CN107213458A - The novel therapeutic vaccine and application method of a kind of use carrier combinations - Google Patents
The novel therapeutic vaccine and application method of a kind of use carrier combinations Download PDFInfo
- Publication number
- CN107213458A CN107213458A CN201710148286.1A CN201710148286A CN107213458A CN 107213458 A CN107213458 A CN 107213458A CN 201710148286 A CN201710148286 A CN 201710148286A CN 107213458 A CN107213458 A CN 107213458A
- Authority
- CN
- China
- Prior art keywords
- virus
- recombinant vector
- immune substance
- therapeutic vaccine
- target
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0091—Purification or manufacturing processes for gene therapy compositions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
- A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Epidemiology (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Manufacturing & Machinery (AREA)
- Biotechnology (AREA)
- Dermatology (AREA)
- Virology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention relates to a kind of novel therapeutic vaccine of use carrier combinations and application method, the therapeutic vaccine includes the first immune substance and the second immune substance, and the first immune substance is made up of recombinant vector bacterium, and the second immune substance is made up of recombinant vector virus；Recombinant vector bacterium be include in genome and express target viral or target tumor in main CD4+T cell antigen epitopes DNA sequence carrier bacteria, recombinant vector virus is to include in gene and express the vector virus with identical contained by the recombinant vector bacterium for the DNA sequence of main CD4+T cell antigen epitopes in target viral or target tumor；Use a kind of novel therapeutic vaccine of use carrier combinations of the present invention, the CD8+T cellullar immunologic responses in infected body or tumor mice can be strengthened, the depletion state of CD8+T cells is substantially improved, the effective effect for improving therapeutic vaccine control virus infection or control tumour.
Description
Technical field
The invention belongs to novel therapeutic vaccine and the user of vaccines arts, more particularly to a kind of use carrier combinations
Method.
Background technology
Chronic viral infection disease, such as AIDS, hepatitis B, hepatitis etc., it is still the significant threat that human health faces.The whole world is about
There are 34,000,000 people to carry AIDS virus (HIV), there are about 400,000,000 people's Hepatitis B carriers (HBV), 1.5 hundred million people infection hepatitis C virus
(HCV)(1).In China, only HBV carrier is just more than 90,000,000 people, and the people of chronic active hepatitis B about 30,000,000 is in the world
One, HIV infection rate and the incidence of disease are in rising trend.Therefore, chronic viral infection be China's publilc health face it is great
Challenge, causes increasingly serious society and financial burden (about consuming the 2% of China GDP every year).Vaccine inoculation is for virus
A kind of most effective, the most economical immunology means of infection.Estimated according to WHO, 1 dollar of vaccine inoculation input can save 5~10
The health care expense of dollar.
Existing frequently-used vaccine includes two kinds of preventative vaccine (document 1) and therapeutic vaccine, and preventative vaccine mainly leads to
Cross and act on the lymphocyte that not antigen exposed, produce immunological memory to prevent possible corresponding infection.However, chronic
Under the specifc immunity environment of virus infection, antigen exposes the specific lymphocyte of cause of disease, and by long-term chronic stimulation
Exhaust, lose most functions, it is impossible to set up immunological memory storehouse (document 2, document 3).It can be seen that the different decisions of infection property
Preventative vaccine is not suitable for being directly used in treatment chronic viral infection.
Found by research, for chronic viral infection, therapeutic vaccine is because of its reversible immunocyte exhausted
Function, directly kill comprising virus target cell infection, and may finally remove infection and as confrontation chronic viral infection it is new
Strategy and technology.And chronic viral infection goes back simultaneous inhibition and microenvironment is immunized in addition to viral antigen continues to exist
Formed.Therapeutic vaccine is immunized after the body of chronic viral infection, and microenvironment, which is immunized, in identical can also act on the effect newly produced
Answering property CD8+T cells, so as to cause the function of a new round to be exhausted, cause the effect of vaccine low.In this context, by therapeutic
Effect CD8+T cells that are vaccine-induced and newly being formed need to have the ability that exhaustion is resisted in the case where microenvironment is immunized in inhibition, so that
Enable therapeutic vaccine effectively lasting its antiviral efficacy of performance after immune.However, so far also without straight well
Connect and act on CD8+T cells and intervene the means of immunodepletion in itself, and studied prompting, in chronic viral infection environment
Lower overstimulation virus-specific CD8+T cells easily promote its apoptosis (document 4, document 5) on the contrary.
Currently, the research of domestic and international therapeutic vaccine still follows the research mode of preventative vaccine research mostly, uses
Different types of immunogene, such as recombinant protein, synthetic peptide, recombinant DNA or viral vector, antigen-antibody complex etc., compatibility is passed
System or novel adjuvant, viral duplication (document 6- documents are controlled to produce immune response caused by similar preventative vaccine
9).But such research and development not yet obtain critical breakthrough, high-efficient and lasting prepared by the new strategy of research and development and means is still needed badly
Chronic viral infection therapeutic vaccine.
Document 1：Plotkin, S.A.Complex Correlates of Protection After
Vaccination.Clinical infectious diseases：an official publication of the
Infectious Diseases Society of America(2013)；
Document 2：Wherry, E.J.T cell exhaustion.Nature immunology 12,492-499
(2011)；
Document 3：Wherry, E.J.et al.HIV-specific CD8 T cells express low levels of
IL-7Ralpha：Implications for HIV-specific T cell memory.Virology 353,366-373
(2006)；
Document 4：West, E.E.et al.Tight regulation of memory CD8 (+) T cells limits
Their effectiveness during sustained high viral load.Immunity 35,285-298
(2011)；
Document 5：Nolz, J.C.＆Harty, J.T.Protective capacity of memory CD8+T cells
is dictated by antigen exposure history and nature of the infection.Immunity
34,781-793 (2011)；
Document 6：Wang Xuan is happy, and Wen Yumei is therapeutic with clinic-laboratory-clinical module research antigen-antibody complex type
Hepatitis B vaccine infectious diseases information 23,193-196 (2010)；
Document 7：Lan, P., Zhang, C., Han, Q., Zhang, J.＆Tian, Z.Therapeutic recovery of
HBV-induced hepatocyte-intrinsic immune defect reverses systemic adaptive
immune tolerance.Hepatology(2013)；
Document 8：Cobleigh, M.A., Wei, X.＆Robek, M.D.A Vesicular Stomatitis Virus-
Based Therapeutic Vaccine Generates a Functional CD8 T Cell Response to
Hepatitis B Virus in Transgenic Mice.Journal of virology 87,2969-2973 (2013)；
Document 9：Chen Yonghong, the New research progress Journal of Immunologies 28,266-271 of old small beautiful hepatitis B vaccine
(2012)。
The content of the invention
In order to overcome the above-mentioned deficiency of prior art, the invention provides a kind of novel therapeutic epidemic disease of use carrier combinations
Seedling and application method.
A kind of novel therapeutic vaccine of use carrier combinations, including the first immune substance and the second immune substance, it is described
First immune substance is made up of recombinant vector bacterium, and second immune substance is made up of recombinant vector virus；The restructuring is carried
Body bacterium be include in genome and express target viral or target tumor in main CD4+T cell antigen epitopes deoxidation
The carrier bacteria of RNA sequence so that the first immune substance can specifically stimulation of host CD4+T cells, generation is directed to
The specific cellullar immunologic response of target viral or target tumor；Recombinant vector virus is to include and express in gene
With identical contained by the recombinant vector bacterium for main CD4+T cell antigen epitopes in target viral or target tumor
DNA sequence vector virus so that the second immune substance can further strengthen stimulation of host for target disease
The CD4+T cellullar immunologic responses of poison or target tumor, and enhanced CD4+T cellullar immunologic responses can aid in other be directed to
The cellullar immunologic response of target viral or target tumor；The carrier bacteria be suitable for human body, safety be used as vaccine
And the bacterium of gene therapy；The vector virus be suitable for human body, safety be used as vaccine and the virus of gene therapy；Institute
Stating carrier bacteria and the vector virus can be removed by human immune system.
It is preferred that, the method for obtaining recombinant vector bacterium is as follows：In carrier bacteria genome conformity goal virus or
Target tumor is directed to the protein coding gene of CD4+T cell Main Antigenics, obtains recombinant vector bacterium；Obtain recombinant vector
The method of virus is as follows：Target viral is inserted in vector virus gene or target tumor is directed to CD4+T cell major antigens
The protein coding gene of epitope, and recombinant vector virus is obtained by cell transfecting mode.
It is preferred that, the target viral is the virus for causing human body chronic infection.
It is preferred that, the target tumor is human tumor.
It is preferred that, the recombinant vector bacterium and recombinant vector expressing viral identical target viral or target tumor
CD4+T cell antigen epitopes or the combination of the epitope of series connection.
A kind of application method of the novel therapeutic vaccine of use carrier combinations, comprises the following steps：
Step a：After infected body enters the infection period infected by target viral, weight is contained to infected body injection
First immune substance of group carrier bacteria；
Step b：Right times after infected body injects the first immune substance, contain weight to infected body injection
Second immune substance of group vector virus.
It is preferred that, the first immune substance is injected to infected body using the method for abdominal cavity or intramuscular injection in step a；
The second immune substance is injected to infected body using the method for abdominal cavity or intramuscular injection in stepb.
A kind of application method of the novel therapeutic vaccine of use carrier combinations, comprises the following steps：
Step a：The first immune substance containing recombinant vector bacterium is injected to tumor mice；
Step b：Right times after tumor mice injects the first immune substance, are carried to tumor mice injection containing restructuring
Second immune substance of precursor virus.
It is preferred that, tumor mice injection first is immunized using the method in abdominal cavity, muscle or knurl internal injection in step a
Material；The second immune substance is injected to tumor mice using the method for abdominal cavity, muscle or knurl internal injection in stepb.
Using a kind of novel therapeutic vaccine of use carrier combinations of the present invention, in carrier bacteria and vector virus
Target viral is added in the gene of two kinds of different carriers or target tumor is directed to the albumen of CD4+T cell Main Antigenics
Encoding gene so that infected body or tumor mice are immunized during the vaccine is used by injecting first successively
The immune of the CD4+T cells for target viral or target tumor of reinforcement is told on after material and the second immune substance should
Answer, so as to strengthen the CD8+T cellullar immunologic responses in infected body or tumor mice, substantially improve the consumption of CD8+T cells
State is exhausted, the effective effect for improving therapeutic vaccine control virus infection or control tumour.
Brief description of the drawings
Fig. 1：Show that a kind of novel therapeutic vaccine reduction of use carrier combinations of the present invention in embodiment 1 is slow
Infections Mice Body inner virus titre；
Fig. 2：Show that a kind of novel therapeutic vaccine of use carrier combinations of the present invention in embodiment 1 is strengthened
The effect of CD8 T cell specificity antivirus immune responses；
Fig. 3：Show that a kind of novel therapeutic vaccine of use carrier combinations of the present invention in embodiment 1 is strengthened
The effect of CD4 T cell specificity antivirus immune responses；
Fig. 4：Show that a kind of novel therapeutic vaccine of use carrier combinations of the present invention in embodiment 1 strengthens anti-
The effect of viral humoral immunity；
Fig. 5：Show a kind of novel therapeutic vaccine reduction suppression of use carrier combinations of the present invention in embodiment 1
The effect of property signal representation processed；
Fig. 6：Show a kind of novel therapeutic vaccine reduction of use carrier combinations of the present invention in embodiment 1
The effect of Treg cell frequencies；
Fig. 7：Show that a kind of novel therapeutic vaccine of use carrier combinations of the present invention in embodiment 2 suppresses swollen
The effect of knurl growth.
Embodiment
A kind of novel therapeutic vaccine of use carrier combinations, including the first immune substance and the second immune substance, are used for
Treat chronic viral infection or tumour.First immune substance is made up of recombinant vector bacterium, and the second immune substance is by recombinant vector
Virus composition, completes to prepare and reach the first immune substance of Eligibility requirements and the second immune substance difference refrigerated storage.Wherein
Recombinant vector bacterium be include in genome and express target viral or target tumor in main CD4+T cell antigen epitopes
Or the carrier bacteria of the DNA sequence of the epitope combination of series connection so that the first immune substance can be specifically
Stimulation of host CD4+T cells, produce the specific cellullar immunologic response for target viral or target tumor；Recombinant vector
Virus is to include and express with identical contained by the recombinant vector bacterium for target viral or target tumor in gene
The vector virus of the DNA sequence of the epitope combination of main CD4+T cell antigen epitopes or series connection so that the
Two immune substances can further strengthen stimulation of host for target viral or the CD4+T cellullar immunologic responses of target tumor,
And enhanced CD4+T cellullar immunologic responses can aid in other cellular immunities for target viral or target tumor should
Answer.The recombinant vector bacterium finally obtained and expression of recombinant virus the CD4+T cells of identical target viral or target tumor
Epitope or the combination of the epitope of series connection.
The target viral that a kind of novel therapeutic vaccine of use carrier combinations of the present invention is targeted is to cause people
The virus of body chronic infection, targeted target tumor is human tumor.The CD4+T of wherein target viral or target tumor is thin
The DNA sequence of extracellular antigen epitope is 30-105 base-pairs, encodes 10-35 amino acid sequences.
Carrier bacteria used in preparing a kind of novel therapeutic vaccine of use carrier combinations of the present invention is suitable
Can be as vaccine and the bacterium of gene therapy for human body, safe, and used vector virus is also suitable for people
It is body, safety to be used as vaccine and the virus of gene therapy, it is ensured that to carry out the carrier bacteria and load selected by before genetic recombination
Precursor virus can be eliminated by human immune system.The specific system of the immune substance of vaccine first and the second immune substance of the present invention
Standby and application method will be described in detail in a particular embodiment.
Embodiment 1
First, using carrier combinations novel therapeutic vaccine preparation method：
The target viral that a kind of novel therapeutic vaccine of use carrier combinations of the present invention is directed in embodiment 1 is
Lymphocytic choriomeningitis virus (LCMV), is a kind of chronic infection virus, wherein lymphatic choroid plexus meninx
The protein coding gene that the Main Antigenic of CD4+T cell immune responses can be caused in scorching virus (LCMV) is GP61-GP66
Gene；It is carrier bacteria to select listerisa monocytogenes in mjme (LM), and selection influenza A virus (IAV) is carrier disease
Carrier bacteria and the bacterium of vector virus and virus itself are selected as in poison, the present embodiment or after attenuation treatment to human body
Do not injure, can be eliminated by human immune system.
Prepared by the vaccine of embodiment 1 include step a and step b：
Step a：Prepare the first immune substance, including step a1 and step a2.
Step a1：Attenuation treatment is carried out to listerisa monocytogenes in mjme (LM), the side of homologous recombination is then utilized
Method, by GP66 protein coding genes site-directed integration in listerisa monocytogenes in mjme (LM) genome after attenuation
The downstream of hly gene promoters and signal peptide sequence, the recombinant vector bacterium for obtaining expressing GP66 (GP61) is rLM-GP66
(LCMV GP61)；
Step a2：Take LM-GP66 (LCMV GP61) bacterium storing liquid to apply BHI flat boards, choose single bacterium colony inoculation BHI broth cultivations
Base is supported, is cultivated under 37 DEG C of environment, the absorption value for determining bacterial concentration A600 in every 6 to 8 hours, adjustment bacterial concentration is 6 ×
105/ ml, and plate count correction is applied, it will finally cultivate qualified rLM-GP66 (LCMV GP61) bacterium frost and be stored in -80
In DEG C refrigerator.
Step b：Prepare the second immune substance, including step b1 and step b2.
Step b1：GP66 protein coding genes are inserted into influenza A virus (IAV) NA using Reverse Genetics
In gene, then chimeric NA genes are inserted in pHW2000, and with pHW-PB1, pHW-PB2, pHW-PA, pHW-HA, pHW-
The genetic transcription such as NP, pHW-M and pHW-NS/expression vector cotransfection 293T cells, finally will contain Flu-A disease after transfection
The 293T cells and supernatants inoculation SPF chicken embryos of malicious (IAV), obtaining has the recombinant vector of HA-HI test viral for IAV-GP66.
Step b2：The method of the culture reference current international practice of IAV-GP66 viruses, using primary chicken embryo fibroblasts
(CEF) cultivated in 150 square centimeters of blake bottle, the blake bottle includes MEM nutrient solutions, works as chicken embryo fibroblasts
(CEF) grow up to after individual layer, the Strain of inoculation IAV-GP66 viruses, and make viral MOI=1；After 37 DEG C of environment cultures 3 days,
Centrifuge and abandon supernatant, in dry ice and 37 DEG C of water-bath frozen-thawed cells 3 times, in ultrasound 1 minute on ice, then will cultivate qualified IAV-
GP66 frozen virus is stored in -80 DEG C of refrigerators.The concentration mensuration of wherein IAV-GP66 viruses is infected using median tissue culture
Dosimetry abbreviation TCID50 is measured, and specific method is as follows：The IAV-GP66 virus liquids being serially diluted are amounted to
0.2ml is mixed with 100 μ l 1 × 105ml mdck cells and is placed in Microtitration plates, and 18 to 22 are cultivated in 37 DEG C of incubators
After hour, cell 50 3nfective dose is determined.
2nd, using carrier combinations novel therapeutic vaccine application method
In the present embodiment, the mouse used is C57BL/6J (CD45.2), purchased from the magnificent Fukang biotechnology share in Beijing
Co., Ltd；All mouse are raised in Third Military Medical University SPF (Specific pathogen-free) level Animal House.It is all
Mouse used is that the mouse used in 6-10 week old, and same experiment is that same sex is grouped at random in experiment.This implementation
RLM-GP66 (LCMV GP61) bacterium bacterial strains after being recombinated used in example are commercially available from Biources Inc. companies of the U.S.,
The Strain of IAV-GP66 viruses after restructuring used at the same time comes from Inst. of Immunology, PLA et al..
On used recombinant vector virus IAV-GP66, and its construction method is in document in the present embodiment
《Qualitatively Different Memory CD8+T Cells Are Generated after Lymphocytic
Choriomeningitis Virus and Influenza Virus Infections》In be described, the document in
It is published within 2010 Journal of Immunology magazines ((4) 2182-2190 of August 15,2010,185；DOI：
https://doi.org/10.4049/jimmunol.1001142).Illustrate that recombinant vector virus IAV-GP66 is logical in text
Cross the plastid reverse genetics system constructing that is made up of eight plasmids；PCR guiding mutation technique by LCMV virus
42 insertions of neuraminidase (NA) GFP of GP (nine amino acid lengths) sequences from H1N1PR8 plants of influenza virus；For
Ensure that the length of restructuring NA albumen keeps constant, QNHTGICNQ sequences are deleted from recombinant protein sequence.
The text is as follows：
Recombinant influenza virus was produced using an established eight-
plasmid influenza reverse-genetics system.The plasmids used in the
construction of the recombinant influenza viruses were described previously
(18).The LCMV gp epitope was inserted into the NA of A/PR/8/34(H1N1)at
residue 42 using a PCR mutagenesis approach.A corresponding number of amino
acids(nine-QNHTGICNQ)was deleted from the recombinant viruses to maintain the
protein length equal to the wild-type NA protein.
Step a：Using target viral LCMV-CL13 infecting mouses, enter the LCMV-CL13 chronic viral infection phases in mouse
Afterwards the 21st day, CD8+T cells entered comprehensive depletion state, from now on using combined therapy vaccine, pass through abdominal cavity
The method of injection or intramuscular injection is to infected mouse injection 1x106Cfu contains the of LM-GP66 (LCMV GP61) bacterium
One immune substance, injection volume is 0.2ml, and the first immune substance is using the dilution of RPMI culture mediums.
Step b：The 7th day after mouse injects the first immune substance, i.e. mouse enter LCMV-CL13 chronic viral infections
The 28th day after phase, 0.5TCID is injected to being infected mouse in step a by the method for intraperitoneal injection or intramuscular injection50Contain
There is the second immune substance of IAV-GP66 viruses, for the virus-specific CD4+T cells of boost high quantities, injection volume is
0.1ml, the second immune substance is diluted using RPMI culture mediums.
3rd, using the novel therapeutic vaccine using effect test experience of carrier combinations
The 8th day after the injection of the second immune substance, separate each tissue sample and utilize flow cytometry analysis CD8+T cells
Quantity, function and phenotype, while also analyze CD4+T cells quantity and function.Finally, titration mouse spleen, lungs and
Virus titer in liver, determines the effect of therapeutic vaccine.In vaccine effect test experience, combined therapy will not be injected
The LCMV-Cl13 infecting mouses of vaccine are used as control.
1. the quality and quantity analysis of the CD4+T cells of virus-specific
1.1 quantitative analysis：The cell separated from spleen is first noted down into TCS, then directly gathered with four of the small peptide containing GP66
Body is dyed, and is aided with CD3, CD4 and CD44, and dead cell is distinguished with Live/Dead dyestuffs, flow cytometry is carried out, with Live/
Dead-Tetramer+CD3+CD4+CD44+ defines the CD4+T cells of virus-specific living, according to its total cell frequency
With total cell quantity, the quantity of the CD4+T cells of virus-specific is determined.
1.2 quality analysis：Pass through above-mentioned flow cytometry, it is first determined the CD4+T cells of virus-specific, then
The quality of the CD4+T cells of virus-specific is further defined in terms of differentiation direction, cytokine secretion.Correlation technique
It is as follows：Cell mixture is stimulated with GP66 small peptides 5 hours, then carries out cell surface and intracellular dyeing using corresponding antibodies.
2. the CD8+T cell depletions analysis of virus-specific
The degree of exhaustion of CD8+T cells is analyzed in terms of following 6：
2.1 cell quantities, TCS is first noted down by the cell separated from spleen, then directly with four of the small peptide containing GP33+
Aggressiveness is dyed, and is aided with CD3, CD4 and CD44, and dead cell is distinguished with Live/Dead dyestuffs, flow cytometry is carried out, with Live/
Dead-Tetramer+CD3+CD4+CD44+ defines the CD8+T cells of virus-specific living, according to its total cell frequency
With total cell quantity, the quantity of the CD8+T cells of virus-specific is determined
The expression of 2.2 cell surface Inhibitory receptors, including PD-1,2B4, LAG3, Tim3 etc., these acceptors can make
Quantitative analysis is carried out with flow cytometer；
The secretion of 2.3 cell factors, mainly including IL-2, IFN-, TNF, secretion level quantitatively can using specificity
GP33 small peptides stimulate 5 hours, then using intracellular dye method, analyzed using flow cytometer；
2.4 killing abilities, the killing ability of cell can detect that CD107a/b expression is entered with cell instrument and corresponding antibodies
Row display；
2.5 multiplication capacities, the propagation of cell can detect that Ki-67 expression is entered by using flow cytometer and corresponding antibodies
Row display；
3. organize virus sweep analysis
3.1, by the different sample of tissue of immune and non-immune infecting mouse, weigh, are homogenized, and centrifugation takes supernatant, used
TIANAMP Virus RNA Kit (DP315-R) tissue viral RNAs extracts kit extracts the viral RNA in tissue；
3.2 with Nanodrop to after the virus RNA quantification that is extracted, be to make in cDNA, process of reverse-transcription by its reverse transcription
With virus specific primers (GP-R：GCAACTGCTGTGTTCCCGAAAC)；
3.3qRT-PCR method detection viral copy number：Detect unknown sample when, need to by plaque ethods gold mark
Ten times of doubling dilutions of virus of the concentration known of quasi- titration, set up standard curve.The primer sequence is：GP-F
CATTCACCTGGACTTTGTCAGACTC and GP-R GCAACTGCTGTGTTCCCGAAAC；
3.4 draw extracted copy viral RNA number according to standard curve, and every gram is calculated further according to the tissue weight of record
Virus titer in tissue.
4. antibody titer is detected
Isolate mice serum and determine LCMV specific IgG titers using ELISA method.With PBS by BHK-LCMV
Lysate is diluted to concentration for 3 μ g/ml.Per Kong Zhongjia 100ul, stayed overnight in 4 DEG C of environment, and solution in hole discarded in second day,
Washed with PBST 3 times.200ul confining liquids (PBS+0.2%Tween-20+10%FCS) are added per hole, room temperature is placed 1 hour.
In one round, the test serum necessarily diluted, heel row gradient dilution, incubation at room temperature 90 minutes, and do sky simultaneously successively are added
Bai Kong, negative control hole and Positive control wells, are then washed three times with PBST.Goat anti-mouse are configured in confining liquid
IgG-HRP (1: 5000) ELIAS secondary antibody.It is incubated at room temperature 90 minutes, is washed with PBST three times.By 4mg OPD (Sigma, P8787)
It is dissolved in 10ml citrate buffer solutions, adds 33ul 3% H2O2(Fisher, H324500).100ul is added per hole.Treat
After substrate and enzyme reaction are complete, 100ul 1M HCl are added in each reacting hole.Read using ELIASA per hole OD at 490nm
Value.
5. use the novel therapeutic vaccine and effect detection associated with PD-L1 antibody of carrier combinations
Infect every three days from the 26th day after LCMV-CL13 mouse self-infection and received a PD-L1 antibody (ra
tanti-mouse PD-L1 antibody；10F.9G2；BioXcell) inject, totally three times, per injection dosage is 200 μ g,
By the way of intraperitoneal injection.At the same time, the novel therapeutic using carrier combinations is received from the 21st day after mouse infection
Immune, i.e., the 21st day injection LM-GP61 after mouse infection of vaccine, 28 days injection IAV-GP61 after mouse infection.
4th, using carrier combinations novel therapeutic vaccine beneficial effect
As shown in figs 1 to 6, the novel therapeutic vaccine of the present invention for using carrier combinations used in embodiment 1
By the way that recombinant vector bacterium and the viral two kinds of different carriers of recombinant vector are applied in combination successively, strengthen virus-specific CD4+T thin
The immune response of born of the same parents, so as to strengthen the response of CD8+T cells in chronic viral infection, improves the depletion state of CD8+T cells.This
The novel therapeutic vaccine immunity of the described use carrier combinations of invention is by after the mouse of chronic viral infection, spleen in Mice Body
Virus titer is remarkably decreased 100-1000 times in dirty, lungs and liver organization.
Immune, the mouse of chronic viral infection of novel therapeutic vaccine by use carrier combinations of the present invention
Internal virus-specific CD8+T cell numbers are improved twice or so, while the raising about three to four of feature CD8+T cell numbers
Times；Thus, it could be seen that the immune response of virus-specific CD8+T cells is significantly improved, the function depletion state of CD8+T cells
Significantly improve, and CD8+T cells recover stronger antiviral effect function.
The novel therapeutic vaccine of use carrier combinations of the present invention has while CD8+T cell functions are improved
Effect improves the number and function of virus-specific CD4+T cells, about four times of the number increase of virus-specific CD4+T cells,
So as to provide more helps, the ability that enhancing CD8+T cell resistances are exhausted for CD8+T cells.Also, this vaccine is in enhancing
The humoral immunity in slow-virus infection can also be strengthened while cellular immunity.In immune Mice Body, folliculus helper T lymphocyte
TFH cell numbers are improved twice, and Germinal center B cell ratio is raised twice, and the special viral antibody IgG drops in serum
Degree is significantly improved, about 1.5 times.Finally, this vaccine can also improve body vivo immunization and suppress environment, the mouse through vaccine immunity
Macrophage and the expression of surface of dendritic cells inhibition ligand molecular decline, and regulatory T cells frequency has also declined, about
Decline 5 percent.
A parts show method flow of the mouse using the novel therapeutic vaccine of carrier combinations in Fig. 1；B-d parts are aobvious
Show using vaccine immune mouse and control mice spleen (b parts), lungs (c parts) and liver (d parts) inner virus titre
Value, it is seen that mouse after the novel therapeutic vaccine of carrier combinations using effectively reducing the viscera tissues such as spleen, lungs and liver
Interior virus titer.
In Fig. 2 a part show control group mice and vaccine group Murine Virus activation CD44hiCD8 T cells frequency and
The comparison of number；B parts show the frequency sum purpose ratio of control group mice and vaccine group Murine Virus specific C D8 T cells
Compared with；C parts show control group mice and vaccine group Murine Virus specific C D8 T cell surface expression inhibition molecular levels
Compare；D parts show that control group mice and vaccine group mouse CD8 T cells express the comparison of proliferation marker Ki-67 levels；e-
F parts show that control group mice and vaccine group mouse CD8 T cells are external through virus-specific peptide GP33 stimulation aftereffect functions
Comparison；G-h parts show that control group mice and vaccine group mouse group CD8 T cells are external through virus-specific peptide GP276 thorns
Swash the comparison of aftereffect function.
A-c parts show the CD44hiCD4 T cells and disease of control group mice and the activation of vaccine group Murine Virus in Fig. 3
The frequency sum purpose of malicious specificity GP66+CD4 T cells compares；D-e parts show control group mice and vaccine group mouse CD4
The comparison of secrete cytokines after the external stimulation through specific peptide GP66 of T cell.
A parts show the comparison of control group mice and vaccine group Murine Virus specificity T FH numbers in Fig. 4；B parts are shown
The comparison of control group mice and vaccine group mouse Germinal center B cell (GCB) frequency；C parts show control group mice and vaccine
The comparison of LCMV specific IgGs in group mice serum.
Fig. 5 is shown can reduce macrophage (Macrophage) and dendron using the novel therapeutic vaccine of carrier combinations
Shape cell (DC) surface inhibition signaling molecule PD-L1 expression.
Fig. 6 is shown can reduce regulatory T cells (Treg) frequency using the novel therapeutic vaccine of carrier combinations.
It can be seen that when the novel therapeutic vaccine of use carrier combinations of the present invention is used for into chronic viral infection, can lead to
The immune response of stimulation oversaturation CD4+T cells and then the effective ability for strengthening CD8+T cell anti-virus ability and resisting exhaustion,
With good antiviral effect.
Embodiment 2
First, using carrier combinations novel therapeutic vaccine preparation method：
The target tumor that a kind of novel therapeutic vaccine of use carrier combinations of the present invention is directed in embodiment 2 is
The melanoma cells (B16-GP) of LCMV viral glycoproteins are expressed, are a kind of solid tumor, wherein melanoma cells (B16-
GP the protein coding gene that) can cause the Main Antigenic of CD4+T cell immune responses is also GP61-GP66 genes；Equally
It is carrier bacteria to select listerisa monocytogenes in mjme (LM), and selection influenza A virus (IAV) is vector virus, this reality
Apply the bacterium that carrier bacteria and vector virus are selected as in example and virus itself or human body is not hindered after attenuation treatment
Evil, can be eliminated by human immune system.
The vaccine preparation process be the same as Example 1 of embodiment 2 is identical.
2nd, using carrier combinations novel therapeutic vaccine application method
In the present embodiment, the mouse used is C57BL/6J (CD45.2), purchased from the magnificent Fukang biotechnology share in Beijing
Co., Ltd；All mouse are raised in Third Military Medical University SPF (Specific pathogen-free) level Animal House.It is all
Mouse used is that the mouse used in 6-10 week old, and same experiment is that same sex is grouped at random in experiment.This implementation
RLM-GP66 (LCMV GP61) bacterium bacterial strains after being recombinated used in example are commercially available from Biources Inc. companies of the U.S.,
The Strain of IAV-GP66 viruses after restructuring used at the same time comes from Inst. of Immunology, PLA et al..
Step a：Target tumor is expressed into the melanoma cells (B16-GP) of LCMV viral glycoproteins by subcutaneous
The mode of injection is in mouse skin top layer transplanting plantation melanoma cells (B16-GP).Melanoma cells (B16- to be transplanted
GP) into combined therapy vaccine is begun to use after knurl, by the method for intraperitoneal injection, intramuscular injection or knurl internal injection to lotus
Knurl mouse injects 1x106Cfu contains the first immune substance of LM-GP66 (LCMV GP61) bacterium, and injection volume is 0.2ml, and
First immune substance is diluted using RPMI culture mediums.
Step b：In 5-7 days after mouse injects the first immune substance, pass through intraperitoneal injection, intramuscular injection or knurl body
The method of interior injection injects 0.5TCID to tumor-bearing mice in step a50The second immune substance containing IAV-GP66 viruses, is used for
The virus-specific CD4+T cells of boost high quantities, injection volume is 0.1ml, and the second immune substance is dilute using RPMI culture mediums
Release.
3rd, using carrier combinations novel therapeutic vaccine using effect test experience
Before the novel therapeutic vaccine injection of use carrier combinations of the present invention, in injection process and after injection
, the repeatedly change of measurement tumor-bearing mice epidermal melanin knurl volume size, it is determined that the effect of vaccine of the present invention.Simultaneously in this hair
In the effect detection experiment of bright vaccine, the lotus knurl of the novel therapeutic vaccine of use carrier combinations of the present invention will not be injected
Mouse is used as control.
As shown in fig. 7, the novel therapeutic vaccine of use carrier combinations of the present invention is used for into tumor model, pass through
CD4+T cellular pathways can effectively strengthen body anti-tumor capacity, with the good effect for slowing down tumour growth, be a kind of
New generation vaccine with good potential application foreground.
The above embodiment of the present invention is only example to illustrate the invention, and is not the implementation to the present invention
The restriction of mode.For those of ordinary skill in the field, other can also be made not on the basis of the above description
With the change and variation of form.Here can not all embodiments be exhaustive.It is every to belong to technical scheme institute
Row of the obvious changes or variations amplified out still in protection scope of the present invention.
Claims (9)
1. a kind of novel therapeutic vaccine of use carrier combinations, including the first immune substance and the second immune substance, its feature
It is, first immune substance is made up of recombinant vector bacterium, second immune substance is made up of recombinant vector virus；Institute
State recombinant vector bacterium for include in genome and express target viral or target tumor in main CD4+T cellular antigens tables
The carrier bacteria of the DNA sequence of position so that the first immune substance can specifically stimulation of host CD4+T cells,
Produce the specific cellullar immunologic response for target viral or target tumor；The recombinant vector virus is bag in gene
Contain and express with identical contained by the recombinant vector bacterium for main CD4+T cells in target viral or target tumor
The vector virus of the DNA sequence of epitope so that the second immune substance can further strengthen stimulation of host pin
To target viral or the CD4+T cellullar immunologic responses of target tumor, and enhanced CD4+T cellullar immunologic responses can be aided in
It is other to be directed to target viral or the cellullar immunologic response of target tumor；The carrier bacteria is suitable for human body, safety
It is used as vaccine and the bacterium of gene therapy；The vector virus be suitable for human body, safety be used as vaccine and gene therapy
Virus；The carrier bacteria and the vector virus can be removed by human immune system.
2. the novel therapeutic vaccine of a kind of use carrier combinations according to claim 1, it is characterised in that recombinated
The method of carrier bacteria is as follows：Conformity goal virus or target tumor are directed to CD4+T cell masters in carrier bacteria genome
The protein coding gene of epitope is wanted, recombinant vector bacterium is obtained；The method for obtaining recombinant vector virus is as follows：In carrier disease
Target viral is inserted in virus gene or target tumor is directed to the protein coding gene of CD4+T cell Main Antigenics, and is led to
Cross cell transfecting mode and obtain recombinant vector virus.
3. the novel therapeutic vaccine of a kind of use carrier combinations according to claim 1 or 2, it is characterised in that described
Target viral is the virus for causing human body chronic infection.
4. the novel therapeutic vaccine of a kind of use carrier combinations according to claim 1 or 2, it is characterised in that described
Target tumor is human tumor.
5. the novel therapeutic vaccine of a kind of use carrier combinations according to claim 1 or 2, it is characterised in that described
The CD4+T cell antigen epitopes of recombinant vector bacterium and recombinant vector expressing viral identical target viral or target tumor or
The epitope combination of series connection.
6. a kind of application method of the novel therapeutic vaccine of use carrier combinations as claimed in claim 1 or 2, its feature exists
In comprising the following steps：
Step a：After infected body enters the infection period infected by target viral, infected body injection is carried containing restructuring
The first immune substance of body bacterium；
Step b：Right times after infected body injects the first immune substance, are carried to infected body injection containing restructuring
Second immune substance of precursor virus.
7. a kind of application method of the novel therapeutic vaccine of use carrier combinations according to claim 6, its feature exists
In using the method for abdominal cavity or intramuscular injection to the first immune substance of infected body injection in step a；Adopt in stepb
The second immune substance is injected to infected body with the method for abdominal cavity or intramuscular injection.
8. a kind of application method of the novel therapeutic vaccine of use carrier combinations as claimed in claim 1 or 2, its feature exists
In comprising the following steps：
Step a：The first immune substance containing recombinant vector bacterium is injected to tumor mice；
Step b：Right times after tumor mice injects the first immune substance, contain recombinant vector disease to tumor mice injection
Second immune substance of poison.
9. a kind of application method of the novel therapeutic vaccine of use carrier combinations according to claim 8, its feature exists
In using the method in abdominal cavity, muscle or knurl internal injection to tumor mice the first immune substance of injection in step a：In step b
The method in middle use abdominal cavity, muscle or knurl internal injection injects the second immune substance to tumor mice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710148286.1A CN107213458A (en) | 2017-03-14 | 2017-03-14 | The novel therapeutic vaccine and application method of a kind of use carrier combinations |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710148286.1A CN107213458A (en) | 2017-03-14 | 2017-03-14 | The novel therapeutic vaccine and application method of a kind of use carrier combinations |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107213458A true CN107213458A (en) | 2017-09-29 |
Family
ID=59927508
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710148286.1A Pending CN107213458A (en) | 2017-03-14 | 2017-03-14 | The novel therapeutic vaccine and application method of a kind of use carrier combinations |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107213458A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101068919A (en) * | 2004-11-30 | 2007-11-07 | Aeras全球Tb疫苗基金会 | Bacterial packaging strains usefuel for generation and production of recombinant double-stranded RNA nucleocapsids and uses thereof |
| CN102947452A (en) * | 2010-05-23 | 2013-02-27 | 艾杜罗生物科技公司 | Methods and compositions using listeria for adjuvant treatment of cancer |
| WO2017024000A1 (en) * | 2015-08-03 | 2017-02-09 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Brachyury deletion mutants, non-yeast vectors encoding brachyury deletion mutants, and their use |
-
2017
- 2017-03-14 CN CN201710148286.1A patent/CN107213458A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101068919A (en) * | 2004-11-30 | 2007-11-07 | Aeras全球Tb疫苗基金会 | Bacterial packaging strains usefuel for generation and production of recombinant double-stranded RNA nucleocapsids and uses thereof |
| CN102947452A (en) * | 2010-05-23 | 2013-02-27 | 艾杜罗生物科技公司 | Methods and compositions using listeria for adjuvant treatment of cancer |
| WO2017024000A1 (en) * | 2015-08-03 | 2017-02-09 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Brachyury deletion mutants, non-yeast vectors encoding brachyury deletion mutants, and their use |
Non-Patent Citations (8)
| Title |
|---|
| M R CASTRUCCI等: "Protection against lethal lymphocytic choriomeningitis virus (LCMV) infection by immunization of mice with an influenza virus containing an LCMV epitope recognized by cytotoxic T lymphocytes", 《J VIROL》 * |
| PABLO PENALOZA-MACMASTER等: "Vaccine-elicited CD4 T cells induce immunopathology after chronic LCMV infection", 《SCIENCE》 * |
| RAN HE等: "Efficient control of chronic LCMV infection by a CD4 T cell epitope-based heterologous prime-boost vaccination in a murine model", 《CELLULAR MOLECULAR IMMUNOLOGY》 * |
| 冯美卿: "《生物技术制药》", 31 January 2016, 中国医药科技出版社 * |
| 张琦等: "CD4+记忆T细胞与血管炎", 《医学综述》 * |
| 李文桂等: "重组单核细胞增生性李斯特菌疫苗的研制现状", 《中国病原生物学杂志》 * |
| 李颖等: "流感病毒载体的应用研究进展", 《国际流行病学传染病学杂志》 * |
| 许力凡: "CD4+T细胞对体液免疫的"阴阳"调节", 《中国博士学位论文全文数据库医药卫生科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111315407B (en) | Broad-spectrum anti-influenza vaccine immunogen and application thereof | |
| CN104640565B (en) | Hepatitis B virus core protein and surface antigen protein and the vaccine comprising it | |
| CN105939730A (en) | MERS-CoV vaccine | |
| CN105483140B (en) | It is a kind of using people's replication defective adenoviral as the Ebola virus disease vaccine of carrier | |
| CN110051835A (en) | Filamentous virus shares antigen, nucleic acid construct prepared therefrom and vaccine and its application method | |
| EA011557B1 (en) | Nucleic acid constructs | |
| CN110462029A (en) | HIV immunotherapy without preimmunization step | |
| CN102083457B (en) | Smallpox DNA vaccination and its antigen for causing immune response | |
| CN108715856B (en) | It is a kind of using people's replication defective adenoviral as the Marburg virus disease vaccine of carrier | |
| CN113105531A (en) | T cell epitope polypeptide of avian infectious bronchitis virus N protein and application thereof | |
| CN109136198A (en) | A kind of expression Chicken Infectious Anemia Virus VP1, VP2 genetic recombination bird pox virus live vector vaccine | |
| CN105384826A (en) | Cord blood nucleated cell for expressing chimeric antigen receptor and application of cord blood nucleated cell | |
| CN105132371B (en) | External method and the application thereof of offering, activate DC cell | |
| CN102787097B (en) | Modified dendritic cell and vaccine containing the same | |
| CN108367064A (en) | Express the vaccine based on cytomegalovirus of Ebola virus glycoproteins | |
| KR20200001671A (en) | Vaccine composition for preventing or treating infection due to severe fever with thrombocytopenia syndrome virus | |
| CN110072536A (en) | Filamentous virus shares antigen, nucleic acid construct and the vaccine being made from it and its application method | |
| CN107213458A (en) | The novel therapeutic vaccine and application method of a kind of use carrier combinations | |
| CN107335054A (en) | A kind of DC vaccine for treating chronic hepatitis B | |
| CN102181406A (en) | Recombinant adenovirus, dendritic cell (DC) modified by recombinant adenovirus and application of recombinant adenovirus and DC | |
| CN101775375B (en) | Preparation method of recombinant adeno-associated viruses containing EB virus latent membrane protein 1 and 2 genes and application thereof | |
| CN108101966A (en) | Isotope of redox-sensitive polypeptide based on cell-penetrating peptide and its application in vaccine carrier | |
| CN109701008A (en) | For the therapeutic DC combination vaccine and preparation method thereof of herpes simplex virus | |
| CN102018964A (en) | Three-plasmid co-immune vaccine system capable of breaking immune tolerance and preparation method thereof | |
| CN105779480A (en) | Recombinant adeno-associated virus carrier carrying multi-site mutant EGFR (Epidermal Growth Factor Receptor) novel antigenic gene as well as construction method and application of recombinant adeno-associated virus carrier |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170929 |
|
| WD01 | Invention patent application deemed withdrawn after publication |