CN107236710B

CN107236710B - Cell expression system for stably expressing anti-TNF-alpha monoclonal antibody

Info

Publication number: CN107236710B
Application number: CN201710187701.4A
Authority: CN
Inventors: 罗学刚; 张同存; 苗峙; 李潜; 王鹏; 赵涧
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2017-03-27
Filing date: 2017-03-27
Publication date: 2021-03-26
Anticipated expiration: 2037-03-27
Also published as: CN107236710A

Abstract

The invention relates to a cell expression system for stably expressing an anti-TNF-alpha monoclonal antibody, a construction method and application thereof, wherein light and heavy chain encoding genes of the anti-TNF-alpha monoclonal antibody are optimized according to cell codon preference, an anti-TNF-alpha human mouse chimeric monoclonal antibody homologous recombinant vector using Bak1 gene and the like as targets is constructed, a CRISPR/Case9 vector with a specific cutting effect is constructed aiming at the exon region of the Bak1 and the like target genes, the two vectors are together introduced into Chinese hamster ovary Cells (CHO) by a liposome transfection mode, and a positive cell strain for stably expressing the anti-TNF-alpha monoclonal antibody is obtained by screening. The invention can be used for the high-efficiency production of the anti-TNF-alpha monoclonal antibody, and the antibody can be used for treating diseases such as rheumatoid arthritis, ankylosing spondylitis and the like.

Description

Cell expression system for stably expressing anti-TNF-alpha monoclonal antibody

Technical Field

The invention belongs to the field of biological medicine, and relates to construction and expression of a cell expression system for stably expressing an anti-TNF-alpha monoclonal antibody.

Background

Rheumatoid Arthritis (RA) is a chronic systemic immune inflammatory disease with unknown cause, can cause systemic joint swelling pain and dysfunction, is one of the main disability diseases, and seriously affects the life quality of patients. RA is a common disease worldwide, the prevalence rate of China is 0.3-0.4%, the RA can be attacked at any age, and is commonly seen in women of 30-50 years old.

At present, the drugs for treating RA mainly include non-steroidal anti-inflammatory drugs (NSAIDs), Disease-modifying anti-rheumatic drugs (NMARDs), adrenocortical hormones, traditional Chinese medicine preparations, biological preparations and the like, because the causes of RA are complex, and the effects of cytokines, immunity and the like are involved, the treatment of chemical drugs and traditional Chinese medicine preparations is lack of pertinence to target points, and with the rapid development of biotechnology, biological preparations such as monoclonal antibodies specifically aiming at the actions of cytokines become the most pertinent RA treatment drugs at present, and the RA treatment drugs with the best curative effect are regarded as the hopes of radically treating RA. Among them, the anti-TNF- α monoclonal antibody infliximab (trade name REMICADE) is a first-line treatment drug for RA that has been widely used in the united states, and has significant efficacy, fast onset of action, and sustained efficacy. However, the production of the medicine in China is still blank, the clinical application depends on import, and the treatment cost is high.

In addition, the current commercial anti-TNF-alpha monoclonal antibody co-expresses light chain and heavy chain by two plasmids, and has relatively poor genetic stability.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, and successfully realizes double cis-trans independent co-expression of the light chain and the heavy chain by introducing an internal ribosome binding site (IRES) between the gene sequences of the heavy chain and the light chain. Meanwhile, the CRISPR-Cas9 technology is utilized to stably integrate the gene of the anti-TNF alpha monoclonal antibody at a fixed point in the genome of a host cell, so that the gene which has potential negative influence on cell proliferation and antibody expression production is inactivated while the stable and efficient expression of the antibody is realized, and the production efficiency is improved.

The technical scheme of the invention is as follows:

a cell strain for stably expressing an anti-TNF-alpha monoclonal antibody carries out codon according to light chain and heavy chain encoding genes optimized by cell codon preference, constructs a light chain and heavy chain coexpression eukaryotic expression plasmid, and realizes the stable fixed-point integration of an antibody gene in a host genome by utilizing a CRISPR-Cas9 technology to obtain a positive cell strain for stably expressing the anti-TNF-alpha monoclonal antibody.

Furthermore, the host cells include CHO, NS0, SP2/0, and the CHO cells include CHO-K1, CHO-S.

A method for constructing a cell expression system for stably expressing an anti-TNF-alpha monoclonal antibody uses a gene which does not influence the basic survival capability of a cell and has potential negative influence on cell proliferation and antibody expression production as a target, constructs an anti-TNF-alpha human mouse chimeric monoclonal antibody homologous recombinant plasmid specifically integrated to a target gene site and a CRISPR/Case9 vector specifically cutting the target gene, co-transfects the recombinant plasmid and the CRISPR/Case9 vector into a host cell, and successfully obtains the anti-TNF-alpha monoclonal antibody LC and HC polycistronic coexpression cell system stably integrated at a fixed point through screening.

Moreover, the negatively affected genes include Bak1, Bax, Igfbp4, AqpI.

Moreover, the antibody homologous recombination expression plasmid is used for connecting the light chain LC and the heavy chain HC together in a polycistronic mode through an internal ribosome binding site IRES in series, so that independent co-expression is realized.

Moreover, the construction method is as follows:

(1) constructing an anti-TNF alpha human mouse chimeric monoclonal antibody homologous recombinant vector which does not influence the basic survival capability of cells and has potential negative influence on cell proliferation and antibody expression production by taking a gene as a target, wherein an antibody light chain LC and a heavy chain HC are connected in series through an internal ribosome binding site IRES in a polycistron mode, thereby realizing independent co-expression;

(2) aiming at the gene region with negative influence, a CRISPR/Case9 vector with specific cutting effect on the target gene locus is constructed;

(3) the two expression plasmids are co-transferred into host cells, and a stable fixed-point integrated anti-TNF-alpha monoclonal antibody LC and HC polycistronic and reverse co-expression cell line is successfully obtained through screening.

Moreover, the negatively affected genes include Bak1, Bax, Igfbp4, AqpI.

An application of a cell expression system for stably expressing an anti-TNF-alpha monoclonal antibody in the biological medicine field such as the production of the anti-TNF-alpha monoclonal antibody.

The invention has the advantages that:

1. when cloning antibody light chain and heavy chain sequences, amino acid codons are optimized, so that the codons in the target sequences are high-efficiency codons in CHO cells.

2. An internal ribosome binding site is introduced between the heavy chain gene sequence and the light chain gene sequence, so that double cis-trans independent co-expression of the light chain and the heavy chain is successfully realized, and the genetic stability of the light chain and the heavy chain is improved.

3. By using a CRISPR-Cas9 technology, the anti-TNF alpha human mouse chimeric monoclonal antibody gene is inserted into the gene position of Bak1, Bax, Igfbp4, AqpI and the like which does not influence the basic survival capability of cells and has potential negative influence on cell proliferation and antibody expression production, on one hand, the stable fixed-point integration of the antibody gene is realized, the genetic stability of a recombinant cell line is improved, the stable and efficient production is facilitated, on the other hand, the negative genes of Bak1, Bax, Igfbp4, AqpI and the like are inserted and inactivated, and the proliferation speed of cells and the antibody production performance are improved.

4. The invention takes a gene which does not influence the basic survival ability of cells and has potential negative influence on cell proliferation and antibody expression production as a target, constructs an anti-TNF alpha human mouse chimeric monoclonal antibody homologous recombination plasmid specifically integrated to a target gene locus and a CRISPR/Case9 vector specifically cutting the target gene, co-transfects the two into host cells, and successfully obtains a stable fixed-point integrated anti-TNF-alpha monoclonal antibody LC and HC polycistronic and coexpression cell line through screening.

Drawings

FIG. 1 is a pX330-Case9 plasmid map;

FIG. 2 shows the RT-PCR results of the positive clones of the antibody recombinant cells screened by the present invention.

Lanes

1 and 2 show the cDNA reverse transcribed from the mRNA presented in the antibody recombinant cells and the negative control cells, respectively, as templates. FIG. 2A shows the LC gene fragment amplified using LF and LR as primers. FIG. 2B shows the IRES gene fragment amplified using IF and IR as primers. FIG. 2C shows HC gene fragments amplified using HF and HR as primers. In all three panels, there is no band in lane 2, while in lane 1 there is a band at about 720bp (panel A), 600bp (panel B), and 1400bp (panel C). The sizes of the light chain gene, the IRES gene and the heavy chain gene are the same. The results show that the light chain gene, the IRES gene and the heavy chain gene have been successfully transcribed into mRNA in CHO-K1 cells, and lay the foundation for the next step of protein synthesis.

FIG. 3 shows the results of ELISA for antigen binding of anti-TNF α antibodies from positive clones of antibody recombinant cells screened according to the present invention. The ordinate 24 represents the negative control, i.e.the supernatant of CHO cells transformed with the plasmid in the absence of load. Horizontal coordinates refer to positive clone fluorescence intensity/cell/day: negative control fluorescence intensity/cell/day. Six single clones with the ratio of more than 16 are selected, namely G1C3, G1F3, G2G1, G2H4, G2C5 and G2F 5. Namely six monoclonals with highest expression quantity of anti-TNF-alpha mAb in single cell in one day.

FIG. 4 shows the purification and electrophoresis detection of the anti-TNF-alpha monoclonal antibody produced by the recombinant cell expression of the anti-TNF-alpha antibody screened by the present invention. FIG. 4a antibody purification P1, P2 represent two elution peaks; FIG. 4b, ELISA detects the content of anti-TNF-alpha monoclonal antibody in the two elution peaks of P1 and P2; FIG. 4c and FIG. 4d, SDS-PAGE detection is performed on the purified samples, FIG. 4c shows electrophoresis without reducing agent, and FIG. 4d shows electrophoresis with reducing agent DTT

Detailed Description

The present invention is further illustrated by the following specific examples, which are intended to be illustrative, not limiting and are not intended to limit the scope of the invention.

The invention provides a cell expression system for stably expressing an anti-TNF-alpha monoclonal antibody, a construction method and application thereof, and the specific contents comprise:

a cell expression system for stably expressing an anti-TNF-alpha monoclonal antibody is characterized in that codons are carried out on light and heavy chain coding genes optimized according to cell codon preference to construct a light and heavy chain co-expressed eukaryotic expression plasmid, an antibody homologous recombination vector which takes genes (BAK1 and Bax) which do not influence the basic survival capacity of cells and have potential negative influence on cell proliferation and antibody expression production as targets is constructed on the basis, a CRISPR/Case9 vector with a specific cleavage effect is constructed aiming at the target genes, two vectors are jointly introduced into host cells such as CHO-K1 and the like and are integrated onto a cell genome in a liposome transfection mode, and a positive cell strain for stably expressing the anti-TNF-alpha monoclonal antibody is obtained through screening.

The gene which does not affect the basic survival ability of cells and has potential negative surface influence on cell proliferation and antibody expression production is taken as a target, an anti-TNF alpha human mouse chimeric monoclonal antibody homologous recombinant plasmid specifically integrated to a target gene locus and a CRISPR/Case9 vector specifically cutting the target gene are constructed, the anti-TNF alpha monoclonal antibody LC and HC polycistronic and reverse coexpression cell line stably integrated at a fixed point are successfully obtained by co-transfecting the recombinant plasmid and the CRISPR/Case9 vector into a host cell and screening.

The genes which have negative effects include Bak1, Bax, Igfbp4, AqpI and the like which inhibit the processes of high-density culture, serum-free culture, suspension culture and the like of cells.

A method for constructing a cell expression system for stably expressing an anti-TNF-alpha monoclonal antibody is characterized in that: the construction method comprises the following steps:

(1) constructing an anti-TNF alpha human mouse chimeric monoclonal antibody homologous recombination vector which takes Bak1, Bax, Igfbp4, AqpI and the like as targets, does not influence the basic survival capability of cells, and has potential negative influence on cell proliferation and antibody expression production, wherein an antibody light chain LC and a heavy chain HC are connected in series through an internal ribosome binding site (IRES) in a polycistronic mode, so as to realize independent co-expression;

(2) aiming at a gene region of Bak1, Bax, Igfbp4, AqpI and the like which does not influence the basic survival capability of cells and has potential negative influence on cell proliferation and antibody expression production, a CRISPR/Case9 vector with specific cutting effect on a target gene locus is constructed;

The cell expression system for stably expressing the anti-TNF-alpha monoclonal antibody is mainly used for producing the TNF-alpha monoclonal antibody in the field of biological medicines.

The specific process is as follows:

firstly, the construction of recombinant plasmid for stably expressing anti-TNF-alpha monoclonal antibody (taking targeting Bak1 as a representative process) comprises the following steps:

1. construction of recombinant plasmid pcDNA3.1-LC-IRES-HC

The anti-TNF-alpha monoclonal antibody Light Chain (LC), the Internal Ribosome Entry Site (IRES) and the antibody Heavy Chain (HC) gene are synthesized by an artificial synthesis method, and the LC-IERS-HC gene which is connected in series is obtained, enzyme cutting sites are respectively introduced at two ends, and the recombinant plasmid pcDNA3.1-LC-IRES-HC is constructed by inserting the recombinant plasmid pcDNA3.1-LC-IRES-HC on a pcDNA3.1 vector after enzyme cutting and connection.

2. The construction of the homologous recombinant vector of the anti-TNF alpha human mouse chimeric monoclonal antibody with the BAK1 gene as a target comprises the following steps:

(1) on the basis of the construction of the recombinant plasmid pcDNA3.1-LC-IRES-HC, two fragments, namely a fragment 1 and a fragment 2, can be obtained by double enzyme digestion and recovery of BglII and BstZ 17I.

(2) A section of sequence is selected from the upstream and downstream of a Bak1 target sequence respectively to be used as a homologous template of homologous recombination plasmid, and two fragments are obtained through PCR amplification and are respectively a homologous arm 1 and a homologous arm 2. (primers contain homologous sequences of fragment 1 and fragment 2, respectively)

The primer information is as follows:

the PCR reaction conditions are shown in the following table:

(3) and carrying out homologous recombination on the fragment 1, the fragment 2, the homologous arm 1 and the homologous arm 2 to obtain the anti-TNF alpha human mouse chimeric monoclonal antibody homologous recombination vector taking the BAK1 gene as a target.

3. The construction of the CRISPR/Cas9 vector with Bak1 gene as target includes the following steps: synthesizing sgRNA gene aiming at target gene by artificial synthesis method, and connecting into pX330-Case9 (aminobenzyl resistance) plasmid by enzyme cutting Bbs1 to obtain CRISPR/Cas9 plasmid of target gene targeted cutting.

4. The establishment of CHO cell expression system of anti-TNF-alpha monoclonal antibody includes the following steps:

(1) mass extraction of plasmids: by alkaline cracking

(2) Transfection (Co-transformation of homologous recombination plasmid with CRISPR/Cas9 plasmid)

(3) G418 method for screening stable cell line

After 24 hours of transfection, the cells are inoculated on a 10cm culture plate according to a certain dilution ratio (according to the growth condition of the cells), a culture medium with the optimal screening concentration is added, and the solution is changed every other day.

② when the cells die after about 6 days, the serum concentration can be increased, for example, 10% serum is used originally, at this time, 20% serum can be used.

③ after 10 days of culture, the concentration of G418 is halved, and the screening pressure is maintained.

And fourthly, resistant clones can be found when the screening is carried out for about 12 to 14 days.

Fifthly, extracting the genome, and detecting whether the target gene is integrated on the genome by PCR. Extracting total RNA, and detecting whether the target gene is transcribed by RT-PCR.

Sixthly, after the target gene is integrated on the genome and is transcribed, a limit dilution method is used for screening positive clones, and the single clone is transferred into a 96-well plate for culture to reach 1 cell/well as possible.

And (c) identifying the single clone: wells of 1 cell/well were picked, labeled and only cells in these wells were detected by subsequent ELISA. After the cells are massively amplified, ELISA is used for detecting whether the target gene is expressed or not and determining the expression quantity.

According to the result of measuring the protein expression quantity by ELISA, several monoclonals with high expression quantity are selected and transferred to a six-hole plate for amplification culture, and in this case, the monoclonals are selected as a screening culture medium.

Ninthly, when the cell convergence reaches about 80-90%, the cells are passed to a culture dish of 10cm, the cells are selected as a screening culture medium, and when the cell convergence reaches about 80-90%, the cells are frozen.

Second, ELISA detection of anti-TNF-alpha monoclonal antibody

(1) The coating solution dissolves soluble TNF-alpha antigen, 50 mu L/hole of the antigen coating mixture is added, the final concentration is 1 mu g/mL, and the mixture is incubated at 37 ℃ for 2 hours or at 4 ℃ overnight.

(2) The coating mixture in the plate wells was removed, the plate was washed three times with wash solution (PBST) and the wash solution in the plate wells was removed.

(3) Adding 200 mu L/hole sealing solution into the well of the enzyme-labeled plate, incubating for 1h at 37 ℃, removing the sealing solution in the well after the incubation is finished, washing the plate for three times by using washing solution, and removing the washing solution in the well.

(4) Cell supernatants were taken and added to wells of an enzyme-labeled plate at 50. mu.L/well, and negative controls were set. Incubating for 1.5h at 37 ℃. After the incubation is finished, the cell supernatant in the plate hole is removed, and the plate is washed three times by using the washing solution, so that the washing solution in the plate hole is removed.

(5) The secondary antibody was diluted to 1:5000 to 1:8000 with blocking solution, and the secondary antibody diluted to the working concentration was added to a well of an microplate at 50. mu.L/well and incubated at 37 ℃ for 1 hour. After the incubation is finished, the secondary antibody in the plate hole is removed, and the plate is washed three times by using the washing solution, so that the washing solution in the plate hole is removed.

(6) TMB was developed and 50. mu.L/well of the formulated substrate was added to the plate, incubated at 37 ℃ and the reaction was stopped by adding 50. mu.L/well of 1M HCl once the color was developed. The microplate reader was turned on, adjusted to OD450nm readings, and relevant data was recorded.

Purification and detection of anti-TNF-alpha monoclonal antibody

Culturing antibody secreting cells for three days;

collecting cell culture supernatant on the fourth day, centrifuging, collecting supernatant at 10000g for 5 min, and filtering with 0.45 μm Polyethersulfone (PES) filter membrane;

thirdly, diluting the filtrate and the sample loading buffer solution of protein A according to the proportion of 1: 1;

purifying the antibody by an AKTA purifier10 protein purifier and a HiTrap rProtein A FF affinity column of GE company;

carrying out elution after sample loading and rinsing, and collecting an elution peak;

sixthly, dialyzing the collected eluent for 24 hours by using a dialysis bag with the molecular cut-off size of 10kD in PBS buffer solution with the pH value of 8.0;

seventhly, after the dialysis is finished, concentration treatment is carried out by using polyethylene glycol PEG 20000.

Preparing a 6% and a 12% polybutene amide gel;

ninthly, preparing two samples, treating one sample with reducing agent mercaptoethanol and the other sample without reducing agent before electrophoresis;

sample (r) was loaded into a 6% acrylamide gel without reducing agent treatment, and sample (r) was loaded into a 12% polyacrylamide gel with reducing agent treatment, and electrophoresis was started;

after electrophoresis is finished, soaking the two pieces of glue and dyeing the glue in a Coomassie brilliant blue R-250 solution for 3 hours, and then decoloring the glue for 12 hours;

two pieces of glue were scanned and imaged with an Odyssey gel imager.

SEQUENCE LISTING

<110> Tianjin science and technology university

<120> cell expression system for stably expressing anti-TNF-alpha monoclonal antibody

<130> 2017-03-27

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 705

<212> DNA

<213> Light Chain (LC) sequence of anti-TNF-alpha monoclonal antibody of the present invention

<400> 1

atggagaccg acaccctcct gctgtgggtg ctgctgctct gggttcctgg ctccactggc 60

gacatcctgc tgacccagtc tcctgctatc ctgtctgtat ctcctggcga gagggtgtct 120

ttctcttgcc gggccagcca gttcgtgggc tcttctatcc attggtacca gcagaggacc 180

aacggctctc ccaggctcct catcaaatat gcctccgagt ctatgtctgg catcccttct 240

cggttcagtg gcagtggctc tggcaccgac ttcaccctct ccatcaacac cgtggagtct 300

gaggatatcg ccgactatta ctgtcagcag agtcactctt ggcctttcac cttcggctcc 360

ggcaccaacc tggaggtcaa gcgaaccgtg gctgccccat ctgtgttcat cttccctcca 420

tctgatgagc agctcaagtc tggcactgcc tctgtggtgt gcctgctgaa taacttctat 480

cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccagtctgg caactcccag 540

gagagtgtga ccgagcagga cagcaaggac agcacctaca gcctcagcag caccctgacc 600

ctgagcaagg ccgactacga gaagcacaag gtgtacgcct gcgaggtgac ccatcagggc 660

ctgagctctc ccgtgaccaa gagcttcaac aggggcgagt gttga 705

<210> 2

<211> 1410

<212> DNA

<213> Heavy Chain (HC) sequence of anti-TNF-. alpha.monoclonal antibody of the present invention

<400> 2

atggactgga cctggagggt cttctgcttg ctggctgtgg caccaggtgc ccactccgag 60

gtgaagctgg aggagtctgg cggcggcctg gtgcagcctg gcggctctat gaagctgtct 120

tgcgtggctt ccggcttcat cttctctaat cactggatga actgggtgcg ccagtctcct 180

gagaagggcc tggagtgggt ggccgagatc cggtctaagt ccatcaattc cgccacccac 240

tatgctgagt ccgtgaaggg ccgcttcacc atctctcggg acgactctaa gtctgccgtc 300

tacctgcaga tgaccgacct gaggaccgag gacaccggcg tgtattactg ttccagaaac 360

tattatggct ctacctatga ttactggggc cagggcacca ccctcaccgt gtctagcgcc 420

tccaccaagg gcccatctgt gttccccctg gccccctctt ccaagtccac ttctggcggc 480

acagctgccc tgggctgcct ggtcaaggac tacttccccg agcctgtgac cgtgtcttgg 540

aactctggcg ccctgaccag cggcgtgcac accttccctg cagtgctcca gtcttccggc 600

ctgtactccc tgtcctctgt ggtgaccgtg ccctccagca gcctgggcac ccagacctac 660

atctgcaacg tgaatcacaa gcccagcaac accaaggtgg acaagaaggt ggagcccaag 720

tcttgtgaca agacccacac ctgcccaccc tgcccagccc ctgagctgct gggcggccct 780

tctgtgttcc tgttcccccc aaagcccaag gacaccctga tgatctcccg gacccctgag 840

gtgacctgcg tggtggtgga cgtgagccac gaggaccctg aggtgaagtt caactggtat 900

gttgacggag ttgaggtgca taatgccaag accaagcctc gggaggagca gtacaacagc 960

acctaccggg tggtgagcgt gctgaccgtg ctgcaccagg actggctgaa tggcaaggag 1020

tacaagtgca aggtgtccaa caaggccctg ccagccccca tcgagaagac catctccaag 1080

gccaagggcc agccccgaga gccacaggtg tacaccctgc ccccatcccg ggatgagctg 1140

accaagaatc aagtgtccct gacctgcctg gtgaagggct tctatcccag cgacatcgcc 1200

gtggagtggg agagcaatgg ccagcctgag aacaactaca agaccacccc tcccgtgctg 1260

gactccgacg gctccttctt cctgtactcc aagctgaccg tggacaagag caggtggcag 1320

cagggcaacg tgttctcttg ctccgtgatg catgaggctc tgcacaacca ctacacccag 1380

aagagcctgt ccctgtctcc cggcaagtga 1410

<210> 3

<211> 576

<212> DNA

<213> IRES sequence of anti-TNF-. alpha.monoclonal antibody of the present invention

<400> 3

cccccccccc taacgttact ggccgaagcc gcttggaata aggccggtgt gcgtttgtct 60

atatgttatt ttccaccata ttgccgtctt ttggcaatgt gagggcccgg aaacctggcc 120

ctgtcttctt gacgagcatt cctaggggtc tttcccctct cgccaaagga atgcaaggtc 180

tgttgaatgt cgtgaaggaa gcagttcctc tggaagcttc ttgaagacaa acaacgtctg 240

tagcgaccct ttgcaggcag cggaaccccc cacctggcga caggtgcctc tgcggccaaa 300

agccacgtgt ataagataca cctgcaaagg cggcacaacc ccagtgccac gttgtgagtt 360

ggatagttgt ggaaagagtc aaatggctct cctcaagcgt attcaacaag gggctgaagg 420

atgcccagaa ggtaccccat tgtatgggat ctgatctggg gcctcggtgc acatgcttta 480

catgtgttta gtcgaggtta aaaaaacgtc taggcccccc gaaccacggg gacgtggttt 540

tcctttgaaa aacacgatga taatatggcc acaacc 576

<210> 4

<211> 2810

<212> DNA

<213> LC-IRES-HC sequence of anti-TNF-alpha monoclonal antibody of the present invention after expansion of the recombinant cell line

<400> 4

taatacgact cactataggg agacccaagc tggctagtta agcttccacc atggagaccg 60

acaccctcct gctgtgggtg ctgctgctct gggttcctgg ctccactggc gacatcctgc 120

tgacccagtc tcctgctatc ctgtctgtat ctcctggcga gagggtgtct ttctcttgcc 180

gggccagcca gttcgtgggc tcttctatcc attggtacca gcagaggacc aacggctctc 240

ccaggctcct catcaaatat gcctccgagt ctatgtctgg catcccttct cggttcagtg 300

gcagtggctc tggcaccgac ttcaccctct ccatcaacac cgtggagtct gaggatatcg 360

ccgactatta ctgtcagcag agtcactctt ggcctttcac cttcggctcc ggcaccaacc 420

tggaggtcaa gcgaaccgtg gctgccccat ctgtgttcat cttccctcca tctgatgagc 480

agctcaagtc tggcactgcc tctgtggtgt gcctgctgaa taacttctat cccagagagg 540

ccaaagtaca gtggaaggtg gataacgccc tccagtctgg caactcccag gagagtgtga 600

ccgagcagga cagcaaggac agcacctaca gcctcagcag caccctgacc ctgagcaagg 660

ccgactacga gaagcacaag gtgtacgcct gcgaggtgac ccatcagggc ctgagctctc 720

ccgtgaccaa gagcttcaac aggggcgagt gttgagaatt cgcccctctc cctccccccc 780

ccctaacgtt actggccgaa gccgcttgga ataaggccgg tgtgcgtttg tctatatgtt 840

attttccacc atattgccgt cttttggcaa tgtgagggcc cggaaacctg gccctgtctt 900

cttgacgagc attcctaggg gtctttcccc tctcgccaaa ggaatgcaag gtctgttgaa 960

tgtcgtgaag gaagcagttc ctctggaagc ttcttgaaga caaacaacgt ctgtagcgac 1020

cctttgcagg cagcggaacc ccccacctgg cgacaggtgc ctctgcggcc aaaagccacg 1080

tgtataagat acacctgcaa aggcggcaca accccagtgc cacgttgtga gttggatagt 1140

tgtggaaaga gtcaaatggc tctcctcaag cgtattcaac aaggggctga aggatgccca 1200

gaaggtaccc cattgtatgg gatctgatct ggggcctcgg tgcacatgct ttacatgtgt 1260

ttagtcgagg ttaaaaaaac gtctaggccc cccgaaccac ggggacgtgg ttttcctttg 1320

aaaaacacga tgataatatg gccacaacca tggactggac ctggagggtc ttctgcttgc 1380

tggctgtggc accaggtgcc cactccgagg tgaagctgga ggagtctggc ggcggcctgg 1440

tgcagcctgg cggctctatg aagctgtctt gcgtggcttc cggcttcatc ttctctaatc 1500

actggatgaa ctgggtgcgc cagtctcctg agaagggcct ggagtgggtg gccgagatcc 1560

ggtctaagtc catcaattcc gccacccact atgctgagtc cgtgaagggc cgcttcacca 1620

tctctcggga cgactctaag tctgccgtct acctgcagat gaccgacctg aggaccgagg 1680

acaccggcgt gtattactgt tccagaaact attatggctc tacctatgat tactggggcc 1740

agggcaccac cctcaccgtg tctagcgcct ccaccaaggg cccatctgtg ttccccctgg 1800

ccccctcttc caagtccact tctggcggca cagctgccct gggctgcctg gtcaaggact 1860

acttccccga gcctgtgacc gtgtcttgga actctggcgc cctgaccagc ggcgtgcaca 1920

ccttccctgc agtgctccag tcttccggcc tgtactccct gtcctctgtg gtgaccgtgc 1980

cctccagcag cctgggcacc cagacctaca tctgcaacgt gaatcacaag cccagcaaca 2040

ccaaggtgga caagaaggtg gagcccaagt cttgtgacaa gacccacacc tgcccaccct 2100

gcccagcccc tgagctgctg ggcggccctt ctgtgttcct gttcccccca aagcccaagg 2160

acaccctgat gatctcccgg acccctgagg tgacctgcgt ggtggtggac gtgagccacg 2220

aggaccctga ggtgaagttc aactggtatg ttgacggagt tgaggtgcat aatgccaaga 2280

ccaagcctcg ggaggagcag tacaacagca cctaccgggt ggtgagcgtg ctgaccgtgc 2340

tgcaccagga ctggctgaat ggcaaggagt acaagtgcaa ggtgtccaac aaggccctgc 2400

cagcccccat cgagaagacc atctccaagg ccaagggcca gccccgagag ccacaggtgt 2460

acaccctgcc cccatcccgg gatgagctga ccaagaatca agtgtccctg acctgcctgg 2520

tgaagggctt ctatcccagc gacatcgccg tggagtggga gagcaatggc cagcctgaga 2580

acaactacaa gaccacccct cccgtgctgg actccgacgg ctccttcttc ctgtactcca 2640

agctgaccgt ggacaagagc aggtggcagc agggcaacgt gttctcttgc tccgtgatgc 2700

atgaggctct gcacaaccac tacacccaga agagcctgtc cctgtctccc ggcaagtgac 2760

tcgagtctag agggcccttc gaacaaaaac tcatctcaga agaggatctg 2810

<210> 5

<211> 23

<212> DNA

<213> sgRNA Gene sequence of target Gene

<400> 5

ccccgagatg gacaatttgc tcc 23

<210> 6

<211> 50

<212> DNA

<213> homology arm 1 upstream

<400> 6

gccacctgac gtcgacggat cgggaggact tggggttcgt atcccaggtc 50

<210> 7

<211> 50

<212> DNA

<213> downstream of homology arm 1

<400> 7

gagagtgcac cataggggat cgggaccccc tgggtctctt gttcctgatg 50

<210> 8

<211> 50

<212> DNA

<213> homology arm 2 upstream

<400> 8

atcaatgtat cttatcatgt ctgtagggag ggggactgga cttatctctg 50

<210> 9

<211> 50

<212> DNA

<213> downstream of homology arm 2

<400> 9

aagctctagc tagaggtcga cggtagggtg tggtttgaaa gtgtgaaccc 50

Claims

1. A method for constructing a cell expression system for stably expressing an anti-TNF-alpha monoclonal antibody comprises the following steps:

1) construction of recombinant plasmid pcDNA3.1-LC-IRES-HC

Synthesizing an anti-TNF-alpha monoclonal antibody light chain LC, an internal ribosome entry site IRES and an LC-IERS-HC gene of an antibody heavy chain HC gene series by a synthetic method, respectively introducing enzyme cutting sites at two ends, and inserting the enzyme cutting sites into a pcDNA3.1 vector after enzyme cutting and connection so as to construct a recombinant plasmid pcDNA3.1-LC-IRES-HC; the LC, HC and IRES gene sequences are respectively shown in SEQ ID NO: 1. 2 and 3;

2) and constructing the homologous recombinant vector of the anti-TNF alpha human mouse chimeric monoclonal antibody with the BAK1 gene as a target, which comprises the following steps:

(1) on the basis of the construction of recombinant plasmid pcDNA3.1-LC-IRES-HC, carrying out double enzyme digestion by BglII and BstZ17I and recovering to obtain two fragments, namely a fragment 1 and a fragment 2;

(2) respectively selecting a section of sequence on the upstream and downstream of a Bak1 target sequence as a homologous template of a homologous recombinant plasmid, and performing PCR amplification to obtain two fragments which are respectively a homologous arm 1 and a homologous arm 2; the primers contain homologous sequences of fragment 1 and fragment 2, respectively,

the primer information is as follows:

homology arm 1 upstream primer: GCCACCTGACGTCGACGGATCGGGAGGACTTGGGGTTCGTATCCCAGGTC the flow of the air in the air conditioner,

homology arm 1 downstream primer: GAGAGTGCACCATAGGGGATCGGGACCCCCTGGGTCTCTTGTTCCTGATG the flow of the air in the air conditioner,

the length of the product is 921 bp;

homology arm 2 upstream primer: ATCAATGTATCTTATCATGTCTGTAGGGAGGGGGACTGGACTTATCTCTG the flow of the air in the air conditioner,

homology arm 2 downstream primer: AAGCTCTAGCTAGAGGTCGACGGTAGGGTGTGGTTTGAAAGTGTGAACCC the flow of the air in the air conditioner,

the length of the product is 792 bp;

the PCR reaction conditions were as follows:

the PCR amplification reaction conditions of the homology arm 1 are as follows: 3min at 94 ℃; 45s at 94 ℃, 45s at 62 ℃ and 1min at 72 ℃; 10min at 72 ℃; 30 cycles;

the PCR amplification reaction conditions of the homology arm 2 are as follows: 94 ℃ for 3 min; 45s at 94 ℃, 45s at 60 ℃ and 1min at 72 ℃; 10min at 72 ℃; 30 cycles;

(3) carrying out homologous recombination on the fragment 1, the fragment 2, the homologous arm 1 and the homologous arm 2 to obtain an anti-TNF alpha human mouse chimeric monoclonal antibody homologous recombination vector taking a BAK1 gene as a target;

3) and constructing a CRISPR/Cas9 vector targeting the Bak1 gene, which comprises the following steps: synthesizing sgRNA gene aiming at the target gene by an artificial synthesis method, and connecting the sgRNA gene into pX330-Case9 plasmid with ampicillin resistance by enzyme digestion Bbs1 to obtain CRISPR/Cas9 plasmid for target gene targeted cleavage;

4) the establishment of the CHO cell expression system of the anti-TNF-alpha monoclonal antibody comprises the following steps:

(1) extracting plasmid by an alkaline cracking method;

(2) transfection, homologous recombination plasmid and CRISPR/Cas9 plasmid cotransformation;

(3) screening a stable cell line by a G418 method;

and the number of the first and second electrodes,

diluting and inoculating the cells to a 10cm culture plate according to a proportion after 24 hours of transfection, adding a culture medium with the optimal screening concentration, and changing the culture medium once every other day;

② when the cells die in large quantity after about 6 days of culture, the serum concentration in the culture medium is increased;

③ after 10 days of culture, halving the concentration of G418, and maintaining the screening pressure;

fourthly, resistant clones appear after about 12 to 14 days of screening;

extracting genome, and detecting whether the target gene is integrated on the genome by PCR; extracting total RNA, and detecting whether a target gene is transcribed by RT-PCR;

sixthly, after the target gene is integrated on the genome and is transcribed, screening positive clones by using a limiting dilution method, transferring the single clones into a 96-well plate for culture, and achieving 1 cell/well;

and (c) identifying the single clone: picking out holes with 1 cell/hole, marking, and detecting the cells in the holes by ELISA; after cell amplification, ELISA is used for detecting whether the target gene is expressed or not and determining the expression quantity;

selecting the monoclone with high expression quantity to transfer to a six-hole plate for amplification culture according to the result of measuring the protein expression quantity by ELISA, and using a screening culture medium at the moment;

ninthly, when the cell concentration reaches 80-90%, the cells are passed to a culture dish of 10cm, at the moment, a screening culture medium is used, and when the cell concentration reaches 80-90%, the cells are frozen.