 (being that sample 1 is to sample 5) positive (yellow-green fluorescences), and pipe 6 is to pipe 7 (being that sample 6 is to sample 7) negative (without fluorescence).
Adopt visual inspection, the sensitivity of detection method is 1PFU/ml under natural light or under UV-light.The concentration of viral RNA in RNA to be measured=(1PFU/ml * 200 μ l)/50 μ l=0.004PFU/ μ l.Content=0.004PFU/ μ l * 2.5 μ l=0.01PFU of viral RNA in each LAMP reaction system.Be that sensitivity is 0.01PFU/ reaction system.
Adopt under ultra violet lamp and observe, the sensitivity of detection method is 0.01PFU/ reaction system.
Four, primer special is applied to the detection (agarose electrophoresis observation) of west nile virus
The sample 1 that the professional primer detecting step two obtaining by step 1 obtains and sample 7 RNA to be measured.In LAMP reaction system, can not add fluorexon, other is with the LAMP reaction system of step 3.
LAMP reaction system is 63 ℃ of reactions 35min, then 75 ℃ of 2min termination reactions.
After termination reaction, get product 5 μ l and with Sca I restriction enzyme, carry out enzyme and cut.Get LAMP reaction product 0.5 μ l and enzyme and cut product 5 μ l and carry out agarose gel electrophoresis, sepharose concentration is 2.5%, and electrophoretic buffer is 1 * Tris-boric acid (TBE) damping fluid, and 100V electrophoresis 40 minutes, observes electrophoresis result under ultraviolet source.
The results are shown in Figure 2, swimming lane 3 and swimming lane 4 are respectively LAMP reaction product and the enzyme thereof of sample 1 and cut product, positive, the band banding pattern (200bp-2000bp) of the visible typical gradient sample of LAMP product, visible 2 bands (244bp and 164bp) only after enzyme is cut; Swimming lane 1 and 2 is respectively LAMP reaction product and the enzyme thereof of sample 7 and cuts product, negative, without typical gradient belt transect type.
Five, primer special is applied to west nile virus and detects (turbidimeter in real time)
LAMP reaction system is with the LAMP reaction system of step 3.LAMP reaction system is placed in to the real-time turbidimeter of LA320C, 63 ℃ of reactions 35min, then 75 ℃ of 2min termination reactions.In reaction system, can not add fluorexon.
Turbidimeter amplification curve is shown in Fig. 3 (curve is from top to bottom followed successively by sample 1-7) in real time, and sample 1 to sample 5 has special amplification curve, positive, and sample 6 and sample 7 are negative.
The sensitivity that turbidimeter is observed is 0.01PFU/ reaction system.
Six, LAMP atopic detects
The sample 1 that the primer special detecting step two obtaining by step 1 obtains (west nile virus Chin-01 strain) RNA, with dengue type 2 virus 43 strains, yellow fever virus 17D strain, tick-brone encephalitis virus (or claiming fores encephalitis virus) Senzhang strain, japanese encephalitis virus (or claiming epidemic encephalitis B virus) SA14-14-2 strain is contrast.Above-mentioned virus (being 100000PFU/ml) is extracted after RNA, adopt primer of the present invention to carry out LAMP reaction (method is identical with step 4), result is Fig. 4, only the reaction of west nile virus Chin-01 strain has amplification curve, result is positive, other virus reactions, all without obviously amplification curve is negative, show that primer of the present invention all has good specificity.
Dengue type 2 virus 43 strains are documented in Wei Yan, Jiang Tao, and Li Xiaofeng, etc.The preliminary observation of novel DNAzyme based on dengue 2-type virus prM gene to viral RNA Degradation. the periodical .2007.31 (1) of institute of Military Medical Science Institute: 16-19,23; The nucleic acid database number of logging in AF204178.
Yellow fever virus 17D strain is documented in Co MD, Kilpatrick ED, Rothman AL.Dynamics of the CD8T-cell response following yellow fever virus 17D immunization.Immunology.2009.128 (1Suppl): e718-27; The nucleic acid database number of logging in X03700.
Tick-brone encephalitis virus Senzhang strain is documented in Ma Xinying, takes charge of bright silver, Gao Xuan, etc.China's Tick-borne encephalitis virus Senzhang strain Isolated coding region sequence is measured.China's virusology.2003.18 (4): 322-325; The nucleic acid database number of logging in AY182009.
Japanese encephalitis virus SA14-14-2 strain is documented in Li Yuhua, Li Hailing, and Wu Yonglin, etc.Epidemic encephalitis B virus living vaccine strain SA14-14-2 stable gene Journal of Sex Research.China's microbiology and Journal of Immunology.2003.23 (11): 858-861; The nucleic acid database number of logging in AF315119.
Above-mentioned viral public Jun Kecong Inst. of Epidemiology and Microbiology, Academy of Military Medical Sciences, PL obtains.This institute guarantees, can after meeting the approval of Biosafety management regulation Qie Jing relevant to army relevant departments of country, to the unit that has qualification to be engaged in more than Equations of The Second Kind viral pathogen, provide.
Above-mentioned virus all belongs to Flavivirus, with west nile virus be equal genus member.
Embodiment 2, sample LAMP reaction detection to be checked
China there is no west Nile fever case at present.The present invention replaces with mouse infection analog sample, and virus infection method is documented in Deng Yongqiang, Jiang Tao, etc., Detection of West Nile virus using real-time PCR assay.China's microbiology and Journal of Immunology.2005.25(6)：519-522。Concrete grammar is: in three grades of laboratories of animal organism safety, get 18 of female BALB/c mouse in 4～6 week age (SPF level, purchased from Military Medical Science Institute's Experimental Animal Center), Transperitoneal injection west nile virus Chin-01 strain 100 μ l (10
5pFU/ml), after infecting, within the 6th day, get mouse brain tissue samples, be kept at-70 ℃ standby.
The primer special that employing is obtained by embodiment 1 step 1 detects gathering from the mouse brain tissue samples of numbering the infection west nile virus Chin-01 strain of 1-18 respectively, with the positive contrast of sample 2 (+) of embodiment 1 step 2, with the negative contrast of sample 7 (-).
After respectively in vitro infection west nile virus Chin-01 strain mouse brain tissue samples fully being ground, resuspended with 1mlDMEM substratum, centrifugal 10 minutes of 5000g, get supernatant 210 μ l, extract the RNA (extracting method is with the step 2 of embodiment 1) of supernatant liquor, ring isothermal amplification method is with the step 3 of embodiment 1.
Detected result is shown in Fig. 5, and #1 to #18 is that mouse brain sample 1 is to sample 18.Can find out, #12, #18 and positive control have specific amplified curve, and all the other samples and negative control are negative without specific amplified curve.
Employing document (Deng Yongqiang, Jiang Tao, etc.Detection of West Nile virus using real-time PCR assay.China's microbiology and Journal of Immunology.2005.25 (6): 519-522) (upstream primer is real-time RT-PCR method: TGATCCATGTAAGCCCTCAGAA, downstream primer is: ACATTGGGCTTTGAAGTTACAACA, probe is: 5 ' FAM-CGTCTCGGAAGGAGGACCCCA-3 ' BHQ1, annealing temperature is 60 ℃) #1 to #18 sample is detected, detected result is shown in Fig. 6 (have three of obvious amplification curve and be followed successively by from top to bottom positive control, #18, #12), can find out, #12, #18 and positive control have specific amplified curve, positive.All the other samples and negative control are without specific amplified curve, negative.
Claims (10)
1. a primer special that detects west nile virus, comprise primer 1, primer 2, primer 3 and primer 4, the nucleotide sequence of described primer 1, described primer 2, described primer 3 and described primer 4 is respectively sequence 1, sequence 2, sequence 3 and the sequence 4 in sequence table.
2. primer special as claimed in claim 1, is characterized in that: described primer special also comprises primer 5, and the nucleotides sequence of described primer 5 is classified the sequence 5 of sequence table as.
3. primer special as claimed in claim 1 or 2, is characterized in that: described primer special is comprised of described primer 1, described primer 2, described primer 3, described primer 4 and described primer 5;
Described west nile virus is specially west nile virus Chin-01 strain.
4. detect a ring mediated isothermal amplification reagent for west nile virus, comprise RNA reversed transcriptive enzyme,
bstprimer special described in archaeal dna polymerase, 2 * ring mediated isothermal amplification damping fluid, claim 1-3.
5. ring mediated isothermal amplification reagent according to claim 4, is characterized in that:
Described amplifing reagent also comprises fluorexon;
Described amplifing reagent by RNA reversed transcriptive enzyme,
bstprimer special described in archaeal dna polymerase, 2 * ring mediated isothermal amplification damping fluid, claim 1-3 and fluorexon form;
Primer 1 in described primer special and the primer 2 final concentration in described ring mediated isothermal amplification reagent is 5pmol/L; Primer 3 in described primer special and primer 4 final concentration in described ring mediated isothermal amplification reagent is 40pmol/L; The final concentration of primer 5 in described primer special in described ring mediated isothermal amplification reagent is 20pmol/L;
The concentration of described RNA reversed transcriptive enzyme in described ring mediated isothermal amplification reagent is 0.004 U/ μ L;
Described RNA reversed transcriptive enzyme is specially AMV reversed transcriptive enzyme;
Described
bstthe concentration of archaeal dna polymerase in described ring mediated isothermal amplification reagent is 0.32U/ μ L;
The concentration of described fluorexon in described ring mediated isothermal amplification reagent is 50 μ mol/L;
Described 2 * ring mediated isothermal amplification damping fluid is prepared as follows: to be just dissolved in concentration be that the Tris hydrochloride damping fluid that 40 mmol/L, pH value are 8.8 obtains for Repone K, magnesium sulfate, ammonium sulfate, polysorbas20, trimethyl-glycine, Manganous chloride tetrahydrate and dNTPs;
In described 2 * ring mediated isothermal amplification damping fluid, the concentration of described Repone K is 20 mmol/L, the concentration of described magnesium sulfate is 16 mmol/L, the concentration of described ammonium sulfate is 20 mmol/L, the mass percentage concentration of described polysorbas20 is 0.2%, the concentration of described trimethyl-glycine is 1.6mol/L, and the concentration of described Manganous chloride tetrahydrate is 1mmol/L, and the concentration of every kind of described dNTP is 2.8mmol/L;
Described west nile virus is specially west nile virus Chin-01 strain.
6. detect a test kit for west nile virus, comprise the ring mediated isothermal amplification reagent described in claim 4 or 5;
Described west nile virus is specially west nile virus Chin-01 strain.
7. the ring mediated isothermal amplification reagent described in arbitrary described primer special or claim 4 or 5 or test kit claimed in claim 6 application in evaluation and/or assistant identification west nile virus in claim 1-3; Described application does not comprise the diagnosis of clinical disease;
Described west nile virus is specially west nile virus Chin-01 strain.
8. identify and/or assistant identification testing sample in the method for west nile virus, described method shall not be applied to the diagnosis of clinical disease, comprises the steps:
With the ring mediated isothermal amplification reagent described in arbitrary described primer special or claim 4 or 5 in claim 1-3 or the described primer special in test kit claimed in claim 6, testing sample is carried out to ring mediated isothermal amplification, detection ring mediated isothermal amplification product;
In described ring mediated isothermal amplification, the RNA of testing sample of take is template;
Described loop-mediated isothermal amplification condition is: first 60 ℃-65 ℃ are reacted 35-60min, then 75 ℃ of 2min termination reactions.
9. method as claimed in claim 8, is characterized in that:
Described loop-mediated isothermal amplification condition is: first 63 ℃ are reacted 35min, then 75 ℃ of 2min termination reactions;
Described sample to be tested is mouse brain;
Described west nile virus is west nile virus Chin-01 strain.
10.1 methods as claimed in claim 8 or 9, is characterized in that:
The method of described detection ring mediated isothermal amplification product is following 1)-4) at least one:
1) observe described loop-mediated isothermal amplification product, if described product is yellow-green colour under natural light, and under UV-light, have glassy yellow fluorescence, in sample to be tested, contain or candidate is contained west nile virus; If described product is orange-yellow under natural light, and under UV-light without fluorescence, in sample to be tested, do not contain or candidate is not contained west nile virus;
2) with real-time turbidimeter, detect described loop-mediated isothermal amplification product, if there is specific amplified curve, in sample to be tested, contain or candidate is contained west nile virus; If without specific amplified curve, in sample to be tested, do not contain or candidate is not contained west nile virus;
3) loop-mediated isothermal amplification product described in electrophoresis detection, obtains the amplified reaction product of gradient batten band, in sample to be tested, contains or candidate is contained west nile virus; If loop-mediated isothermal amplification product is not gradient batten band, in sample to be tested, do not contain or candidate is not contained west nile virus;
The size of described gradient batten band is 100 bp-2000 bp;
4) use
scai enzyme is cut described loop-mediated isothermal amplification product, and enzyme is cut product described in electrophoresis detection, if described enzyme is cut product, is 244bp product and 164bp product, in sample to be tested, contains or candidate is contained west nile virus; If it is not the biobelt of 244bp and 164bp that described enzyme is cut product, in sample to be tested, do not contain or candidate is not contained west nile virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110241233.7A CN102952892B (en) | 2011-08-22 | 2011-08-22 | Loop-mediated isothermal amplification kit for detecting West Nile viruses, and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110241233.7A CN102952892B (en) | 2011-08-22 | 2011-08-22 | Loop-mediated isothermal amplification kit for detecting West Nile viruses, and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102952892A CN102952892A (en) | 2013-03-06 |
| CN102952892B true CN102952892B (en) | 2014-12-03 |
Family
ID=47762273
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110241233.7A Active CN102952892B (en) | 2011-08-22 | 2011-08-22 | Loop-mediated isothermal amplification kit for detecting West Nile viruses, and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102952892B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104152440B (en) * | 2013-05-15 | 2016-05-25 | 中国人民解放军军事医学科学院微生物流行病研究所 | For the identification of the primer sets compound of russian spring-summer encephalitis virus and their application |
| CN103352029A (en) * | 2013-07-29 | 2013-10-16 | 中国人民解放军军事医学科学院微生物流行病研究所 | Epidemic encephalitis B/forest encephalitis hybrid virus and application of virus |
| CN106884057A (en) * | 2017-03-22 | 2017-06-23 | 广州中医药大学 | A kind of visible detection method of zika virus |
| CN115981384B (en) * | 2023-02-07 | 2023-09-22 | 淮阴工学院 | Intelligent biomass ORC evaporation pressure control equipment |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101629215A (en) * | 2009-03-06 | 2010-01-20 | 中国人民解放军第二军医大学 | Kit for rapid joint detection of epidemic JEV, DEV and WNV and detection method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2010046042A (en) * | 2008-08-25 | 2010-03-04 | Mukogawa Gakuin | Method for detecting specific gene |
-
2011
- 2011-08-22 CN CN201110241233.7A patent/CN102952892B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101629215A (en) * | 2009-03-06 | 2010-01-20 | 中国人民解放军第二军医大学 | Kit for rapid joint detection of epidemic JEV, DEV and WNV and detection method thereof |
Non-Patent Citations (4)
| Title |
|---|
| Jyoti Shukla，et al.Molecular detection and characterization of West Nile virus associated with multifocal retinitis in patients from southern India.《International Journal of Infectious Diseases》.2011,e53-e59. * |
| Real-Time Reverse Transcription Loop-Mediated Isothermal Amplification for Rapid Detection of West Nile Virus;Manmohan Parida，et al;《JOURNAL OF CLINICAL MICROBIOLOGY》;20041231;第42卷(第1期);257-263 * |
| 利用环介导等温扩增技术检测西尼罗病毒;李淑华等;《第二军医大学学报》;20101231;第31卷(第6期);590-594 * |
| 实时RT-PCR检测西尼罗病毒;邓永强等;《中华微生物学和免疫学杂志》;20051231;第25卷(第6期);519-522 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102952892A (en) | 2013-03-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2016054870A1 (en) | Method and use of nucleic acid isothermal amplification via polymerase spiral reaction | |
| CN102952896B (en) | Universal loop-mediated isothermal amplification kit for detecting influenza A virus and application of universal loop-mediated isothermal amplification kit | |
| CN102618669B (en) | Kit and method for quickly examining loop SFTSV (severe fever with thrombocytopenia syndrome bunyavirus) mediated isothermal amplification of severe fever with thrombocytopenia syndrome bunyavirus | |
| CN104131112B (en) | A kind of gonococcus detects with primer sets, the kit that contains this primer sets and application thereof | |
| CN102952892B (en) | Loop-mediated isothermal amplification kit for detecting West Nile viruses, and its application | |
| CN112094946B (en) | LAMP (loop-mediated isothermal amplification) detection primer and kit for bovine sarcoidosis virus and application of LAMP detection primer and kit | |
| CN102605107A (en) | S-segment loop-mediated isothermal amplification rapid detection kit and method for server fever with thrombocytopenia syndrome bunyavirus | |
| CN107177700A (en) | A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus | |
| CN107236826A (en) | A kind of LAMP primer group, kit and detection method for detecting lily asymptomatic virus | |
| CN101724714B (en) | Loop mediated isothermal amplification kit for detecting encephalitis B virus | |
| CN102952900A (en) | Reagent and method for detecting yellow fever virus | |
| CN110468222B (en) | Special detection primers for rickettsiae in China Heilongjiang | |
| CN101899529A (en) | Method for detecting human H1N1 influenza virus gene by color-based reverse transcriptase loop-mediated isothermal amplification | |
| CN102816870A (en) | Primer and kit for detecting coxsackievirus A6 type RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid | |
| CHENG et al. | Sensitive detection of influenza A (H1N1) virus by isothermal amplification in a single tube | |
| CN107400734B (en) | Loop-mediated isothermal amplification Zika virus detection kit | |
| CN113481326B (en) | Isothermal nucleic acid amplification reaction reagent, isothermal nucleic acid amplification method and application thereof | |
| CN102399903B (en) | Chikungunya virus isothermal amplification detection kit and primer thereof | |
| KR102076343B1 (en) | Composition for detecting adenovirus type 55 using Real-time LAMP and uses thereof | |
| CN104278024A (en) | Primer composition for identification of human adenovirus type 55 and application thereof | |
| CN102417933B (en) | Color based reverse transcription loop-mediated isothermal amplification technology for detecting EV71 virogene | |
| CN104513867A (en) | Primer set, reagent kit and method for detecting hop stunt viroid based on loop-mediated isothermal amplification technology | |
| CN102952891B (en) | Loop-mediated isothermal amplification kit for detecting BYD viruses, and its application | |
| CN102296064B (en) | Specific primer for detecting enterovirus 71 (EV71) and application thereof | |
| CN108754021A (en) | A kind of ring mediated isothermal amplification detection reagent of duck hepatitis B virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |