CN107227341B

CN107227341B - Application of LncRNA HOXD-AS1 in prostate cancer diagnosis and drug treatment

Info

Publication number: CN107227341B
Application number: CN201710298757.7A
Authority: CN
Inventors: 黄健; 林天歆; 陈旭; 顾鹏; 谢锐辉
Original assignee: Sun Yat Sen Memorial Hospital Sun Yat Sen University
Current assignee: Sun Yat Sen Memorial Hospital Sun Yat Sen University
Priority date: 2017-04-27
Filing date: 2017-04-27
Publication date: 2021-01-15
Anticipated expiration: 2037-04-27
Also published as: CN107227341A

Abstract

The invention discloses an application of LncRNA HOXD-AS1 in prostate cancer diagnosis and drug treatment, wherein the DNA sequence of a specific probe of LncRNA HOXD-AS1 is shown AS SEQ ID NO. 2; the specific primer of the LncRNA HOXD-AS1 is a primer pair consisting of DNA sequences shown AS SEQ ID NO. 3 and SEQ ID NO. 4; the RNA sequence of the siRNA for inhibiting the expression of the LncRNA HOXD-AS1 is at least one of SEQ ID NO. 5 or SEQ ID NO. 6. The research of the invention finds that LncRNA HOXD-AS1 is an important carcinogenic factor of the prostate cancer, and can be used AS a molecular marker for prognosis diagnosis of the prostate cancer and a novel target point for treatment.

Description

Application of LncRNA HOXD-AS1 in prostate cancer diagnosis and drug treatment

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to application of LncRNA HOXD-AS1 in prostate cancer diagnosis and drug treatment.

Background

The incidence of Prostate Cancer (PCa) in china has increased year by year, and has become the most common malignant tumor of the male urogenital system, seriously threatening the health of the elderly male. Early stage prostate cancer is treated mainly by surgery, but some patients develop in situ recurrence of the tumor or distant metastasis after surgery. Some patients are diagnosed at an advanced stage, and the success rate of the operation is very low. Androgen deprivation therapy (Androgen)

Deprivation Therapy, ADT) or Castration (Castration) is a first-line treatment for advanced Prostate Cancer, and although approximately 90% of Prostate Cancer patients respond well to Castration Therapy (manifested by a decrease in PSA and tumor shrinkage), tumors generally no longer respond to Castration Therapy after 18-24 months and develop Castration Resistant Prostate Cancer (CRPC). Poor prognosis of castration resistant prostate cancer is a major cause of death in prostate cancer patients. Paclitaxel-based drugs (such as docetaxel) are first-line drugs that castrate against prostate cancer, and although such drugs can alleviate symptoms of CRPC and reduce PSA levels, the overall survival benefit for the patient is not significant. Therefore, there is a need to find markers for predicting the prognosis of prostate cancer recurrence (e.g., castration sensitivity and chemotherapy sensitivity) and to develop new targets for prostate cancer therapy.

In recent years, a lot of researches show that Long non-coding RNA (Long non-coding RNA) refers to a non-coding RNA subclass which has a transcript length of more than 200 nucleotides and does not code protein, and is widely involved in regulating and controlling various life activity processes of human bodies at an epigenetic level. lncRNA is abnormally expressed in various malignant tumors, and plays an important role in oncogene or cancer suppressor gene in tumorigenesis and development through the regulation and control of downstream target genes. Recent studies have found that lncRNA also plays an important role in prostate cancer. For example, lncRNA HOTAIR is highly expressed in Castration Resistant Prostate Cancer (CRPC), and the knockdown of HOTAIR can inhibit the proliferation and castration resistance of prostate cancer cells. The SChLAP1 is highly expressed in prostate cancer and metastatic prostate cancer, the proliferation of the prostate cancer can be inhibited by knocking down SChLAP1 in a prostate cancer cell line, and the invasion capacity of the prostate cancer can be promoted by over-expressing SChLAP1 in a prostate epithelial cell line RWPE-1. Although the current research reveals that lncRNA is involved in the processes of prostate cancer proliferation, metastasis, androgen signal transduction and the like, the mechanism of castration resistant prostate cancer development is still not clearly elucidated.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides the application of LncRNA HOXD-AS1 in prostate cancer diagnosis and drug treatment. In order to achieve the purpose, the invention adopts the technical scheme that: LncRNA HOXD-AS1 gene and application of expression product thereof in screening or preparing a pharmaceutical preparation, a chip or a kit for diagnosing or treating prostate cancer, prognosis recurrence of prostate cancer or clinical stage of prostate cancer, wherein the LncRNA HOXD-AS1 gene sequence is shown AS SEQ ID NO: 1. LncRNA HOXD-AS1 is also called HAGLR, and its gene ID is 401022.

In addition, the invention also provides application of an LncRNA HOXD-AS1 inhibitor in preparing a pharmaceutical preparation for treating prostatic cancer, wherein the LncRNA HOXD-AS1 inhibitor treats the prostatic cancer by inhibiting the expression of LncRNA HOXD-AS1 gene or reducing the expression level of LncRNA HOXD-AS1 gene, and the sequence of the LncRNA HOXD-AS1 gene is shown AS SEQ ID NO. 1.

In addition, the invention also provides a specific probe of LncRNA HOXD-AS1, and the DNA sequence of the probe is shown AS SEQ ID NO. 2.

In addition, the invention also provides a specific primer of LncRNA HOXD-AS1, wherein the primer is a primer pair consisting of DNA sequences shown AS SEQ ID NO. 3 and SEQ ID NO. 4.

In addition, the present invention provides a kit comprising the probe according to claim 3 and/or the primer according to claim 4.

In addition, the invention also provides application of the kit in diagnosing prostate cancer, prognosis recurrence of prostate cancer or clinical stage of prostate cancer.

In addition, the present invention provides an siRNA inhibiting expression of LncRNA HOXD-AS1 gene, the siRNA being selected from siRNA1 or siRNA2, wherein: the sequence of the siRNA1 is shown as SEQ ID NO. 5, and the sequence of the siRNA2 is shown as SEQ ID NO. 6.

In addition, the invention also provides application of the siRNA in preparing a medicinal preparation for treating prostate cancer.

In addition, the present invention provides a pharmaceutical preparation comprising the siRNA of claim 7.

In addition, the invention also provides application of the pharmaceutical preparation in treating prostatic cancer.

The invention has the beneficial effects that: the invention provides an application of LncRNA HOXD-AS1 in prostate cancer diagnosis and drug treatment, and in view of the importance of lnncRNAs in prostate cancer, a gene LncRNA HOXD-AS1 related to prostate cancer castration resistance is screened out through a gene chip; the analysis of a TCGA database finds that LncRNA HOXD-AS1 is highly expressed in prostate cancer cases with high stage, Gleason score and lymph node metastasis, is negatively related to the prognosis of progression-free survival, and is an independent index for diagnosing the survival prognosis of the prostate cancer; in vivo and in vitro functional experiments show that the silent LncRNA HOXD-AS1 can inhibit the proliferation, castration resistance and chemotherapy resistance of prostate cancer cells; the results show that LncRNA HOXD-AS1 is an important carcinogenic factor of the prostate cancer, and can be used AS a molecular marker for prognosis diagnosis of the prostate cancer and a novel target point for treatment.

Drawings

FIG. 1 is a graph of the screening of the prostate cancer castration resistance-associated lncRNAs in example 1; in fig. 1A, lncRNAs differentially expressed in the hormone-dependent prostate cancer cell line LNCaP and the hormone-independent prostate cancer cell lines LNCaP-Bic and LNCaP-AI are detected by a gene chip; FIG. 1B shows that IncRNAs with higher upregulation multiples in the chip are detected by real-time quantitative PCR; FIG. 1C RNA-FISH detection of the subcellular localization of IncRNA HOXD-AS1 on a 10 μm scale.

FIG. 2 is a Kaplan-Miere survival analysis of example 2 analyzing the progression-free survival of prostate cancer cases in the HOXD-AS1 high/low expression group;

FIG. 3 is a graph showing that silencing expression of LncRNA HOXD-AS1 inhibits prostate cancer cell proliferation in example 3; wherein, FIG. 3A detects the interference efficiency of LncRNA HOXD-AS1 in LNCaP, LNCaP-Bic, LNCaP-AI and PC-3 cells using qPCR; FIG. 3B uses MTS to examine the effect of knockdown of LncRNA HOXD-AS1 in LNCaP and PC-3 cells on their proliferative capacity in normal media; FIG. 3C uses MTS to test the effect of knockdown LncRNAHOXD-AS1 on its proliferative capacity in androgen deprivation media in LNCaP, LNCaP-Bic, and LNCaP-AI cells; FIG. 3D Effect of knock-down LncRNAHOXD-AS1 on LNCaP and PC-3 cell clonality; denotes p <0.05, denotes p < 0.01;

FIG. 4 is a graph showing that silencing of LncRNA HOXD-AS1 expression in example 4 enhances prostate cancer cell sensitivity to castration treatment drugs; in FIG. 4A, after the LncRNA HOXD-AS1 is knocked down in LNCaP, LNCaP-Bic and LNCaP-AI cell strains, the sensitivity of cells to bicalutamide is detected by MTS; FIG. 4B Bicarinamine IC after knockdown of LncRNA HOXD-AS1₅₀Variation of (1), IC₅₀Expressed as mean ± standard deviation; denotes p<0.05, represents p<0.01；

FIG. 5 shows the sediment of example 4The expression of the default LncRNA HOXD-AS1 can enhance the sensitivity of the prostate cancer cells to the in vitro paclitaxel chemotherapy; wherein, FIG. 5A detects the effect of knocking down LncRNA HOXD-AS1 on paclitaxel sensitivity in LNCaP, LNCaP-Bic, LNCaP-AI and PC-3 cells by MTS; FIG. 5B paclitaxel IC after knockdown of LncRNA HOXD-AS1₅₀Variation of (1), IC₅₀Expressed as mean ± standard deviation; denotes p<0.05, represents p<0.01；

FIG. 6 is a graph showing that silencing LncRNA HOXD-AS1 increased the rate of paclitaxel-induced apoptosis in prostate cancer cells in example 4; in FIG. 6A, after silencing LncRNA HOXD-AS1 in LNCaP, LNCaP-Bic, LNCaP-AI and PC-3 cells, the apoptosis ratio was detected by flow cytometry, DMSO was used AS a control group, and PTX was used AS a paclitaxel-treated group; FIG. 6B flow cytometry analysis of apoptotic cell proportion statistics, the proportion is expressed as mean. + -. standard deviation; denotes p <0.05, denotes p < 0.01.

Detailed Description

To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the following detailed description, accompanying tables and drawings.

The cell lines, lncRNA expression profiling chips and reagents mentioned in this application are commercially available or otherwise publicly available, and are merely exemplary and not exclusive to the present invention, and may be replaced by other suitable tools and biomaterials, respectively.

Example 1 identification of the prostate cancer castration resistance-associated Gene LncRNA HOXD-AS1

Prostate cancer cell culture

Prostate cancer cell lines LNCaP and PC-3 were purchased from American Type Culture Collection (ATCC), LNCaP was cultured in RPMI-1640 medium, and PC-3 was cultured in F12K medium. The medium contained 10% fetal bovine serum, 50U/ml penicillin and 50. mu.g/ml streptomycin. Before androgen-related experiments, LNCaP should be pretreated in phenol red-free RPMI-1640 containing 10% charcoal-adsorbed serum for 48-72 h to completely remove the influence of hormone.

Construction of castration resistant prostate cancer cell line

Construction of cell lines castration resistant to prostate cancer based on LNCaP cells using two methods

1) Adding bicalutamide with the final concentration of 20 mu M into a phenol-free red 1640 culture medium and 10% of common fetal calf serum, continuously passaging for 12 months (about 48-50 generations) and establishing LNCaP-Bic cells;

2) using a phenol red-free 1640 culture medium and 10% charcoal to adsorb serum, and continuously carrying out passage for 12 months (about 48-50 generations) to establish LNCaP-AI cells;

the castration-resistant prostate cancer cell line LNCaP-Bic uses phenol red-free RPMI-1640 containing 10% of fetal bovine serum, and added with BicalutaMide (Bicalutamide) with a concentration of 20 μ M, and the LNCaP cell uses phenol red-free RPMI-1640 containing 10% of carbon adsorption fetal bovine serum. Both the medium was supplemented with 50U/ml penicillin and 50. mu.g/ml streptomycin.

lncRNA expression profiling chip

Preparing LNCaP, LNCaP-Bic and LNCaP-AI cells, cracking the cells after logarithmic growth phase by using Trizol, extracting RNA for quality identification, amplifying the RNA qualified by quality inspection according to a marking method of a general marking kit of Boo biological chip, and transcribing to generate fluorescence-marked cRNA; the marked sample is hybridized on a crystal core lncRNA + mRNA expression spectrum chip (4 multiplied by 180K) of Boo biological company Limited (China, Beijing), and scanned by an Agilent Scanner G2565CA Scanner after being hybridized and rinsed; raw data analysis was done by Agilent Feature Extraction Software (version 10.7.3.1) Software. The standard for differential genes is that the expression changes by more than or equal to 2 times.

As shown in FIG. 1A, there was a difference in the expression of lncRNA in androgen-dependent cells LNCaP, androgen-independent cells LNCaP-Bic, and LNCaP-AI cells.

RNA extraction and reverse transcription-real-time fluorescence quantitative PCR experiment

Total RNA extraction: discarding the culture medium, washing with PBS for 2 times, adding 1ml of Trizol lysate into each well of 6-well plate cells, repeatedly blowing, uniformly mixing to fully lyse the cells, standing at room temperature for 10-15 min, and transferring the lysate to a 1.5ml EP tube. 1/5 volumes of chloroform was added, mixed by vigorous shaking and allowed to stand at room temperature until separation occurred. The solution in the EP tube was centrifuged at 12000rpm for 15min at 4 ℃ while the solution was divided into three layers, and the uppermost supernatant (about 400-500. mu.l) was carefully transferred to a new RNase-free EP tube, taking care not to touch the mesophase and pellet. And (3) RNA precipitation: adding isopropanol (about 400-500 mu l) with the same volume as the supernatant, fully mixing uniformly, and standing for 10min at room temperature. After centrifugation at 12000rpm for 10min at 4 ℃ the supernatant was discarded to obtain an RNA precipitate. Adding 1ml of 75% ethanol, washing for 1 time, centrifuging at 4 ℃ and 7500rpm for 5min, fully removing ethanol, and air drying until RNA is completely transparent. Adding appropriate amount of DEPC treated water according to the size of the precipitate, and fully shaking and uniformly mixing. RNA concentration and purity detection: using a Nano drop 2000Spectrophotometer, firstly, treating water with DEPC to zero, and adding 1. mu.l of RNA sample to detect the concentration and purity; if OD260/OD280 are in

1.9-2.1, which shows that the RNA has good quality and no protein pollution; if OD260/OD280 is less than 1.8, it indicates protein contamination in the RNA.

Reverse transcription: the reverse transcription reagent PrimerScript RT-PCR kit (TAKARA) was used. The following systems were prepared in 200. mu.l PCR tubes without RNase as shown in Table 1:

TABLE 1

The solution is mixed evenly and put into a PCR instrument, and the temperature is set as follows: 15min at 37 ℃; reverse transcription was performed at 85 ℃ for 5 s. The product can be used for subsequent PCR experiments after being diluted by 10 times by DEPC water, and can be stored at-30 ℃ for a long time.

Fluorescent quantitative PCR: the experiment adopts SYBR Green PCR kit of Roche, Bio-rad CFXConnect read-Time System to carry out the fluorescent quantitative PCR experiment. GAPDH as internal reference, 2 for quantitative determination^-ΔΔctThe method is carried out. The quantitative PCR system was prepared as shown in Table 2. The experimental steps are as follows: 1) a distribution pipe: comprises SYBRGreen, water, upstream and downstream primers, and is fully and evenly mixed; 2) adding the reagents in the main tube into a 96-well plate, wherein each well is 8 mu l; 3) fully and uniformly mixing the diluted cDNA, wherein each hole is 2 mu l; 4) and (5) pasting a film, centrifuging and loading on a machine. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; 45 amplification cycles: denaturation at 95 ℃ for 15s, de-ignition at 56 ℃ for 15s, and extension at 72 ℃ for 15 s; keeping at 72 deg.C for 7 min; dissolving yeastLine: the temperature is 55-95 ℃ and 1 time/min.

TABLE 2

LncRNA HOXD-AS1 primers were: primer F (SEQ ID NO: 3): ACCTGCCTCTACTACTGCAAA, Primer R (SEQ ID NO: 4): GCAAAGACAATATAAGGGCCC, respectively; thus, the expression level of HOXD-AS1 was determined. As shown in FIG. 1B, differences exist in the expression of LncRNA HOXD-AS1 in androgen-dependent cells LNCaP, androgen-independent cells LNCaP-Bic, and LNCaP-AI cells.

RNA fluorescence in situ hybridization (RNA-FISH)

Cell culture: the cells are inoculated in a 10-15 mm small dish special for a confocal microscope, and the cell confluence degree is up to 50-60% before the experiment. Cell fixation and permeabilization: (1) washing cells with 1 × PBS for 5min, 1 time; (2) fixing 4% paraformaldehyde at room temperature for 10 min; (3) washing the cells with 1 × PBS for 3 times, 5min each time; (4) adding 1ml of precooled 0.5% Triton X-100 PBS into each well, and standing for 10min at 4 ℃; (5) after discarding the passage solution, 1 × PBS was added to wash the cells 3 times for 5min each time. And (3) probe hybridization: (1) adding 200 μ l of prehybridization solution into each well, and prehybridization at 37 deg.C for 30 min; (2) during prehybridization, the hybridization solution is preheated at 37 ℃; (3) adding 2.5 μ l of 20 μ M HOXD-AS1FISH probe stock solution, 2.5 μ l of internal reference U6 and 18S FISH probe stock solution into 150 μ l of hybridization solution respectively in dark, and mixing well; (4) discarding the pre-hybridization solution, adding 150 μ l of hybridization solution containing probe, keeping out of the sun, hybridizing overnight at 37 deg.C, keeping the hybridization environment wet; (5) washing the cells 3 times, 5min each time, with 42 ℃ in the dark, 4 XSSC, 0.1% Tween-20; (6) light-shielding, washing cells 1 time at 42 ℃ in 2 XSSC; (7) light-shielding, washing cells 1 times with 1 XSSC at 42 ℃; (8) the cells were washed with 1 × PBS in the dark and shaken at room temperature for 5 min. DNA staining, mounting and photographing: (1) shading, dyeing with DAPI staining solution for 1 min; (2) washing the cells with 1 × PBS 3 times in a dark place for 5min each time; (3) the PBS was completely discarded, and 80. mu.l of a fluorescent anti-quenching blocking tablet was added dropwise; (4) the photographs were taken under a fluorescent confocal microscope at 63 Xoil.

LncRNA HOXD-AS1 specific probe (shown in SEQ ID NO: 2): CGCATCTCTATTTGGTTTGA, respectively; thus, the expression level and subcellular localization of LncRNA HOXD-AS1 in the cells were examined. As shown in FIG. 1C, LncRNA HOXD-AS1 was mainly expressed in the nuclear location of prostate cancer cells.

Example 2 high expression of LncRNA HOXD-AS1 was significantly associated with tumor stage, Gleason score, lymph node metastasis and poor prognosis of prostate cancer

Expression value data of LncRNA HOXD-AS1 in TCGA for prostate cancer patients is derived from TANRIC (http:// ibl.mdanderson.org/tandic/_ design/basic/query.html), clinical information corresponding to patients is from TCGA website https:// cancer. nih.gov/, clinical pathological information of 374 prostate cancer patients is obtained, and is shown in Table 3.

TABLE 3 clinical pathological information of prostate cancer patients in TCGA

Excluding cases without corresponding clinical data, correlation analysis of LncRNA HOXD-AS1 expression levels with prostate cancer clinicopathological features Using χ²The test, correlation with overall survival analysis using log-rank test, multifactorial analysis of survival impact using Cox regression analysis, all statistical analysis using SPSS 19.0 software, results are shown in fig. 2, table 4 and table 5.

AS shown in fig. 2, prostate cancer patients with higher expression levels of LncRNA HOXD-AS1 had relatively lower survival rates; as shown in tables 4 and 5, high expression was observed in all of the prostate cancer patients with high stage, high Gleason score and lymph node metastasis, high level expression of LncRNA HOXD-AS1 was an independent predictor of progression-free survival of prostate cancer, and detection of LncRNA HOXD-AS1 expression was used AS a marker for diagnosing the progression of prostate cancer.

TABLE 4

Analysis of relationship between HOXD-AS1 expression level and prostate cancer clinical pathological characteristics

P <0.05 was considered statistically different. Patients with a corresponding lack of clinical information are excluded from the corresponding correlation analysis.

TABLE 5

Single and multi-factor analysis of HOXD-AS1 expression level and prostate cancer survival prognosis

The Cox risk regression model, the univariate analysis and survival related variables are statistically different, and the multivariate analysis is further adopted. Significance of

The P values are shown in bold. HR > 1 indicates increased risk of death; HR < 1 indicates a reduced risk of death.

Example 3 silencing HOXD-AS1 inhibits the proliferation of prostate cancer cells.

Transfection of cellular siRNA

Small interfering RNA (siRNA) is synthesized by Shanghai Jima, and the oligonucleotide sequence is as follows:

si-HOXD-AS 1-1: 5'-GCCCUUUCUGACCUGCUUA-3', as shown in SEQ ID NO: 5; si-HOXD-AS 1-2: 5'-GAAAGAAGGACCAAAGUAA-3', as shown in SEQ ID NO: 6. by using

The RNAIMAX Reagent transfects siRNA into prostate cancer cell strains PC-3, LNCaP-Bic and LNCaP-AI cells, and the final concentration of siRNA transfection is 75 nM. The method comprises the following specific steps:

1) plate paving: 24h before transfection, cells were digested, centrifuged, resuspended, and counted. Inoculating cells into a 6-hole plate, wherein each hole contains 1.5ml of complete culture medium, so that the confluence degree of the cells before transfection reaches 50-60%;

2) transfection: adding 150pmol of siRNA into 125 μ l of Opti-MEM I culture medium, and shaking and mixing uniformly;

3) sucking 5 ul Lipofectamine RNAimax Reagent and adding into another 125 ul Opti-MEM culture medium for mixing;

4) shaking and mixing the two tubes of liquid uniformly, and standing at room temperature for about 15 min;

5) changing the culture medium of a 6-well plate into 1ml of complete culture medium, adding the 250 mu l of mixture into the 6-well plate, adding the mixture into the 6-well plate, wherein the total amount of liquid is 1250 mu l, and the concentration of siRNA is 75nM, and gently shaking up after adding;

6) standing at 37 deg.C and 5% CO₂The incubator is used for changing the culture solution for 1 time in the next day; continuously incubating for 24-72 h and then carrying out subsequent experiments; the inhibition efficiency of HOXD-AS1 was measured by real-time fluorescent quantitative PCR, and the results are shown in FIG. 3A.

MTT assay

Transfected or treated cells were trypsinized, centrifuged, resuspended, and counted. LNCaP and its castration resistant cell line 4X 10 per well³2X 10 per hole PC-3³Cells, 100. mu.l of medium, were plated in 96-well plates, 3-5 replicates per group, and 1 additional medium-only blank control well was set. Adding 20 mu l of MTS reagent, and continuously culturing for 2-4 h in a dark place. The OD of each well was measured by a microplate reader (490nm wavelength). Measurements were made every 24h for a total of 6 d. Cell proliferation curves were plotted against OD values and the results are shown in FIGS. 3B and 3C.

Clone formation experiments

The transfection, digestion, centrifugation, heavy suspension and counting of the prostate cancer cell strain LNCaP and PC-3 cells are the same as the above. Preparing single cell suspension, inoculating 250 or 500 cells per well in a 96-well plate, culturing in complete culture medium of 200 μ l per well, and culturing in an incubator for 7-10 days. After 7-10 days, the culture medium is carefully sucked off, paraformaldehyde is fixed for 30min, then 0.1% crystal violet solution (dissolved in pure water) is used for dyeing for 30min, and the solution is washed clean by pure water and dried. Pictures were taken under a 40 x light microscope for counting and statistics, and the results are shown in figure 3D.

AS shown in fig. 3A, 3B, 3C, and 3D, silencing lncrnhaoxd-AS 1 expression in prostate cancer cells by siRNA inhibited prostate cancer cell proliferation.

Example 4 silencing LncRNA HOXD-AS1 increases sensitivity and efficacy of prostate cancer cells to the castration therapy drug bicalutamide and the chemotherapeutic drug paclitaxel

Sensitivity test of castration drug bicalutamide and chemotherapy drug paclitaxel

Transfected or treated cells were trypsinized, centrifuged, resuspended, and counted. LNCaP and its castration resistant cell strain 1X 10 per well⁴PC-3 5X 10 per well³And inoculating 100 mul of culture medium to a 96-well plate, wherein each group comprises 3-5 multiple wells, and 1 blank control well only containing the culture medium is additionally arranged. One group was treated with 0, 10, 20, 40, 60 and 100 μ M bicalutamide (Sigma, St. Louis, MI, USA) for 120h, and the other group was treated with 0, 5, 10, 20, 50 and 100nM paclitaxel (Selleck, Houston, TX, USA) for 18h, 20 μ l of MTS reagent was added, and the culture was continued for 2-4 h in the absence of light. The OD of each well was measured by a microplate reader (490nm wavelength). The cell drug inhibition curves were plotted against cell viability and the results are shown in FIGS. 4-5.

AS shown in fig. 4 and 5, silencing LncRNA HOXD-AS1 expression in prostate cancer cells by siRNA increased the sensitivity and efficacy of prostate cancer cells to the castration treatment drug BicalutaMide (BicalutaMide) and the chemotherapeutic drug Paclitaxel (PTX).

Detection of apoptosis by flow cytometry

1d before adding chemotherapeutic drugs, the ratio is 3-4 x 10⁵Per well post-transfection cells were seeded in 6-well plates. Paclitaxel (Paclitaxel) was added to a final concentration of 5nM, while the blank control group was not dosed. After 48h, the supernatant and adherent cells were collected and washed 2 times with PBS. Add 100. mu.l Binding Buffer to resuspend the cells. Add 5. mu.l Annexin V and 5. mu.l PI for double staining, mix well, incubate 20min at room temperature in the dark. Flow cytometer FACSCaliber BD flow cytometer with Ex/Em of 488/530nm, the results are shown in fig. 6.

As shown in FIG. 6, silencing LncRNA HOXD-AS1 expression in prostate cancer cells by siRNA increased the number of apoptosis induced by paclitaxel.

Example 5 silencing LncRNA HOXD-AS1 increases sensitivity and efficacy of prostate cancer cells to paclitaxel chemotherapy in vivo

Animal experiment to obtain animal ethics of Zhongshan universityCommittee approval was performed in the central barrier environment of laboratory animals in the southern school district of the university of zhongshan. PC-3si-Ctrl and PC-3si-HOXD-AS1 cells were digested and washed 2 times with PBS and counted, 3.5X 10 cells per mouse⁶One cell was injected subcutaneously and 10 mice were injected for each of the two groups of cells. Cells were mixed well with an equal volume of matrigel before injection and then subcutaneously inoculated into the left back of nude mice. Tumor nodules can be accessed subcutaneously approximately one week later, at which time tumor length, width and height are measured beginning every other day, and injections of si-Ctrl and si-HOXD-AS1 are randomly divided into 2 groups, a control group receiving PBS and an experimental group receiving paclitaxel chemotherapy. The experimental group was administered paclitaxel intraperitoneal perfusion chemotherapy at 5mg/kg body weight on days 9, 12, 15, 21, 24, and 27, and the control group was perfused with PBS of the same amount. And (5) taking out subcutaneous tumors after the nude mice are sacrificed by 30d by cervical dislocation, and taking pictures, weighing and recording.

The experimental results show that paclitaxel can increase tumor growth inhibition of mouse load after silencing LncRNA HOXD-AS1 expression in prostate cancer cells by siRNA.

Finally, it should be noted that the above embodiments are intended to illustrate the technical solutions of the present invention and not to limit the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. Use of a specific probe for detecting LncRNA HOXD-AS1 and/or a specific primer for LncRNA HOXD-AS1 in the preparation of a kit for diagnosing prostate cancer or a clinical stage of prostate cancer, wherein the DNA sequence of the probe is shown AS SEQ ID NO. 2, and the primer is a primer pair consisting of the DNA sequences shown AS SEQ ID NO. 3 and SEQ ID NO. 4; the LncRNA HOXD-AS1 gene sequence is shown AS the gene with the ID of 401022.

2. The application of siRNA for inhibiting LncRNA HOXD-AS1 gene expression in preparing a pharmaceutical preparation for treating prostate cancer, wherein the siRNA is selected from siRNA1 or siRNA2, the sequence of the siRNA1 is shown AS SEQ ID NO. 5, and the sequence of the siRNA2 is shown AS SEQ ID NO. 6; the LncRNA HOXD-AS1 gene sequence is shown AS the gene with the ID of 401022.