CN107217025A - A kind of bacillus subtilis JG 1 for producing endo-inulinase and its preparation method and application - Google Patents
A kind of bacillus subtilis JG 1 for producing endo-inulinase and its preparation method and application Download PDFInfo
- Publication number
- CN107217025A CN107217025A CN201710431985.7A CN201710431985A CN107217025A CN 107217025 A CN107217025 A CN 107217025A CN 201710431985 A CN201710431985 A CN 201710431985A CN 107217025 A CN107217025 A CN 107217025A
- Authority
- CN
- China
- Prior art keywords
- inulinase
- endo
- bacillus subtilis
- plasmid
- pma05
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01007—Inulinase (3.2.1.7)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a kind of bacillus subtilis JG 1 for producing endo-inulinase, the bacillus subtilis JG 1 is using pMA05 large intestine withered grass shuttle plasmids as framework construction plasmid pMA05inu, then it is transformed into by chemical transformationBacillsu subtilisIn 168, the positive transformant filtered out by kalamycin resistance selection markers of the plasmid in bacillus subtilis.The invention also discloses the bacillus subtilis JG 1 of production endo-inulinase preparation method and application.Bacillus subtilis is generally acknowledged food security microorganism, is not in the potential safety hazard that Escherichia coli produce FOS；The DP3 of higher purity, DP4, the FOS of the DP5 degree of polymerization can be obtained；Bacillus subtilis has higher advantage than Other Engineering bacterium in terms of endo-inulinase is produced.The enzyme activity highest enzyme activity of endo-inulinase is 20.16U/ml.
Description
Technical field
The present invention relates to genetic engineering and fermentation engineering field, and in particular to a kind of withered grass bud of production endo-inulinase
Spore bacillus JG-1 and its preparation method and application.
Background technology
FOS (Fructooligosaccharide) is also known as FOS or FOS, is that a class is double
Discrimination bacillus proliferation factor, with low-heat, stably, the characteristic such as safety non-toxic.It is a kind of non-digestible oligosaccharide, it is impossible to by animal
The digestion enzyme hydrolysis of secretion itself, reaches and is optionally utilized after enteron aisle by Bifidobacterium, Bacillus acidi lactici, produce and animal is given birth to
Long beneficial organic acid and required vitamin etc.；Intestinal pH is reduced, suppresses harmful bacteria (such as Escherichia coli, clostridium and corruption
Bacterium etc.) propagation, reduce the generation of corruptibility metabolite in enteron aisle, so as to improve animal body immunity, improve healthy shape
Condition, reaches raising utilization of nutrients, strengthens the purpose of breeding performonce fo animals.It is that generally acknowledged prebiotics is represented, thus by
To extensive concern.It is poly- that the family of glycoside hydrolase the 32nd includes endoinulase, exoinulinase, invertase and inscribe β -2,6- fruits
Carbohydrase etc., compound of the major catalytic hydrolysis containing β -2,6 fructose glycosidic bond, β -2,1 fructose glycosidic bond or β-D fructose glycosidic bonds, in theory
There is certain meaning in terms of research, have in feed, food, bio-fuel, washing, sugaring and medicine and other fields and potentially should
Use prospect.Therefore, using inulin as substrate, in the presence of endo-inulinase, also received much concern with microbial method production FOS.
At present, Fructooligosaccharides manufacture enzyme-producing bacteria strain uses aspergillus niger, by the bacterium in 28 DEG C of trainings containing 5~10% sucrose
Shaken cultivation 4 days in base are supported, thalline of the production with fructose transfer activity, these thalline can directly be used, can also consolidated enzyme
The fructose-transferring enzyme of every gram of matrix addition 2-5 unit in 55-60% sucrose solutions, 60 DEG C of reaction 24h, after reaction are used after fixedization
Sugar composition be：Glucose (36-35%), sucrose (10-12%), ketose (21-28%), Nystose (21-24%),
GF4 (3-6%).Fructooligosaccharides content is between 5 5-6 0%, (products obtained therefrom trade name is Mingzhi oligosaccharides G).In addition,
Monose and disaccharides are removed in sugared mixture can also being shifted from gained, the Fructooligosaccharides of high-purity are obtained.
The molecular biology research in the world on dextrase focuses primarily upon synanthrin excision enzyme at present, to synanthrin excision enzyme
Structure and catalyst mechanism understand it is more deep.And the research for synanthrin restriction endonuclease is relatively fewer, enzyme gene is mainly limited to
Clone and heterogenous expression.All gene containing alantin excision enzyme in most microorganism, but only a small number of microbial bodies
The interior gene containing restriction endonuclease, hitherto it is found that certain micro-organisms can produce synanthrin restriction endonuclease, such as Aspergillus ficuum,
Penicillium sp., Kluyveromy-ces marxianus, Bacillus smithii, pseudomonas sp.,
The strains such as Xanthomonas oryzae and Arthrobacter sp, the endo-inulinase of separate sources, its zymologic property
Differ.
The content of the invention
Goal of the invention：According to the deficiencies in the prior art, the technical problems to be solved by the invention, which there is provided, to be utilized
Inulin produces bacillus subtilis (Bacillsu subtilis) recombinant bacterial strain of FOS.
The technical problem of the invention also to be solved there is provided the preparation method of above-mentioned recombinant bacterial strain.
The technical problem of the invention also to be solved there is provided the application of above-mentioned recombinant bacterial strain.
The technical problem of the invention also to be solved there is provided a kind of preparation method of endo-inulinase.
Technical scheme：In order to solve the above problems, the technical scheme is that there is provided a kind of production endo-inulinase
Bacillus subtilis JG-1, the bacillus subtilis JG-1 is using pMA05 large intestines-withered grass shuttle plasmid as framework construction plasmid
PMA05-inu, is then transformed into Bacillsu subtilis168 by chemical transformation, is existed by plasmid pMA05-inu
The positive transformant that kalamycin resistance selection markers in bacillus subtilis are filtered out.
The recombinant bacterial strain Bacillsu subtilis JG-1 of expression endo-inulinase mycology feature is as follows：Withered grass bud
Born of the same parents bacillus, is one kind of Bacillus, 0.7~0.8 × 2~3 microns of individual cells, uniform coloring.Without pod membrane, Zhousheng whip
Hair, can be moved.Gram-positive bacteria, 0.6~0.9 × 1.0~1.5 microns of gemma, ellipse arrives column, positioned at thalline center or slightly
Partially, thalline does not expand after sporulation.Bacterium colony rough surface is opaque, dirty white or slightly yellow, is grown in liquid medium within
When, wrinkle mould is commonly formed, in the organic matter for being widely distributed in soil and corruption, is easily bred in withered grass leaching juice, therefore be named as withered grass
Bacillus.
The present invention endo-inulinase gene inu from Pseudomonas mucidolens (Pseudomonas mucidolens) it
Sequence can be found in NCBI, Gene Bank registration numbers be AF141320.1.Sequence is following (to correspond to sequence table SEQ
ID NO：3)：
ATGCACAACACAGAAGACACAGGTCTTATCGCATACTGGTCTTTCGACGAAGAAAGTGGTAAAACAGCT
GTTGACGTAATCGGAAAGATGAACGACAGCATCGACTACGTTTTCAACCACGCAAGATTCAAGGCAAGTAGCGATCC
ACAAAGAAGAAAGGGAATCAGCGGTAACGCATTGTTGTTCGACGGATACAGTACGTGGATCAAGAGAAGCGCAGATC
AAATCGGAAAGCCAGAAAACGCTTTGACACTGGAAGCATGGGTAGCACCAAGAAGTTACGAATGGGGAGATGAACAA
AGGCTTAGTGCAATCGTAAACCAACACGACAGGGAAAAGAAGGAGGGATTCATCCTGGGTATGTACAGACACGGAAC
TTGGTCTTTGCAACTTGGACTTGACCATGAGTGGATCGAAGTTTGGAGTGAGGATCATCCACTTCCTAAGAACGAGT
GGTCTTACGTGGTAGCTACTTACGACAAGAAGACAAGCATGCTGAAGCTTGCATGCCCATCTATGTTGAAGCTTTAC
CTGAACGGAGTAGAGGTGGCATCAAAGCAAACAACGGCACATTCAACGATCACGCCATCAAGACAAGACCTTCTGAT
CGGTAAAAACAACCAGGCAGTAGTACTCGCAGGAGTATTCTCACTTAACATGTTCAACGGCCTGATCGACGAGATCA
AGATTTACAACCGAGCCCTGTCATCAGACGAGATTGCTTCAAGCTTCCACAGATACCTGGTACCTTACGGAGGAAAA
ATACCGTCAATTCCGTATGACCACCTGAAACTCGACCGTTCACTGCTGGCTGATGATAGGCATCGACCACAATATCA
TGTATCACCACCTGCTCATTGGATGAACGAACCACATGCTCCAATTTATTTCAACGGCCAGTATCACCTCTTTTATC
AGCACAATCCGCAGGGACCTTATTGGCACCAAATTCATTGGGGGCATTGGGTGTCTGACGATTTGGTGCATTGGCGT
GATCTTCCTGTTGCTTTGTCTCCTGAAAAAAATGCCGTTGACCCTGACGGAGATTGGTCAGGATCTGCTACTTATGA
CGAACATGGACTGCCTGTTCTGTTTTTTACCGCTGGAGATGATTCAGCTAAACCTAATCAGCGAGTCGGTCTTGCCC
GTTCAACATTTGCCCAAGATGGAGATAATGACCTGGTTCATTGGGTTAAACATCCGACGCCTGTTGTGGTGCAACAA
CAGGGAGTTGGAAAATTTGGCGACTTTCGTGATCCTTTTGTCTGGAAAGATGGCGATACCTGGTATATGCTCGTCGG
TTCTGGAACGGATGGTGAAGGTGGTACAGCGTTAGCCTATACATCTAAAAATCTGACGGAGTGGGAGTATCGTGGTC
CTTTTTATATTTCGGATCATAAAAATTATCCGTATCTGGGGAAAGTCTGGGAGCTGCCGGTCCTGCTCCCGCTCGGT
AAAGATAAAAAAGGCCATGATAAACATGTCTTTCTCATTTCCCCGGTCGGGGCCGGTGCGGATGTTGAAGTTTTTTA
TTGGATTGGCACGTTTGATAAAGAGCAGTTTCGCTTTATTCCGGATCAGAATGAGCCGCAGCTCATTGATGTCGGCG
ATTCGCATTTTACGGGGCCGTCTGGCATGGTTGATCCGAATACTGGGCGTAAAATACTCTTTACAATAGCGCAGGGG
GAACGGACTCCGGCGTTAGATTATTCTGCGGGCTGGGCGCATAATGGGGGCTTACCGGTGAGCCTTTCGTTACGGGA
AGATGGGCGCTTGGGCGTGGAACCGATTGAAGAATTGAAATCGCTTCGCGGCAAAAAACTTGTCTCCTTTACAAAAA
AATCGGCGGAAGAAGCGAATGATTTACTTACAAATGTGAAAGGGGATATGTTAGAAATTATACTTGAACTTGAACCG
GGCACAGCCAAACAATTTGGCATAAAAGTCCGGCGCTCCCCTGGCGGCGAAGAGGAGACTTTATTATATTATAATAC
CGAAGCGTCCACATTGAATGTGAATCGGATGAAAACCACCTTGGATAATTTTGAACGGAGCAAAGGCATTCAGGGCG
GCAAATTGGAGTTAAATGGCGAAAATTTAAAATTACATATTTATTTAGATCGCTCCATGATTGAAGCCTATGCGAAT
GGGTTAAAAAGCTTAACCACCCGCGCCTATCCGAGCCGGCCGGATTCCTTAGGCTTACAGATTTGGGGGGATGGCAG
CGTCAGCGTCAAATCCATGGAAGTGTGGGAAATGAATAGCGCGTTTGGCCCGACGGTGTCGGCGTATATTCCGGAAC
AACATGCCGATGGCGTGCAGACAAAATAA
Bacillus subtilis JG-1 of the present invention also including above-mentioned production endo-inulinase preparation method, including with
Lower step：
1) acquisition of endo-inulinase encoding gene：The CDS sequences of endo-inulinase in selected Pseudomonas mucidolens, if
Primer is counted, the enzyme gene inu of endo-inulinase is transferred；The primer sequence such as SEQ ID NO:1 and SEQ ID NO:Shown in 2；
2) expression vector pMA05-inu structure：Using large intestine-withered grass shuttle plasmid pMA05 as plasmid backbone, limitation is utilized
Property restriction endonuclease NdeI and BamHI is double cuts plasmid pMA05, then using the method for one-step cloning by purpose fragment and double digestion plasmid
Connection, forms plasmid pMA05-inu；
3) structure of recombinant bacterial strain：By step 2) the correct plasmid pMA05-inu of checking is built by chemical transformation, turn
Change into bacillus subtilis, correct transformant as recombinant bacterial strain is filtered out by kalamycin resistance selection markers；
4) enzymatic production is verified：Using Shaking culture recombinant bacterial strain, the vigor of endo-inulinase is determined, high efficient expression is obtained
The bacillus subtilis JG-1 of recombinant bacterial strain.
Wherein, the screening concentration of above-mentioned kanamycins antibiotic is 25 μ g/ml.
Wherein, above-mentioned steps 4) cultivation temperature be 32 DEG C, 200rpm, fermentation time is 24h.
Wherein, above-mentioned culture is cultivated in 250ml shaking flasks, and 32 DEG C of culture 24h yield of enzyme reach maximum.
The present invention also bacillus subtilis JG-1 including above-mentioned production endo-inulinase is preparing endo-inulinase
With the application in FOS.
A kind of preparation method of endo-inulinase and FOS, comprises the following steps：, will be described withered under the conditions of 4 DEG C
Careless bacillus JG-1 fermented and cultureds obtain zymotic fluid, 9000rpm centrifugation somatic cells, outwell supernatant, then with PH for 7.4 phosphorus
Acid buffer washing thalline 2-3 times, finally with the buffering suspension cell of same volume, using Ultrasonic Cell Disruptor smudge cells, 4 DEG C
Under the conditions of, centrifugal breaking liquid 10min, the supernatant after being crushed is endo-inulinase.
The enzyme activity determination of endo-inulinase：The enzyme activity that reducing sugar method surveys endo-inulinase is surveyed with DNS, it is anti-due to occurring colour developing
Should, the enzyme activity of endo-inulinase is characterized by determining absorbance.
The application of recombinant bacterium Bacillsu subtilis JG-1 constructed by the present invention is to be based on food security microorganism
Production endo-inulinase is simultaneously catalyzed production FOS (FOS).
Beneficial effect：The present invention is relative to prior art, with advantages below：
1：Bacillus subtilis is generally acknowledged food security microorganism, is not in the safety that Escherichia coli produce FOS
Hidden danger；
2：DP3, DP4, the FOS of the DP5 degree of polymerization can be obtained；
3：Bacillus subtilis has higher advantage than Other Engineering bacterium in terms of endo-inulinase is produced.
4th, the enzyme activity highest enzyme activity of endo-inulinase is 20.16U/ml.
Brief description of the drawings
Fig. 1 recombinant plasmids pMA05-inu building process；
Fig. 2 recombinant plasmid pMA05-inu digestion verification figures；Swimming lane 1 is the DNA Maker that molecular weight is 7500, swimming in figure a
Road 2 is single endonuclease digestion figure；Swimming lane 3 is double digestion；It is Maker to scheme swimming lane 1 in b, and swimming lane 2 is verified for single endonuclease digestion, and swimming lane 3 is double digestion
Checking；
Fig. 3 recombinant bacterium Bacillsu subtilis JG-1 enzymatic production curve；Using enzymatic production culture medium, weight
Group bacterium Bacillsu subtilis JG-1 are in 32 DEG C of fermentations, every μ l, 12000rpm the centrifugation 1min of 4h samplings 200, with 200 μ l
0.02mM, PH is 7.4 PBS buffering suspension cells, and is carried out after ultrasonication, after centrifugation, 200 μ l enzyme liquids and 800 μ l
2% inulin 30min inactivations, take 25 μ l plus 50 μ lDNS, are adding 550 μ lRO water, are surveying absorbance at 540nm with ELIASA, enter
And specific enzyme activity U/ml is calculated, 1U is defined as the enzyme amount required for reaction 1 μm of ol/min reduced sugar of generation.Abscissa is the time (h),
Fermentation time, every 4h samplings, right side ordinate is specific enzyme activity (U/ml), and specific enzyme activity is higher, illustrates its full clasmatosis of 200 μ l
Producing enzyme is higher in liquid；Left side ordinate is cell concentration, and unit is cell/ml.
Fig. 4 trisaccharides, tetrose, the mark product liquid phase figure of pentasaccharides；Three peaks are that the degree of polymerization is DP5, DP4, DP3 successively in Fig. 4；
The liquid phase of the conversion fluid of the endo-inulinase catalysis jerusalem artichoke inulin generation FOS of Fig. 5 bacillus subtilises expression
Figure；The degree of polymerization of FOS is detected using high performance liquid chromatography, endo-inulinase is catalyzed the conversion fluid after inulin, taken
24h conversion fluids, dilution, walk liquid-phase chromatographic column, calcium post, abscissa represents appearance time t (min), and ordinate represents peak height (μ
RIU), peak area represents the content of different polymerization degree FOS；According to property of liquid phase, the high first appearance of the degree of polymerization, 3 in figure,
4,5 peaks represent the FOS that the degree of polymerization is 5,4,3 respectively；
Fig. 6 enzyme activity standard curves；Abscissa represents fructose concentration, and unit is g/L, and ordinate represents absorbance, and unit is
L/(g.cm)。
Embodiment
The present invention is further described below in conjunction with the accompanying drawings.
Reagent used in the embodiment of the present invention
| Inulin | TIANGEN Biotech (Beijing) Co., Ltd. |
| One-step cloning enzyme | Nanjing love must the biological Co., Ltd of dream |
| NdeI,BamHI | The precious biological Co., Ltd in TaKaRa Dalian |
| Maker DL15000 | The precious biological Co., Ltd in TaKaRa Dalian |
| K2HPO4 | Shanghai Ling Feng chemical reagent Co., Ltd |
| KH2PO4 | Shanghai Ling Feng chemical reagent Co., Ltd |
| DNS | Moisten into biological Co., Ltd in Shanghai |
The construction of recombinant plasmid vector pMA05-inu of embodiment 1
By gene excavating technology, it is to come from the endo-inulinase in Pseudomonas mucidolens to determine target gene, design
One-step cloning primer, sense primer：AaaaggagcgatttacatatgATGCACAACACAGAAGACACAGG anti-sense primers：
gagctcgactctagaggatccTTATTTTGTCTGCACGCCATCG；Target gene PCR is transferred, restriction enzyme is used
NdeI and BamHI is double cut plasmid vector pMA05, recovery purifying after calculate concentration, linked system is determined, according to the original of homologous recombination
Reason, is connected, the reaction solution connected is transformed into DH5 α with heat-shock transformed method on ice using 30 DEG C of the method for one-step cloning, is applied
Cloth is on the solid LB flat boards containing 100 μ g/ml ammonia benzyl antibiotic, 37 DEG C of incubated overnight 12h, and screening transformant is (from south
The plasmid pMA05 that capital polytechnical university Xu Hong professors seminar give is a large intestine-withered grass shuttle plasmid, and ammonia is shown in DH5 α
The resistance of benzyl), choose 4-6 bacterium and be transferred in the small black bottle containing 100 μ g/ml ammonia benzyl antibiotic, 37 DEG C of shaking table 200RPM cultures
8h, preserves remaining cell liquid after strain and cell is collected by centrifugation, and with plasmid kit extracting plasmid is carried, the plasmid after extracting is used
NdeI and BamHI double digestions (the μ l10*K buffer+0.5 μ l NdeI+0.5 μ l BamHI+3 μ l of 10 μ l=5 μ l plasmids+1
ddH2O) verified with PCR, after double digestion 1h, verify that double digestion is correct by nucleic acid electrophoresis, electrophoretogram such as accompanying drawing 2a, PCR checking
Purposeful band 2331bp, the plasmid built is named as pMA05-inu.The system of single endonuclease digestion is the (μ of 10 μ l=5 μ l plasmids+1
l10*K buffer+1μl BamHI+3μl ddH2O)
Embodiment 2：Recombinant vector conversion bacillus subtilis (Bacillsu subtilis)
What it is due to withered grass expression plasmid method for transformation is all chemical transformation, and the transformation efficiency of bacillus subtilis is high by one
A bit, bacillus subtilis bacterium competence is made first, 200 μ l/ pipes are finally distributed into, and will verify that correct plasmid takes 5 μ l directly to add
Enter into 200 μ l bacillus subtilis bacterium competences, 37 DEG C, 200rpm shakes bacterium 90min, finally applies flat board, kanamycins antibiotic
Concentration be 20 μ g/ml, 37 DEG C of incubated overnights choose transformant, and be inoculated into received containing card antibiotic fluid nutrient medium in, 37
DEG C, 200rpm shakes bacterium 12h, subsequently carries out digestion verification, electrophoretogram such as accompanying drawing 2b according to step in embodiment 1：Swimming lane 1 is
Maker, swimming lane 2 verifies that swimming lane 3 is verified for double digestion for single endonuclease digestion.
Embodiment 3：JG-1 enzymatic productions optimize
Obtained positive clone molecule Bacillsu subtilis JG-1 will be screened, be inoculated into 500ml producing enzyme fermented and cultureds
Fermentation production endo-inulinase in base, initial highest specific enzyme activity is about 1.2U/ml.Endo-inulinase is produced to B.subtilis JG-1
Condition is optimized, and JG-1 is inoculated into 500ml shaking flasks, is fermented under conditions of 32 DEG C, every 4h samplings, takes 200 μ l to send out
Zymotic fluid and 800 μ l 2% inulin reaction 30min, survey endo-inulinase enzyme activity, with the progress of fermentation, recombinant bacterium JG-1's
Cell concentration (OD600nm) reaches maximum, is 2.5, under the conditions of 4 DEG C, centrifugation, and 9000rpm centrifuges 10min, obtains thalline
Cell, with 200 μ l 0.02mM phosphate buffer PBS (PH is 7.4) washing thalline twice, finally with same volume (200 μ
L) thalline is resuspended in PBS, using Ultrasonic Cell Disruptor smudge cells, 4 DEG C, centrifuges 10min, obtains the supernatant containing endo-inulinase
Liquid, with the progress of fermentation, recombinant bacterium Bacillsu subtilis JG-1 specific enzyme activity is most when fermentation is to 24h, after optimization
A height of 20.16U/ml.Experimental result is referring to Fig. 3.Finally determination Bacillsu subtilis JG-1 enzyme ferment condition is：
1% inoculum concentration, fermentation temperature is 32 DEG C, and 200rpm, fermentation time is 24h.
Embodiment 4：The detection of the enzyme activity of endo-inulinase
By the reaction solution after the supernatant of 200 μ l endo-inulinases and 800 μ l2% inulin reaction 30min, 100 are placed on
10min inactivations are boiled in DEG C boiling water, 12000rpm centrifugation 1min take 25 μ l to react supernatant with being boiled in 50 μ l DNS boiling water
10min, occurs chromogenic reaction, then adds the dilution of 550 μ l RO water (excellent general pure water meter), with ELIASA, the light absorption value surveyed under 540nm,
Enzyme activity is calculated according to mark song, enzyme activity is defined as 1U equal to the enzyme amount needed for 1min 1 μm of ol reduced sugar of generation.Inulin inscribe after optimization
The specific enzyme activity of enzyme highest is 20.16U/ml.Standard curve such as Fig. 6.
Embodiment 5：Endo-inulinase catalysis hydrolysis of inulin production FOS
Clasmatosis liquid supernatant 2ml is taken to be added in the 8ml 100g/l inulin solution prepared with PBS, 55 DEG C,
Reacted in 200RPM, shaking bath, 200 μ l are sampled every 4h, after 10 times of dilution, sample crosses 0.22 μm of filter membrane processing, utilizes Ca
Post, walks high performance liquid chromatography, and condition is：Two Ca posts series connection, column temperature is 80 DEG C, and mobile phase is pure water, and flow velocity is 0.4ml/
Min, detector is Composition distribution RI.Liquid phase is walked after the sample treatment for taking catalysis 20h, product predominantly DP3, DP4 is determined,
The FOS of the DP5 degree of polymerization.As a result such as Fig. 5.
Described above is only the preferred embodiment of the present invention, it should be pointed out that：For the ordinary skill people of the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>Yancheng Institute Of Technology
<120>A kind of bacillus subtilis NG-1 for producing endo-inulinase and its preparation method and application
<130> SG20170524001
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 44
<212> DNA
<213>Sense primer
<400> 1
aaaaggagcg atttacatat gatgcacaac acagaagaca cagg 44
<210> 2
<211> 43
<212> DNA
<213>Anti-sense primer
<400> 2
gagctcgact ctagaggatc cttattttgt ctgcacgcca tcg 43
<210> 3
<211> 2331
<212> DNA
<213>In Pseudomonas mucidolens
<400> 3
atgcacaaca cagaagacac aggtcttatc gcatactggt ctttcgacga agaaagtggt 60
aaaacagctg ttgacgtaat cggaaagatg aacgacagca tcgactacgt tttcaaccac 120
gcaagattca aggcaagtag cgatccacaa agaagaaagg gaatcagcgg taacgcattg 180
ttgttcgacg gatacagtac gtggatcaag agaagcgcag atcaaatcgg aaagccagaa 240
aacgctttga cactggaagc atgggtagca ccaagaagtt acgaatgggg agatgaacaa 300
aggcttagtg caatcgtaaa ccaacacgac agggaaaaga aggagggatt catcctgggt 360
atgtacagac acggaacttg gtctttgcaa cttggacttg accatgagtg gatcgaagtt 420
tggagtgagg atcatccact tcctaagaac gagtggtctt acgtggtagc tacttacgac 480
aagaagacaa gcatgctgaa gcttgcatgc ccatctatgt tgaagcttta cctgaacgga 540
gtagaggtgg catcaaagca aacaacggca cattcaacga tcacgccatc aagacaagac 600
cttctgatcg gtaaaaacaa ccaggcagta gtactcgcag gagtattctc acttaacatg 660
ttcaacggcc tgatcgacga gatcaagatt tacaaccgag ccctgtcatc agacgagatt 720
gcttcaagct tccacagata cctggtacct tacggaggaa aaataccgtc aattccgtat 780
gaccacctga aactcgaccg ttcactgctg gctgatgata ggcatcgacc acaatatcat 840
gtatcaccac ctgctcattg gatgaacgaa ccacatgctc caatttattt caacggccag 900
tatcacctct tttatcagca caatccgcag ggaccttatt ggcaccaaat tcattggggg 960
cattgggtgt ctgacgattt ggtgcattgg cgtgatcttc ctgttgcttt gtctcctgaa 1020
aaaaatgccg ttgaccctga cggagattgg tcaggatctg ctacttatga cgaacatgga 1080
ctgcctgttc tgttttttac cgctggagat gattcagcta aacctaatca gcgagtcggt 1140
cttgcccgtt caacatttgc ccaagatgga gataatgacc tggttcattg ggttaaacat 1200
ccgacgcctg ttgtggtgca acaacaggga gttggaaaat ttggcgactt tcgtgatcct 1260
tttgtctgga aagatggcga tacctggtat atgctcgtcg gttctggaac ggatggtgaa 1320
ggtggtacag cgttagccta tacatctaaa aatctgacgg agtgggagta tcgtggtcct 1380
ttttatattt cggatcataa aaattatccg tatctgggga aagtctggga gctgccggtc 1440
ctgctcccgc tcggtaaaga taaaaaaggc catgataaac atgtctttct catttccccg 1500
gtcggggccg gtgcggatgt tgaagttttt tattggattg gcacgtttga taaagagcag 1560
tttcgcttta ttccggatca gaatgagccg cagctcattg atgtcggcga ttcgcatttt 1620
acggggccgt ctggcatggt tgatccgaat actgggcgta aaatactctt tacaatagcg 1680
cagggggaac ggactccggc gttagattat tctgcgggct gggcgcataa tgggggctta 1740
ccggtgagcc tttcgttacg ggaagatggg cgcttgggcg tggaaccgat tgaagaattg 1800
aaatcgcttc gcggcaaaaa acttgtctcc tttacaaaaa aatcggcgga agaagcgaat 1860
gatttactta caaatgtgaa aggggatatg ttagaaatta tacttgaact tgaaccgggc 1920
acagccaaac aatttggcat aaaagtccgg cgctcccctg gcggcgaaga ggagacttta 1980
ttatattata ataccgaagc gtccacattg aatgtgaatc ggatgaaaac caccttggat 2040
aattttgaac ggagcaaagg cattcagggc ggcaaattgg agttaaatgg cgaaaattta 2100
aaattacata tttatttaga tcgctccatg attgaagcct atgcgaatgg gttaaaaagc 2160
ttaaccaccc gcgcctatcc gagccggccg gattccttag gcttacagat ttggggggat 2220
ggcagcgtca gcgtcaaatc catggaagtg tgggaaatga atagcgcgtt tggcccgacg 2280
gtgtcggcgt atattccgga acaacatgcc gatggcgtgc agacaaaata a 2331
Claims (6)
1. a kind of bacillus subtilis JG-1 for producing endo-inulinase, it is characterised in that the bacillus subtilis JG-1 is with pMA05
Large intestine-withered grass shuttle plasmid is framework construction plasmid pMA05-inu, then it is transformed into by chemical transformationBacillsu subtilisIn 168, pass through plasmid pMA05-inuWhat the kalamycin resistance selection markers in bacillus subtilis were filtered out
Positive transformant is the bacillus subtilis JG-1 for producing endo-inulinase.
2. the bacillus subtilis JG-1 of the production endo-inulinase described in claim 1 preparation method, it is characterised in that including
Following steps：
The acquisition of endo-inulinase encoding gene：The CDS sequences of endo-inulinase in selected Pseudomonas mucidolens, design is drawn
Thing, transfers the enzyme gene of endo-inulinaseinu；The primer sequence such as SEQ ID NO:1 and SEQ ID NO:Shown in 2；
Expression vector pMA05-inuStructure：Using large intestine-withered grass shuttle plasmid pMA05 as plasmid backbone, restriction enzyme is utilized
Enzyme NdeI and BamHI are double to cut plasmid pMA05, is then connected purpose fragment and double digestion plasmid using the method for one-step cloning,
Form plasmid pMA05-inu；
The structure of recombinant bacterial strain：By step 2）Build the correct plasmid pMA05- of checkinginuBy chemical transformation, it is transformed into withered
In careless bacillus, correct transformant as recombinant bacterial strain is filtered out by kalamycin resistance selection markers；
Enzymatic production is verified：Using Shaking culture recombinant bacterial strain, the vigor of endo-inulinase is determined, high efficient expression recombinant bacterium is obtained
The bacillus subtilis JG-1 of strain.
3. the bacillus subtilis JG-1 of production endo-inulinase according to claim 2 preparation method, it is characterised in that
The screening concentration of the kanamycins antibiotic is 25mg/ml.
4. the bacillus subtilis JG-1 of production endo-inulinase according to claim 2 preparation method, it is characterised in that
The step 4）Cultivation temperature be 32 DEG C, 200 rpm, fermentation time be 24 h.
5. applications of the bacillus subtilis JG-1 of the production endo-inulinase described in claim 1 in endo-inulinase is prepared.
6. a kind of preparation method of endo-inulinase, it is characterised in that comprise the following steps：Under the conditions of 4 DEG C, by claim 1
Described bacillus subtilis JG-1 fermented and cultureds obtain zymotic fluid, and 9000 rpm centrifugation somatic cells outwell supernatant, then use PH
It is broken using Ultrasonic Cell Disruptor finally with the buffering suspension cell of same volume for 7.4 phosphate buffer washing thalline 2-3 times
Broken cell, under the conditions of 4 DEG C, the min of centrifugal breaking liquid 10, the supernatant after being crushed is endo-inulinase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710431985.7A CN107217025A (en) | 2017-06-09 | 2017-06-09 | A kind of bacillus subtilis JG 1 for producing endo-inulinase and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710431985.7A CN107217025A (en) | 2017-06-09 | 2017-06-09 | A kind of bacillus subtilis JG 1 for producing endo-inulinase and its preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107217025A true CN107217025A (en) | 2017-09-29 |
Family
ID=59947995
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710431985.7A Pending CN107217025A (en) | 2017-06-09 | 2017-06-09 | A kind of bacillus subtilis JG 1 for producing endo-inulinase and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107217025A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108467847A (en) * | 2018-01-18 | 2018-08-31 | 盐城工学院 | Can exocytosis endo-inulinase recombined bacillus subtilis and its preparation method and application |
| CN109055413A (en) * | 2018-07-30 | 2018-12-21 | 江苏医药职业学院 | A kind of shuttle vector and its construction method and application |
| CN110066777A (en) * | 2019-04-30 | 2019-07-30 | 江南大学 | A kind of endoinulase and its application in production oligofructose |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1252438A (en) * | 1998-10-26 | 2000-05-10 | 中国农业科学院饲料研究所 | Inulinase generating saccharomycetes strain and its application in producing high fructure syrup |
| CN1594542A (en) * | 2003-08-19 | 2005-03-16 | 中国农业科学院饲料研究所 | Aspergillus niger inulin endopeptidase gene and recombinant Pichia strain for expressing same |
| CN103243117A (en) * | 2013-05-24 | 2013-08-14 | 江南大学 | Method for cloning and expressing Serratia marcescens lipase by utilizing recombinant Bacillus subtilis |
| CN103952326A (en) * | 2014-05-21 | 2014-07-30 | 山东大学 | Recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme as well as construction method and application of bacterial strain |
| CN105505899A (en) * | 2016-01-12 | 2016-04-20 | 南京工业大学 | Preparation method and application of endo-inulinase |
-
2017
- 2017-06-09 CN CN201710431985.7A patent/CN107217025A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1252438A (en) * | 1998-10-26 | 2000-05-10 | 中国农业科学院饲料研究所 | Inulinase generating saccharomycetes strain and its application in producing high fructure syrup |
| CN1594542A (en) * | 2003-08-19 | 2005-03-16 | 中国农业科学院饲料研究所 | Aspergillus niger inulin endopeptidase gene and recombinant Pichia strain for expressing same |
| CN103243117A (en) * | 2013-05-24 | 2013-08-14 | 江南大学 | Method for cloning and expressing Serratia marcescens lipase by utilizing recombinant Bacillus subtilis |
| CN103952326A (en) * | 2014-05-21 | 2014-07-30 | 山东大学 | Recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme as well as construction method and application of bacterial strain |
| CN105505899A (en) * | 2016-01-12 | 2016-04-20 | 南京工业大学 | Preparation method and application of endo-inulinase |
Non-Patent Citations (4)
| Title |
|---|
| GENBANK: "AF141320.1", 《GENBANK》 * |
| KIM ET AL.: "Inulooligosaccharide production from inulin by Saccharomyces cerevisiae strain displaying cell-surface endoinulinase", 《J. MICROBIOL. BIOTECHNOL.》 * |
| RUIFAN JIANG ET AL.: "One-Step Bioprocess of Inulin to Product Inulo-Oligosaccharides Using Bacillus subtilis Secreting an Extracellular Endo-Inulinase", 《APPL BIOCHEM BIOTECHNOL》 * |
| YANBING XU ET AL.: "Efficient Conversion of Inulin to Inulooligosaccharides through Endoinulinase from Aspergillus niger", 《J. AGRIC. FOOD CHEM.》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108467847A (en) * | 2018-01-18 | 2018-08-31 | 盐城工学院 | Can exocytosis endo-inulinase recombined bacillus subtilis and its preparation method and application |
| CN108467847B (en) * | 2018-01-18 | 2021-11-19 | 盐城工学院 | Recombinant bacillus subtilis capable of extracellularly secreting inulinase and preparation method and application thereof |
| CN109055413A (en) * | 2018-07-30 | 2018-12-21 | 江苏医药职业学院 | A kind of shuttle vector and its construction method and application |
| CN109055413B (en) * | 2018-07-30 | 2021-07-02 | 江苏医药职业学院 | Shuttle plasmid vector and construction method and application thereof |
| CN110066777A (en) * | 2019-04-30 | 2019-07-30 | 江南大学 | A kind of endoinulase and its application in production oligofructose |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104894047B (en) | The construction method of the recombined bacillus subtilis of the epimerase of expression D psicoses 3 based on D alanine deficiency selection markers | |
| CN108929878A (en) | The encoding gene of algin catenase and its application | |
| CN103757074B (en) | A kind of enzyme process prepares the method for rebaudioside M | |
| CN101492661B (en) | Clone, expression of beta-glucosidase gene, and preparation for gentian oligose | |
| CN103397064A (en) | Method for preparing rebaudioside M through enzyme method | |
| CN104312996B (en) | Alpha-L-rhamnosidase Rha1 as well as expressed gene and application of alpha-L-rhamnosidase Rha1 | |
| CN102994439A (en) | Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof | |
| CN107217025A (en) | A kind of bacillus subtilis JG 1 for producing endo-inulinase and its preparation method and application | |
| CN107254429A (en) | A kind of bacillus subtilis of high yield restructuring nitrilase and its application process | |
| CN103865863B (en) | One strain leukonid mutant strain and construction process and methods for using them thereof | |
| CN106479945A (en) | A kind of recombined bacillus subtilis efficiently synthesizing acetylglucosamine | |
| CN105368767A (en) | Recombinant bacillus subtilis for expressing cellobiose-2-epimerase based on D-alanine defective screening, and construction method of recombinant bacillus subtilis | |
| CN107574173A (en) | A kind of recombinant plasmid and its method for building High-productive Monascus Pigment Strain | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN105039374B (en) | A kind of starch induction type recombined bacillus subtilis and preparation method and application | |
| CN112852796A (en) | Cellobiose epimerase mutant and application thereof in preparation of lactulose | |
| CN103205391A (en) | Gene engineering strain and application thereof | |
| CN103952326B (en) | The recombinant pichia yeast strain of a kind of coexpression alantin excision enzyme and restriction endonuclease and construction method and application | |
| CN104109658B (en) | A kind of creatine hydrolytic enzyme and encoding gene thereof and application | |
| CN108018245A (en) | One plant of bacillus subtilis for producing chitosan enzyme and its application | |
| CN101906430A (en) | Sucrose isomerase gene and high-efficiency expression method thereof | |
| CN105039191B (en) | A kind of surface display trehalose synthetase, the method for hydrolysis of trehalose enzyme and application | |
| CN102690795B (en) | Trehalose synthase of streptomyces griseochromogenes and coding gene and application of trehalose synthase | |
| CN105177084B (en) | A kind of method of inulin enzyme mutant fermenting and producing oligofructose | |
| CN104962508A (en) | Toxalbumin MazF reverse screening-based method for building recombinant Bacillus subtilis for expression of D-psicose 3-epimerase Bacillus subtilis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170929 |