CN107236722A - A kind of application of the smooth repair enzyme of Antarctic ice microalgae 64, its encoding gene and expression vector and the enzyme - Google Patents

A kind of application of the smooth repair enzyme of Antarctic ice microalgae 64, its encoding gene and expression vector and the enzyme Download PDF

Info

Publication number
CN107236722A
CN107236722A CN201710371568.8A CN201710371568A CN107236722A CN 107236722 A CN107236722 A CN 107236722A CN 201710371568 A CN201710371568 A CN 201710371568A CN 107236722 A CN107236722 A CN 107236722A
Authority
CN
China
Prior art keywords
enzyme
antarctic ice
light
expression vector
repair enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710371568.8A
Other languages
Chinese (zh)
Other versions
CN107236722B (en
Inventor
缪锦来
郑洲
安美玲
缪凤
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
First Institute of Oceanography SOA
Original Assignee
First Institute of Oceanography SOA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by First Institute of Oceanography SOA filed Critical First Institute of Oceanography SOA
Priority to CN201710371568.8A priority Critical patent/CN107236722B/en
Publication of CN107236722A publication Critical patent/CN107236722A/en
Application granted granted Critical
Publication of CN107236722B publication Critical patent/CN107236722B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A61K8/66—Enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/004—Aftersun preparations
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/99—Other Carbon-Carbon Lyases (1.4.99)
    • C12Y401/99003—Deoxyribodipyrimidine photo-lyase (4.1.99.3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
    • A61K2800/86—Products or compounds obtained by genetic engineering

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Dermatology (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Birds (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses the application of a kind of smooth repair enzyme of Antarctic ice microalgae 64, its encoding gene and expression vector and the enzyme.The present invention obtains the gene cDNA total length of the smooth repair enzyme of Antarctic ice microalgae 64 by RACE, and obtains the smooth repair enzyme genetic of total length 64.The present invention has cloned the smooth repair enzyme genetic of Antarctic ice microalgae 64 first, and be successfully cloned into expression vector, obtain a large amount of 64 smooth repair enzymes, and 64 smooth repair enzymes are applied to the association areas such as cosmetics, biological medicine, it can actively repair and illness is caused by ultraviolet, huge social benefit is brought, it is significant.

Description

A kind of Antarctic ice microalgae 6-4 light repair enzyme, its encoding gene and expression vector and the enzyme Application
Technical field
The invention belongs to biology techniques field, and in particular to a kind of Antarctic ice microalgae 6-4 light repair enzyme, its encoding gene and The application of expression vector and the enzyme.
Background technology
Appearance, the expansion of destruction of the mankind's activity to Ozone in Atmosphere layer, especially north and south the two poles of the earth Ozone hole so that spoke The sunshine middle-ultraviolet lamp enhancing of earth surface is mapped to, causes biosphere increasingly serious by uv damage.In addition with life The increasingly raising of level, increasing people are keen to outdoor activities, and the time of contact ultraviolet is increasing.Due to skin exposure Many molecule absorption UV radiation in appearance, skin, and produce various DNA damages.And DNA molecular is the inhereditary material of life entity Basis, its integrality is sustain life basic.If impaired DNA cannot get timely and effective reparation, cell withers trend Die or morph and cause cell carcinogenesis.
The basic reason of DNA lesions induced by ultraviolet irradiation is that it can induce the DNA pyrimidine bases productions adjacent with bar chain Raw pyrimidine dimer, makes DNA space structures change, so as to hinder DNA replication dna, transcribe and then influence the life of protein Thing function.Ultraviolet radiation is that pyrimidine dimer is formed in DNA to organism DNA major determinant（CPDs）With（6-4）Light Product（6-4）PPs.Both photoproducts hinder the process of the polymerase in DNA replication dna or transcription, so as to cause organism DNA ultraviolet radiation damage, has mutagenesis, carcinogenesis and the effect such as lethal to organism.Stratospheric ozone reduction 10%, The incidence of disease of global cataract will increase by 6~8%, and the incidence of disease of pernicious dermatoma will increase by 26%；The mankind are present in skin Immunologic function can be also damaged because of the intense radiation of ultraviolet, and the ability of resist the disease is substantially reduced.
A kind of important DNA restorative procedures of photorepair, DNA light repair enzymes assume responsibility for DNA plerosis and damage and keep raw The critical function of thing genetic stability.DNA light repair enzymes be divided into CPD light repair enzyme and（6-4）Two kinds of approach of light repair enzyme, this two Planting enzyme has respective reparation approach, and a kind of their enzyme can only repair a kind of damage and can not repair another.Utilize CPD Light repair enzyme and（6-4）Light repair enzyme repair respectively CPDs and（6-4）PPs；I.e. light repair enzyme can untie pyrimidine dimer With（6-4）Photoproduct, makes the DNA of damage recover normal condition.
Be found that in bacterium, insect, higher plant, vertebrate and some low mammal bodies light repair enzyme and its Gene, but in presence of the higher mammal including not yet finding DNA light repair enzymes in human body.And in higher mammal cell In, Exonucleolytic reparation（NER）It is the main approach of DNA plerosis damage.Mammal（Including people）All lack light reparation system System, and the light repair enzyme of unicellular lower eukaryote repairs same effective to the DNA of human body.Human trial proves that light repairs zymoprotein can be by Absorption of human body simultaneously plays effect, is that light repair enzyme is used for mankind's ultraviolet injury and its relevant disease protection and treatment product exploitation Reliable scientific basis is provided.Lack with the presence of partial mass NER repair systems or imperfect, show various diseases, it is most common Be xeroderma pitmentosum (XP) patient, the in addition trichothiodystrophy of Cockayne syndromes and Photosensitive There is NER repair systems shortage.Therefore, light repair enzyme can also be applied to the treatment of above disease.
Although in the environment for living in the strong ultraviolet radioactive in the South Pole, Antarctic ice microalgae still vigorous growth is bred, this imply that the South Pole Should be the key mechanism that it adapts to this adverse circumstances to the efficient self-repairing capability that the purple line losses of DNA are hindered on ice algae science of heredity. With other regional biofacies ratios, the light for being used to repairing ultraviolet injury DNA in Antarctic ice microalgae is repaired enzymatic structure and should had with function Its specificity, just adapts to this extremely severe intensive ultraviolet radiation environment in the South Pole.The content of light repair enzyme in vivo Seldom, each cell there are about 10~20 light and repair enzyme molecule, and this directly to isolate and purify light repair enzyme from organism simultaneously Carry out that its structure, functional activity and study on mechanism are extremely difficult, but with the development of gene clone technology, it is possible to use base Because engineering means clone Antarctic ice microalgae light repair enzyme genetic, and it is transformed into purpose host, completes the excess of light repair enzyme Expression and purifying, and detailed research is carried out to it.
DNA light repair enzymes be divided into CPD light repair enzyme and（6-4）A kind of two kinds of light repair enzyme, enzyme of both enzymes can only be repaiied Multiple one kind is damaged and can not repair another.The present inventor at home and abroad carried out first Antarctic ice microalgae CPD light repair enzyme and The research work of its mechanism of action, invention（CN103160488B）There is provided a kind of Antarctic ice microalgae CPD light repair enzyme, its coding base The application of cause and expression vector and the enzyme.But than CPD light repair enzymes, it is right（6-4）In terms of light repair enzyme and repair mechanisms Understanding want much less, especially with respect to Antarctic organism in intensive ultraviolet radiation habitat（6-4）Light repair enzyme is there is not yet research.
The content of the invention
The technical problems to be solved by the invention there is provided a kind of Antarctic ice microalgae 6-4 light repair enzyme, its encoding gene and The application of expression vector and the enzyme, the present invention is that the encoding gene of 6-4 light repair enzymes is cloned into expression vector, obtains 6- 4 smooth repair enzymes, and 6-4 light repair enzyme is rationally applied to the association areas such as cosmetics, biological medicine, solve in background technology The technical problem of presence.The present invention is for biology（Including the mankind）Ultraviolet radiation injury repair and its relevant disease preventing and treating have Most important theories and practical significance.
In order to solve the above technical problems, the present invention uses following technical scheme：
The invention provides a kind of Antarctic ice microalgae 6-4 light repair enzymes, its amino acid sequence such as SEQ ID No:Shown in 2.
Further：The isoelectric point of the Antarctic ice microalgae 6-4 light repair enzymes is 8.86, and relative molecular mass is 63.1KDa.
Present invention also offers the encoding gene of described Antarctic ice microalgae 6-4 light repair enzymes, its nucleotide sequence such as SEQ ID No:Shown in 1.
Further：The primer for cloning the encoding gene is：
F：ATGGCTTCTGTGACCGGCAA；
R：TCACTCTGTCTCCTTCTTGCTT.
Present invention also offers the expression vector that enzyme coding gene is repaired containing described Antarctic ice microalgae 6-4 light.
The expression vector is BL21 (DE3)/pET-28a (+)/6-4phr.
Further：The expression vector also includes selected marker, includes but is not limited to：Produced in expression bacterial strain The gene of enzyme or the gene of luminophor or the gene with antibiotic marker of raw color change.
Present invention also offers described Antarctic ice microalgae 6-4 light repair enzyme in the preparation of ultraviolet damage is repaired for preparing Application.
Present invention also offers described Antarctic ice microalgae 6-4 light repair enzyme for preparing the application in cosmetics.
By adopting the above-described technical solution, advantages of the present invention and advantageous effects are：The present invention is obtained by RACE To Antarctic ice microalgae（6-4）The gene cDNA total length of light repair enzyme, meanwhile, primer is designed according to the gene fragment order, carried out PCR amplifications obtain total length（6-4）Light repair enzyme genetic.Meanwhile, by the fluorescence quantitative PCR detection gene in ultraviolet stress and by force Expression pattern under the conditions of light irradiation.By the gene cloning to procaryotic clone carrier pMD18-T, sequence verification is carried out.It will build Good recombinant vector connects prokaryotic expression carrier pET-28a (+) after digestion, is expressed in e. coli bl21.Eventually pass through Affinity chromatography obtains purifying protein.The identification and screening of overexpressing strain, can be processed, such as to expression vector for convenience Addition can produce the enzyme or luminophor gene (such as GFP genes, luciferase gene) of color change, or resistant Antibiotic marker.
The Antarctic ice microalgae of the invention by acquisition（6-4）Light repair enzyme is applied to health products, cosmetics, biological medicine etc. Association area causes illness actively to repair by ultraviolet.For example, suncream can keep apart skin with ultraviolet, pass through Two kinds of mechanism of reflection and absorption to light work, and to reduce damage of the ultraviolet to skin, but the skin of damage can not be entered Row is repaired.The present invention recombinant protein DNA light repair enzyme can as advanced skin care product functional component, actively repair by ultraviolet Erythema, scytitis and gene damage caused by line, anti-aging thoroughly breach the concept of current " anti-" ultraviolet.
The present invention has cloned Antarctic ice microalgae first（6-4）Light repair enzyme genetic, and be successfully cloned into expression vector, Obtain a large amount of（6-4）Light repair enzyme, and will（6-4）Light repair enzyme is applied to the correlation neck such as health products, cosmetics, biological medicine Domain, can actively repair and cause illness by ultraviolet, bring huge social benefit, significant.
Brief description of the drawings
Fig. 1 is SDS-PAGE electrophoretograms.
Fig. 2 is（6-4）The Binding experiment result of light repair enzyme and DNA.
Fig. 3 is control group mice skin（It is left）And histotomy（It is right）Figure, scale shows 100 μm.
Fig. 4 is ultraviolet irradiation group mouse skin（It is left）And histotomy（It is right）Figure, scale shows 100 μm.
Fig. 5 is treatment group's mouse skin（It is left）And histotomy（It is right）Figure, scale shows 100 μm.
Embodiment
In order that the technical means, the inventive features, the objects and the advantages of the present invention are easy to understand, tie below Specific embodiment is closed, the present invention is expanded on further.
Method used in following embodiments is this area routine operation, is referred to《Molecular Cloning:A Laboratory guide》.It is real Apply example 1：Antarctic ice microalgaeChlamydomonassp.ICE-L（6-4）The acquisition of light repair enzyme cDNA sequence
1st, the culture of Antarctic ice microalgae, the separation of total serum IgE
By Antarctic ice microalgaeChlamydomonassp.ICE-L（During in November, 2001 Chinese 18th scientific investigation in the Antarctic At middle mountain station（69°S, 77°E）Isolate and purify and obtain in the seawater and sea ice sample that nearby gather, be stored in National Bureau of Oceanography sea In foreign bioactive substance key lab Antarctic ice microalgae algae kind storehouse）Using f/2 culture mediums, cultivation temperature is 0~6 DEG C, culture Light intensity is 1300~1900lux, periodicity of illumination 12:12.It is non-aerating, it is daily to shake 3 times.Inoculum concentration is 20%.Medium component （mg/L）：Filter Chen Haishui, KH2PO415, NaNO315, FeC6H5O70.4, urea 20.4 DEG C of cultures are used to logarithmic phase The Trizol of Invitrogen companies carries out RNA extraction.Experiment is operated according to the extraction process description of Trizol reagents, Ensure no RNase pollutions in whole process, the RNA of extraction is distributed into aliquot, frozen standby in -80 DEG C of refrigerators.
2、（6-4）The acquisition of light repair enzyme genetic cDNA sequences
According to the Antarctic ice microalgae transcript profile sequence of acquisition, filter out（6-4）Light repair enzyme genetic fragment, it is found that the gene 5 ' is complete It is whole, therefore, primer is designed according to fragment sequence and carries out 3 '-RACE：
3 '-RACE primers：
GSP1：5’- GTGGGGTTGGATTCATCACTTGGCTCGT-3’（SEQ ID No:3）； GSP2：5’- GGATTCATCACTTGGCTCGTCACTCGGT-3’（SEQ ID No:4）；
3 '-RACE reverse transcription systems are as follows：
Template ribonucleic acid, the μ L of 0.5 μ g 1.0；
The μ L of 3 '-CDS primers A 1.0；
RNase free H2O 4.75μL；
After sample blending, 70 °C of 3 min, 42 °C of 2 min, 14,000g 10 S of centrifugation；
5×First-Strand Buffer 2. 0μL；
The μ l of DTT, 20 mM 1.0；
The μ l of dNTP, 10 mM 1.0；
RNase Inhibitor, 40 U/ μ L 0.25 μ l；
SMARTScribe Reverse Transcriptase, 100 U/ μ L 1.0 μ l.
The several seconds is centrifuged after slight oscillatory；In 42 DEG C of 90min, 70 DEG C of 10min, more than chilling 2min on ice；With Tricine-EDTA buffer dilute, and are stored in -20 DEG C, stand-by.
3rd, the high quality RNA of acquisition is subjected to reverse transcription, synthesizes cDNA, enter performing PCR reaction, PCR reaction systems are such as Under：
PCR-Grade-water 34.5μL；
10×advantage 2 PCR Buffer 5.0μL；
The μ L of dNTP mix, 10 mM 1.0；
50×advantage 2 polymerase mix 1.0μL；
5’/ 3’-RACE ready cDNA 2.5μL；
UPM, 10 × 5.0 μ L；
GSP1/2 1.0μL。
PCR reaction conditions are：94 DEG C of 30s, 72 DEG C of 3min, 5 circulations；94 DEG C of 30s, 70 DEG C of 30s, 72 DEG C of 3min, 5 circulations；94 DEG C of 30s, 68 DEG C of 30s, 72 DEG C of 3min, 27 circulations.
4th, reclaimed after PCR terminates with 1.0% agarose, be connected to pMD18-T, convertedE.coliDH5 α, are carried out Sequence verification；Utilize NCBI online tools, i.e. http:// blast.ncbi.nlm.nih.gov/Blast.cgi, by gained sequence Row application blast program carries out sequence homology comparison and similarity analysis；Carry out sequence assembly with DNAstar softwares, and Compared in NCBI, to confirm to obtain complete coding region sequence of the target gene as 6-4 light repair enzyme genetics（Nucleotide sequence is such as SEQ ID No:Shown in 1）.
Embodiment 2, Antarctic ice microalgae Chlamydomonas sp.ICE-L（6-4）Light repair enzyme expression vector establishment
1st, the light repair enzyme genetic complete sequence obtained according to sequencing designs primer：
（6-4）F：5’- ATGGCTTCTGTGACCGGCAA-3’（SEQ ID No:5）；
（6-4）R：5’- TCACTCTGTCTCCTTCTTGCTT-3’（SEQ ID No:6）；
PCR reaction conditions are：95 DEG C of pre-degenerations 10min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 1min, 72 DEG C of extension 2min reactions Carry out 30 circulations.
2nd, by the pcr amplification product of light repair enzyme genetic and prokaryotic expression carrier pET-28a (+), respectively with the Hes of EcoR I Xho I is reclaimed in 37 DEG C of digestion 2h, purified purpose fragment and carrier is connected with T4DNA respectively with 1.0% agarose Enzyme is connect in connecting 16h at 16 DEG C, recombinant plasmid is obtained.Linked system is as follows.
Reaction system volume
6-4phr 3.5μL；
pET-28a(+) 4.5μL；
The μ L of ligase 1；
Connect the μ L of buffer solution 1；
React the μ L of total system 10.
3rd, by the recombinant plasmid transformed bacillus coli DH 5 alpha connected, step is as follows：
(1) the μ L of competent cell 300 are taken in 1.5mL centrifuge tubes, ice bath 5min.
(2) plasmid that 5 μ L were connected is added in every pipe, gently rotates to mix content, ice bath 30min.
(3) 42 DEG C of heat shock 90s, should not shake test tube.
(4) 10mL sterile test tubes are taken, often pipe adds 800 μ L LB fluid nutrient mediums, ice bath.
(5) the μ L of cell 200 after conversion are taken to add in 800 μ L LB fluid nutrient mediums, 37 DEG C of 150rpm shaken cultivations 45min。
(6) the 100 μ L bacterium solutions converted are coated on planar surface, 37 DEG C of 12~16h of culture culture.
4th, the bacterium colony of picking white is respectively placed in LB fluid nutrient mediums of the 5mL containing kanamycins, and 37 DEG C of shaken cultivations 8~ 12h, alkaline lysis method of extracting plasmid is to carry out digestion identification.Identify that correct plasmid converts e. coli bl21 in the same way (DE3), sequencing identification obtains recombinant bacterial strain BL21 (DE3)/pET-28a (+)/6-4phr.
Embodiment 3, pole ice algaeChlamydomonassp. ICE-L（6-4）The purifying of light repair enzyme and Protein Detection
1st, recombinant bacterial strain BL21 (DE3)/pET-28a (+)/6-4phr is inoculated in LB fluid nutrient mediums of the 5mL containing kanamycins In, in 37 DEG C of shaken overnight cultures.Next day takes 5mL bacterium solutions to access the continuation of 500mL identicals culture medium and cultivates 2~3h（OD600About 0.6）Afterwards, final concentration of 1mM IPTG is added, in 10 DEG C of shaken cultivation 24h, 8000g centrifugation 10min, thalline is collected.
2nd, Ni agaroses affinity column affinity chromatography：Metal-chelator Ni agaroses are loaded into chromatographic column, combined with 1 × Ni posts Buffer solution is balanced.By supernatant upper prop.It is general to be eluted with 50mM imidazoles, obtain the i.e. described Antarctic ice microalgae of destination protein（6-4）Light Repair enzyme, its amino acid sequence such as SEQ ID NO:Shown in 2.
3rd, BL21 (DE3)/pET-28a (+)/6-4phr thalline of above-mentioned induced expression and the 6-4phr genes of purifying are taken The protein of expression, is mixed with 2 isometric × sample-loading buffer respectively, 100 DEG C of 3~5min of water-bath.The SDS- of preparation 12% PAGE separation gels and 5% concentration glue, take 20 μ L to be loaded onto gel, the 100V in concentration glue, 120V in separation gel, carry out SDS- PAGE electrophoresis, electrophoresis terminates to carry out coomassie brilliant blue staining.
As a result as shown in figure 1, wherein M represents standard molecular weight, 1 and 2 be BL21 (DE3)/pET-28a (+)/6-4phr Mycoprotein, and Antarctic ice microalgae prepared by 3,4,5 separation phases different with 6 expressionsChlamydomonassp. ICE-L （6- 4）Light repair enzyme.Fig. 1 illustrates, Antarctic ice microalgae can be obtained using the above methodChlamydomonassp. ICE-L （6-4）Light Repair enzyme.
Embodiment 4, Antarctic ice microalgae Chlamydomonas sp. ICE-L（6-4）Light repair enzyme sequential analysis of protein
The Antarctic ice microalgae Chlamydomonas sp. ICE-L of acquisition（6-4）The ORFs of light repair enzyme genetic （ORF）Length is 1680bp, encodes 559 amino acid residues.（6-4）Light repair enzyme isoelectric point is 8.86, relative point of measure Protonatomic mass is 63.1KDa.By South Pole chlamydomonas Chlamydomonas sp. ICE-L's（6-4）The amino acid sequence of light repair enzyme Sequence analysis is carried out on NCBI, does not have obvious sequence homology in nucleic acid database.It was found that South Pole chlamydomonas（6-4）Light The amino acid sequence and Dunaliella salina of repair enzyme（6-4）The affiliation of light repair enzyme is nearest.
Embodiment 5, Antarctic ice microalgaeChlamydomonassp. ICE-L（6-4）Light repair enzyme repairs the work of ultraviolet damage With detection
1st, Antarctic ice microalgae（6-4）Light repair enzyme genetic recombinant bacterial strain is inoculated in conical flask, is cultivated in shaking table. 6000r•min-1Thalline is harvested by centrifugation.Ultrasonication thalline, 10000r min-1Centrifugation removes bacterial chip, and supernatant is first with super Filter instrument and collect the progress initial gross separation of 50000-100000Da components, by nickel affinity column chromatography for separation, then through Sepharose Fast Flow are further purified, and obtain Antarctic ice microalgae（6-4）Light repair enzyme genetic expression product.
2nd, to artificial synthesized d (pT)16In plus distilled water dissolving, make d (pT)16Concentration is 10 μm of ol.By d (pT)16Plus Into quartz colorimetric utensil, 100 μ W/cm2UVB irradiates, and every 10 min determines a primerOD 325Value, extremelyOD 325Value is constant.First Solution is prepared according to the system of control group in following system.
Experimental group： Control group：
0.01 mol/L DTT 50 μl 0.01 mol/L DTT 50 μl
Enzyme 50 μl Enzyme 50 μl
10 μmold(pT)16 50 μl For examination Buffer 900 μl
For examination Buffer 850 μl
Total Volume 1000 μl Total Volume 1000 μl
Experimental group and control group are placed under the conditions of same light photograph（Blue light）Repair.Electricity is migrated using EMSA gel blockings The method of swimming detection carries out enzyme activity determination, detects its external repairing activity and understands its repair process.
Pass through detection（6-4）The combination degree of light repair enzyme and DNA, calculates its repair rate to 6-4 photoproducts.Experiment knot Fruit is as shown in Figure 2.
It is embodiment 6, described（6-4）Application of the light repair enzyme in cosmetic field
Under ultraviolet damage, human skin accelerates aging.DNA light repair enzyme can protect the skin from the damage of ultraviolet, Improve the health status of skin, long-term use can reduce skin disease and wrinkle.
In the present embodiment, the Antarctic ice microalgae of embodiment 3 after purification is embedded using lecithin and cholesterol（6-4）Light is repaired Enzyme, is added in cosmetics afterwards.
The mouse of selection 6 weeks or so, positive control applies troweling repair enzyme, and ultraviolet irradiation experiment is carried out to its skin of back, Every mouse reprocessed by 3 days, made skin biopsy, carried out Hematoxylin-eosin dyeing.Experimental result as in Figure 3-5, Ultraviolet radiation damage mouse skin can be thickened substantially, and smear Antarctic ice microalgae（6-4）The mouse skin of light repair enzyme has obvious Repair function.It therefore, it can Antarctic ice microalgae light repair enzyme being added in cosmetics.
It is embodiment 7, described（6-4）Application of the light repair enzyme in biomedicine field
Erythematous response is to be irradiated with the ultraviolet of doses after skin, after a period of time, irradiation skin presentation border is clear Chu, uniform congested reaction.Erythema, random choosing are produced with 254nm length ultraviolets line irradiation mouse back skin 30min, 12h Mouse skin near erythema is taken to be subcutaneously injected, daily injection 0.1mg Antarctic ice microalgaes（6-4）Light repair enzyme, for three days on end, Test result indicates that 1 Zhou Hou treatment groups inflamed skin has clear improvement.Antarctic ice microalgae light repair enzyme can apply to field of medicaments.
The above embodiments are merely illustrative of the technical solutions of the present invention, rather than is limited；Although with reference to foregoing reality Apply example the present invention is described in detail, for the person of ordinary skill of the art, can still implement to foregoing Technical scheme described in example is modified, or carries out equivalent substitution to which part technical characteristic；And these are changed or replaced Change, the essence of appropriate technical solution is departed from the spirit and scope of claimed technical solution of the invention.
SEQUENCE LISTING
<110>Oceanographic Inst. No.1 of State Bureau of Oceanography
<120>A kind of application of Antarctic ice microalgae 6-4 light repair enzyme, its encoding gene and expression vector and the enzyme
<130>
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 1680
<212> DNA
<213>Antarctic ice microalgae
<400> 1
atggcttctg tgaccggcaa agccaaaatc gtgtggttca gaaagggttt acgactgcat 60
gacaacccag ccctcattga ggcctgtcgt ggagctgccc atgtgtaccc catcttcatc 120
ctagatcccc acttccgtag tgctggttac aaggttggag tgaaccgttt taaattcctc 180
atgcaatctc tgacagatct aaatgacagc tttgaggcaa ggggatcccg cttgttggtt 240
ctgagaggga aaccagagga tgtgcttcca caagtgttca aggactggca ggtagatgag 300
ctttgctatg aggtggatac cgagccctac gctgttttga gggatgcaca tgtgagcagc 360
cttgctaaag cagccaacgt tgaagtgaag tcgtttgtca gtcacacact atacgatact 420
gccgacattg ttgagaggaa cgggggaaag ccaccactca cctaccagtc cttcattaag 480
ctggttgaca agatgggaga ccctacagca cctgcacctg atcccccaga gaagatgccc 540
ccgcccaggg atgatcttcc gggtgcagcc ccccaggaga catcggtccc aactttgaag 600
gagataggct atgaccaaga gcccactgcg cccttcaagg gaggagagag agaagcactg 660
gctcgcatgg atacctacct ttcggacaag ctgtgggtgg caaactttga gaagcctcag 720
acagacccaa gcgcctttga aaagcctgcg accaccactc tgtcaccgta cctaaagttt 780
ggatgcctct ctccccggct cttccacact agactgctac agatatacaa ggagcagaag 840
aagcactcag agcccccggt gtccttaagg ggccaactgc tgtggagaga gttcttctac 900
acggtgggtg cccacactcc caacttcagc cacatggtag gcaacaccgt gtgccgccaa 960
atagactgga gacaccagga cgcggcaaca gctgattctg aggcggagca gcatcttgcg 1020
gcatggaagg ctggccgcac tggcttcccc tggattgatg ccatcatgac acagctgcat 1080
gagtggggtt ggattcatca cttggctcgt cactcggtgg catgcttcct cacaagaggg 1140
gacttgtaca tctcatggga gcgaggccag gaggtgtttg aggagctgtt gctggaccag 1200
gaccacttca tcaatgctgg gaactggatg tggctctccg catctgcttt cttctcgcag 1260
tacttcaggg tgtacagccc agttgttttt gggaagaagt acgaccctga gggaaagtac 1320
attcgcaagt tcttgcctgt gctcaaggac atgccagcca agtacatcta cgagccatgg 1380
ctcgccccga ctgaggtcca gaagaaagcc aagtgcatca tcggggtgga ctacccgcgt 1440
cccatagtcg atcacagcat tgccagcaag cagaacattg ggcgcatggc tgcagcttac 1500
aaggcgaaca agggggaagg agaaggggag gccgctgata ctcctaagaa ggccgccaaa 1560
cccaggaaag ctgccgcacc caaagctgca aagaaggagg cgacagatgt tgtttctggg 1620
aagggggcga agcggcagcg gacgatgaaa gagtttgcaa gcaagaagga gacagagtga 1680
<210> 2
<211> 559
<212> PRT
<213>Antarctic ice microalgae
<400> 2
Met Ala Ser Val Thr Gly Lys Ala Lys Ile Val Trp Phe Arg Lys Gly
1 5 10 15
Leu Arg Leu His Asp Asn Pro Ala Leu Ile Glu Ala Cys Arg Gly Ala
20 25 30
Ala His Val Tyr Pro Ile Phe Ile Leu Asp Pro His Phe Arg Ser Ala
35 40 45
Gly Tyr Lys Val Gly Val Asn Arg Phe Lys Phe Leu Met Gln Ser Leu
50 55 60
Thr Asp Leu Asn Asp Ser Phe Glu Ala Arg Gly Ser Arg Leu Leu Val
65 70 75 80
Leu Arg Gly Lys Pro Glu Asp Val Leu Pro Gln Val Phe Lys Asp Trp
85 90 95
Gln Val Asp Glu Leu Cys Tyr Glu Val Asp Thr Glu Pro Tyr Ala Val
100 105 110
Leu Arg Asp Ala His Val Ser Ser Leu Ala Lys Ala Ala Asn Val Glu
115 120 125
Val Lys Ser Phe Val Ser His Thr Leu Tyr Asp Thr Ala Asp Ile Val
130 135 140
Glu Arg Asn Gly Gly Lys Pro Pro Leu Thr Tyr Gln Ser Phe Ile Lys
145 150 155 160
Leu Val Asp Lys Met Gly Asp Pro Thr Ala Pro Ala Pro Asp Pro Pro
165 170 175
Glu Lys Met Pro Pro Pro Arg Asp Asp Leu Pro Gly Ala Ala Pro Gln
180 185 190
Glu Thr Ser Val Pro Thr Leu Lys Glu Ile Gly Tyr Asp Gln Glu Pro
195 200 205
Thr Ala Pro Phe Lys Gly Gly Glu Arg Glu Ala Leu Ala Arg Met Asp
210 215 220
Thr Tyr Leu Ser Asp Lys Leu Trp Val Ala Asn Phe Glu Lys Pro Gln
225 230 235 240
Thr Asp Pro Ser Ala Phe Glu Lys Pro Ala Thr Thr Thr Leu Ser Pro
245 250 255
Tyr Leu Lys Phe Gly Cys Leu Ser Pro Arg Leu Phe His Thr Arg Leu
260 265 270
Leu Gln Ile Tyr Lys Glu Gln Lys Lys His Ser Glu Pro Pro Val Ser
275 280 285
Leu Arg Gly Gln Leu Leu Trp Arg Glu Phe Phe Tyr Thr Val Gly Ala
290 295 300
His Thr Pro Asn Phe Ser His Met Val Gly Asn Thr Val Cys Arg Gln
305 310 315 320
Ile Asp Trp Arg His Gln Asp Ala Ala Thr Ala Asp Ser Glu Ala Glu
325 330 335
Gln His Leu Ala Ala Trp Lys Ala Gly Arg Thr Gly Phe Pro Trp Ile
340 345 350
Asp Ala Ile Met Thr Gln Leu His Glu Trp Gly Trp Ile His His Leu
355 360 365
Ala Arg His Ser Val Ala Cys Phe Leu Thr Arg Gly Asp Leu Tyr Ile
370 375 380
Ser Trp Glu Arg Gly Gln Glu Val Phe Glu Glu Leu Leu Leu Asp Gln
385 390 395 400
Asp His Phe Ile Asn Ala Gly Asn Trp Met Trp Leu Ser Ala Ser Ala
405 410 415
Phe Phe Ser Gln Tyr Phe Arg Val Tyr Ser Pro Val Val Phe Gly Lys
420 425 430
Lys Tyr Asp Pro Glu Gly Lys Tyr Ile Arg Lys Phe Leu Pro Val Leu
435 440 445
Lys Asp Met Pro Ala Lys Tyr Ile Tyr Glu Pro Trp Leu Ala Pro Thr
450 455 460
Glu Val Gln Lys Lys Ala Lys Cys Ile Ile Gly Val Asp Tyr Pro Arg
465 470 475 480
Pro Ile Val Asp His Ser Ile Ala Ser Lys Gln Asn Ile Gly Arg Met
485 490 495
Ala Ala Ala Tyr Lys Ala Asn Lys Gly Glu Gly Glu Gly Glu Ala Ala
500 505 510
Asp Thr Pro Lys Lys Ala Ala Lys Pro Arg Lys Ala Ala Ala Pro Lys
515 520 525
Ala Ala Lys Lys Glu Ala Thr Asp Val Val Ser Gly Lys Gly Ala Lys
530 535 540
Arg Gln Arg Thr Met Lys Glu Phe Ala Ser Lys Lys Glu Thr Glu
545 550 555
<210> 3
<211> 28
<212> DNA
<213>Artificial sequence
<400> 3
gtggggttgg attcatcact tggctcgt 28
<210> 4
<211> 28
<212> DNA
<213>Artificial sequence
<400> 4
ggattcatca cttggctcgt cactcggt 28
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<400> 5
atggcttctg tgaccggcaa 20
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence
<400> 6
tcactctgtc tccttcttgc tt 22

Claims (9)

1. a kind of Antarctic ice microalgae 6-4 light repair enzymes, it is characterised in that：Its amino acid sequence such as SEQ ID No:Shown in 2.
2. Antarctic ice microalgae 6-4 light repair enzymes according to claim 1, it is characterised in that：The Antarctic ice microalgae 6-4 light is repaired The isoelectric point of enzyme is 8.86, and relative molecular mass is 63.1KDa.
3. the encoding gene of the Antarctic ice microalgae 6-4 light repair enzymes described in claims 1, it is characterised in that：Its nucleotide sequence Such as SEQ ID No:Shown in 1.
4. encoding gene according to claim 3, it is characterised in that：The primer for cloning the encoding gene is：
F：ATGGCTTCTGTGACCGGCAA；
R：TCACTCTGTCTCCTTCTTGCTT.
5. the expression vector of enzyme coding gene is repaired containing the Antarctic ice microalgae 6-4 light described in claim 3.
6. expression vector according to claim 5, it is characterised in that：The expression vector is BL21 (DE3)/pET-28a (+)/6-4phr。
7. expression vector according to claim 5, it is characterised in that：The expression vector also includes selected marker base Cause, includes but is not limited to：The gene of enzyme or the gene of luminophor of color change are produced in expression bacterial strain or is had The gene of antibiotic marker.
8. the Antarctic ice microalgae 6-4 light repair enzyme described in claim 1 is for preparing the application in the preparation for repairing ultraviolet damage.
9. the Antarctic ice microalgae 6-4 light repair enzyme described in claim 1 is for preparing the application in cosmetics.
CN201710371568.8A 2017-05-24 2017-05-24 A kind of application of Antarctic ice microalgae 6-4 light repair enzyme, its encoding gene and expression vector and the enzyme Active CN107236722B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710371568.8A CN107236722B (en) 2017-05-24 2017-05-24 A kind of application of Antarctic ice microalgae 6-4 light repair enzyme, its encoding gene and expression vector and the enzyme

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710371568.8A CN107236722B (en) 2017-05-24 2017-05-24 A kind of application of Antarctic ice microalgae 6-4 light repair enzyme, its encoding gene and expression vector and the enzyme

Publications (2)

Publication Number Publication Date
CN107236722A true CN107236722A (en) 2017-10-10
CN107236722B CN107236722B (en) 2019-09-17

Family

ID=59985136

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710371568.8A Active CN107236722B (en) 2017-05-24 2017-05-24 A kind of application of Antarctic ice microalgae 6-4 light repair enzyme, its encoding gene and expression vector and the enzyme

Country Status (1)

Country Link
CN (1) CN107236722B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108096100A (en) * 2017-12-30 2018-06-01 唐林元 A kind of plant base light repairs suncream and preparation method thereof
CN109370968A (en) * 2018-11-02 2019-02-22 国家海洋局第海洋研究所 A kind of CPD light repair enzyme of mutation and 6-4 light repair enzyme double-mass model coexpression bacterial strain and its application
CN110452897A (en) * 2019-08-14 2019-11-15 山东大学 A kind of South Pole Huang sponge gourd moss CPD light repair enzyme and the preparation method and application thereof
CN113980918A (en) * 2021-10-18 2022-01-28 中国海洋大学 Antarctic ice algae MAAs synthetase and coding gene and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012006307A1 (en) * 2010-07-06 2012-01-12 Phycal, Inc Biosecure genetically modified algae

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012006307A1 (en) * 2010-07-06 2012-01-12 Phycal, Inc Biosecure genetically modified algae

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BEEL B等: "A Flavin Binding Cryptochrome Photoreceptor Responds to Both Blue and Red Light in Chlamydomonas reinhardtii", 《PLANT CELL》 *
YI Y等: "登录号：AAX56342.1", 《GENBANK》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108096100A (en) * 2017-12-30 2018-06-01 唐林元 A kind of plant base light repairs suncream and preparation method thereof
CN109370968A (en) * 2018-11-02 2019-02-22 国家海洋局第海洋研究所 A kind of CPD light repair enzyme of mutation and 6-4 light repair enzyme double-mass model coexpression bacterial strain and its application
CN109370968B (en) * 2018-11-02 2022-06-03 自然资源部第一海洋研究所 Mutant CPD (CPD-photorepair enzyme) and 6-4 photorepair enzyme double-plasmid co-expression strain and application thereof
CN110452897A (en) * 2019-08-14 2019-11-15 山东大学 A kind of South Pole Huang sponge gourd moss CPD light repair enzyme and the preparation method and application thereof
CN110452897B (en) * 2019-08-14 2022-06-03 山东大学 Antarctic yellow loofah CPD (cytochrome oxidase inhibitor) photorepair enzyme as well as preparation method and application thereof
CN113980918A (en) * 2021-10-18 2022-01-28 中国海洋大学 Antarctic ice algae MAAs synthetase and coding gene and application thereof
CN113980918B (en) * 2021-10-18 2023-11-24 自然资源部第一海洋研究所 Antarctic ice algae MAAs synthetase, and coding gene and application thereof

Also Published As

Publication number Publication date
CN107236722B (en) 2019-09-17

Similar Documents

Publication Publication Date Title
CN107236722B (en) A kind of application of Antarctic ice microalgae 6-4 light repair enzyme, its encoding gene and expression vector and the enzyme
Rottwinkel et al. Bathy phytochromes in rhizobial soil bacteria
CN103160488B (en) The application of a kind of Antarctic ice microalgae CPD light repair enzyme, its encoding gene and expression vector and this enzyme
Schultz et al. Luciferase of the Japanese syllid polychaete Odontosyllis umdecimdonta
Shen et al. Molecular cloning, characterization and expression of a novel Asr gene from Ginkgo biloba
CN105647943A (en) Saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof
CN105936898B (en) A kind of tea tree purple bud GAP-associated protein GAP CsGST and its encoding gene and application
CN109022328B (en) The application of one plant of polyP bacteria and its Polyphosphate kinase gene in sewage dephosphorization
Hoe et al. Isolation of a new member of DnaJ-like heat shock protein 40 (Hsp40) from human liver
CN103756982B (en) Tulipa fosteriana flavonol synthase TfFLS protein and encoding gene thereof
CN102465132B (en) Application of WRKY polypeptide Glyma02g39870 in promotion of salicylic acid biosynthesis and enhancement of disease resistance of plants
Guijun et al. The analysis of proteome changes in sunflower seeds induced by N+ implantation
CN103937809B (en) Super enriching plant Herba Solani Nigri metallothionein (MT-L2) gene order and cloning process thereof
Keerl A river runs through it-Ancient DNA data on the Neolithic populations of the Great Hungarian Plain
Mahdavi et al. Characterization of two predicted DASH-related proteins from the green alga Volvox carteri provides new insights into their light-mediated transcript regulation and DNA repair activity
CN110066817A (en) Kelp α type carbonic anhydrase gene Sj α-CA2 and its coding albumen and application
Zhidkin et al. Distribution of the rolB/C-like natural transgene in representatives of the genus Vaccinium L.
CN106811448B (en) Cotton tyrosine phosphatase GhPTP1 and its encoding gene and application
CN110452897A (en) A kind of South Pole Huang sponge gourd moss CPD light repair enzyme and the preparation method and application thereof
JP2003334084A (en) Root-specific gene responding to stress
CN109053870A (en) Application of AtERF49 gene during plant responding high temperature stress
CN102477431B (en) Application of R protein Glyma11g00320 to promotion of biosynthesis of salicylic acid and enhancement of disease resistance of plants
CN103966193A (en) Spirulina platensis CPD (cyclobutane pyrimidine dimer) photolyase and application thereof
CN110042107A (en) Safflower CtACO1 gene, its coding protein and application
CN108977414A (en) The artificial synthesized mutant and its coded sequence of a kind of beta carotene assimilation enzyme and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant