CN101068919A - Bacterial packaging strains usefuel for generation and production of recombinant double-stranded RNA nucleocapsids and uses thereof - Google Patents

Abstract

Bacterial packaging strains useful for generating recombinant double-stranded RNA nucleocapsids (rdsRNs) are provided. The packaging strains are useful for the production of RNA encoding vaccine antigens, bioactive proteins, immunoregulatory proteins, antisense RNAs, and catalytic RNAs in eukaryotic cells or tissues. Recombinant ssRNA is introduced into the strains and packaged to form rdsRNs de novo.

Description

Be applicable to bacterial packaging strains of generation and preparation reorganization double-stranded RNA nucleocapsid and uses thereof

Invention field

The invention provides and be applicable to the bacterial packaging strains that produces reorganization double-stranded RNA nucleocapsid (rdsRNs), it can be used for being created in encoding vaccine antigens in eukaryotic cell or the tissue, biological activity protein, the RNA of immune modulator, sense-rna and catalysis RNA.Especially, the present invention also provides bacterial packaging strains, thereby can form rdsRN to the mode that wherein imports reorganization ssRNA and pack with de novo synthesis, and described rdsRN can duplicate and prepare thus purpose RNA in described packaging strains.

Background of invention

Virus nucleocapsid, promptly Bing Du nucleoprotein core has many features, and these features can make it have the value of expression of heterologous genes sequence in biosystem.Owing to lack adventitia and the adhesin of intact virus, the infective particle of nucleocapsid right and wrong is made of the albumen and the genetic material of nucleoid, and it has kept the ability of encapsidate and replicating nucleic acid sequence.Therefore, can be by removing the coding film of parental virus, adhesin, proteolytic enzyme, and the sequence of other infectivities or cytolytic factor alleviates and infects or risk that environment disseminates.By not selecting in its replication cycle, not showing the virus precursor in DNA stage, the RNA nucleocapsid also can further strengthen the security of these gene expression systems, be reduced in thus when importing, the extraneous nucleotide sequence is integrated into described cell or the genomic risk of organism.By in these nucleocapsid expression system designs, utilizing double-stranded RNA (being " dsRNA " in this article), can overcome the inherent instability of RNA.In addition, the virus genomic typical segmentsization of the removal of non-nucleocapsid sequence and dsRNA makes utilizes artificial gene group fragment to replace being designed in order to have much the method for magnetism of deletion sequence and coding allos RNA, adopts this method can express goal gene or purpose RNA is sent in the biosystem.Can design reorganization nucleocapsid expression system thus, thereby it only can contain that coding produces the necessary sequence of other nucleocapsids, the purpose heterologous sequence, with and in cell, breed and prepare necessary sequence.

The double-stranded RNA phage of capsule virus (cystoviridae) section (being " dsRP " in this article) is prototype (prototypical) dsRNA virus (Sinclair etc., J Virol.16:685; 1975); (Mgraw etc., J Virol.58:142; 1986); (Gottlieb etc., Virology 163:183; 1988); (Mindich etc., J Virol.62:1180; 1988); (Mindich, Microbiol.MoI.Biol.Rev.63,149; 1999).The distinctive feature of Cystoviridae dsRP is by three kinds of double-stranded RNA fragments (Mcgraw etc., mentioned above, 1986); (Gottlieb etc., mentioned above, 1988); (Mindich etc., mentioned above, 1988) specified fragment-L, the genome that fragment-M and fragment-S constitutes, and resiniferous film is by (membrane coat) (Sands andLowlicht, Can J Microbiol, 22:154; 1976); (Bamford, and Palva, Biochim Biophys Acta, 601:245; 1980).Genomic fragment is contained within the nucleocapsid core, and it comprises albumen P1, P2, and P4 and P7, and prepared by the gene (for example GenBank Accession#AF226851) of coding dsRNA fragment-L.Synthetic the occurring within the nucleocapsid of positive chain RNA (in this article for " mRNA "), and be that the RNA polymerase that the RNA-by the gene on fragment-L-2 part coding relies on is finished (Mindich etc., mentioned above, 1988); (Van Etten etc., J Virol, 12:464; 1973); Gene on fragment-L-7 has also been brought into play effect (Mindich, etc., mentioned above, 1999) in mRNA synthetic process.

DsRP phi-6, the archetype (archetype) of this section of dsRNA phage, usually can infect pseudomonas syringae (Pseudomonas syringae) (Mindich, Deng, mentioned above, 1999), yet, the dsRP phi-8 that is separated to recently, phi-11, phi-12 and phi-13 can ehec infection bacterial strain JM109 (U.S. classical collection center (being " ATCC " in this article) #53323), O-antigen negative mutant (being appointed as " Salmonella typhimurium (S.Typhimurium " in this article)) and carry out the to a certain degree (Mindich etc. that duplicate therein and Salmonella enteritidis mouse typhus serotype (Salmonella enterica) serovarTyphimurium), mentioned above, 1999); (Mindich etc., J.Bacteriol, 181:4505; 1999); (Hoogstraten etc., Virology, 272:218; 2000); (Qiao etc., Virology 275:218; 2000).

The life cycle of archetype dsRP phi-6 in bacterium open already (Mindich, AdvVirus Res, 35:137; 1988); (Mindich, etc., mentioned above, 1999).Thereby Phi-6 allows to contact and then infection host with host cell membrane by being incorporated into flagellum, has caused fusion thus, and meanwhile nucleocapsid is imported into pericentral siphon.Nucleocapsid is transferred in the tenuigenin subsequently, and this is the incident of the transfer character of an endopeptidase activity that needs albumen P5 and albumen P8.Ironically, the nucleocapsid with complete P8 shell can spontaneously enter the protoplastis of bacterium, thereby has caused the spontaneous transfection of bacterial isolates, prepares protoplastis (Qiao etc., Virology227:103 thus; 1997); (Olkkonen etc., Proc.Natl.Acad.Sci.87:9173; 1990).

When entering tenuigenin, P8 can shell, and remaining nucleocapsid, it contains three kinds of dsRNA fragments and has the rna polymerase activity that RNA-relies on, and then begins synthetic dsRNA fragment L, the mRNA copy of M and S.The albumen that is produced by fragment-L is mainly relevant with the procapsid preparation; Fragment-M then relates generally to the synthetic of attachment protein, fragment-S then produces the glutelin (P8) of procapsid, solvability endopeptidase (P5), and relate to albumen (P9 and P12) (the Johnson and Mindich that the fat coating generates, J Bacteriol, 176:4124; 1994).The segmental packing of dsRNA is in sequence, and wherein fragment-S is identified and is held by the procapsid of sky; The procapsid that has contained fragment-S no longer but now in conjunction with this fragment can in conjunction with and hold fragment-M; The procapsid that has contained fragment S and M no longer but now in conjunction with these fragments can in conjunction with and hold fragment-L, thereby produce nucleocapsid.In case nucleocapsid has contained three kinds of whole single stranded RNAs (being " ssRNA " in this article) fragment, thereby synthesizing of so negative RNA chain just begun to prepare the dsRNA fragment.Nucleocapsid links to each other with 8 with albumen 5 subsequently, and finally is contained in the adipose membrane, thereby has finished the assembling of phage.Cracking that it is generally acknowledged host cell is because film crack protein P10, the product accumulation of fragment-M and taking place, and need endopeptidase P5 (Mindich etc., mentioned above, 1999).

Assembling in the dsRP procapsid and rna polymerase activity do not need host protein, because the procapsid that obtains from the e. coli jm109 derivative purifying that can express fragment-L cDNA copy can be packed the ssRNA fragment L of purifying, M and S (Mindich etc., mentioned above, 1999); (Qiao etc., mentioned above, 1997).In above-mentioned vitro system, after having absorbed the ssRNA fragment, the adding of ribonucleotide has caused the synthetic and segmental generation of ripe dsRNA of minus strand.In addition, dsRNA is synthetic finish after, P8 can link to each other with nucleocapsid, and as mentioned above, products therefrom can enter the bacterium protoplastis and produce effectively infection; (Qiao etc., mentioned above, 1997).

Generation (Mindich, the Adv Virus Res 53:341 of reorganization dsRP (being called as " rdsRP " in this article) described in research in the past; 1999); (Onodera etc., J Virol 66:190; 1992).Thereby can make up simple rdsRP by in fragment-M of dsRP phi-6, inserting kalamycin resistance allelotrope.Can carry the JM109 that expresses the plasmid that contains wild-type dsRPphi-6 recombinant fragment-M by infection and separate the rdsRP that contains described recombinant fragment.By this method, can in host cell, set up a kind of carrier state, in this state, can prepare infective rdsRP (Onodera etc., mentioned above, 1992) continuously by the carrier bacterium strain; (Mindich, Adv Virus Res 53:341; 1999).The phage plaque that is produced by the carrier bacterial strain forms ability and can keep 3-5 flat board to go down to posterity; Yet after additionally going down to posterity, newborn phage can not form plaque on the carrier bacterial strain, but still can produce low-level infectious phage (Onodera etc., mentioned above, 1992).In some cases, there is the carrier bacterial strain of significant amounts to lose the ability that produces infectious phage together; The dsRNA that comes from these bacterial isolateses has shown one or more segmental disappearances (Onodera etc., mentioned above, 1992).Under certain conditions, can produce the sudden change phage of isolating shortage fragment-S a kind of such carrier bacterial strain of phage ability from having lost.But all can not be under any situation to make up rdsRN for making system adapt to the direct purpose that in eukaryotic cell or tissue, works.Therefore, Zhi Bei rdsRP is inherent unsettled by this method, and the analysis that can not be used for the phage assembling and duplicate; And can not satisfy biotechnology applications and scale operation by the rdsRP that prior art provides.

Recently think and can the rdsRP that can express mRNA in eukaryotic cell be developed, and these rdsRP also are used in eukaryotic cell or the tissue and express vaccine antigen, biological activity protein, immune modulator, sense-rna, and catalysis RNA (No. the 20040132678th, the U.S. Patent application of Hone is incorporated by reference in this text it at this and examines, and after this is 20040132678).20040132678 provide the extensive information about the rdsRP availability, have described pattern rdsRP, and have proposed to produce and use the method for described rdsRP.Yet 20040132678 do not provide the guidance of any startup with de novo synthesis mode synthetic rdsRP, do not provide about how to produce and separate the guidance that contains and duplicate the stable carrier bacterial strain of rdsRP yet.In an embodiment of 20040132678, proposed and can produce the method for rdsRP in batches by in carrying the bacterium transformant of plasmid, duplicating parental generation dsRP, can express the purpose recombinant fragment thus.Whether can not know clearly from this is open that these these rdsRP have four kinds of dsRNA fragments (that is, three kinds of wild-type fragments and recombinant fragment), perhaps whether these rdsRP have three kinds of dsRNA fragments, two kinds of wild-type fragments and recombinant fragment.In either case, all and unclear have much to the dependence of wild-type helper phage in order to breed rdsRP; Same unclear is how rdsRP to be separated with the dsRP of wild-type.In addition, 20040132678 do not provide concrete method to come stably recombinant fragment to be integrated within the dsRP yet, relate to very few to rdsRP subsequent duplicate and the stable concrete grammar for preparing.And 20040132678 do not provide the rdsRP composition that lacks wild-type fragment-M and fragment-S simultaneously yet.Finally, 20040132678 do not provide the packaging strains of expression fragment-L and generation procapsid yet, and the consequent bacterial strain that can start rdsRP and the stable resRP of generation with the de novo synthesis method.

Therefore, 20040132678 do not provide enough information to make those skilled in the art produce packaging strains and stably produce rdsRP.And 20040132678 also do not discuss or advise new rdsRN composition, or packaging strains, or import and stable preparation and use the method for rdsRN, and these themes of the present invention just.

Summary of the invention

As described herein, reorganization double-stranded RNA nucleocapsid (rdsRN) comprises the dsRNA fragment of at least a encoding function diplornavirus or bacteriophage nucleocapsid protein, and one or more reorganization dsRNA fragments that include at least a gene of encoding function product at least, described functional product (has for example remedied the host, bacterium) selectivity performance sudden change in the cell, auxotrophic mutation for example, the synthetic sudden change of cell walls, or prevent the sudden change of more than freezing temp, growing.Preferably, described dsRN fragment includes RNA, its coding purpose heterologous gene, immunogen for example, have or do not have adjuvant, it can allow the present invention is used for causing immunoreactive vaccine, although be not limited in this function by the function of the mRNA that this rdsRN produced.The RNA that the is produced adjuvant of can encoding thus, immune modulator, human cytokines, the other biological activated protein, perhaps described RNA itself is functionating with regard to can be used as siRNA or catalysis RNA.Compare with rdsRP, the benefit of rdsRN is stability and operability and security or the like.RdsRN is contained in the bacterial packaging strains that contains the sudden change of selectivity phenotype, thereby allows in described bacterial packaging strains rdsRN to be selected and keep.

Exemplary of the present invention has been described in Fig. 1-3.In each width of cloth figure of Fig. 1-3,10 represent bacterial cell; The genomic dna of the described bacterial cell 10 of 20 representatives; 30 represent nucleocapsid (comprising the albumen with packing activity and rna polymerase activity); 31 (at three wavy lines within the nucleocapsid 30) are then represented the dsRNA that is contained within the nucleocapsid 30.Similarly, in each width of cloth figure of Fig. 1-3, the selectivity performance type sudden change of 21 representatives within genomic dna 20.

As what in each width of cloth figure of Fig. 1-3, can see, two kinds of elements, 40 and 41, all relevant with dsRNA 30 all the time.40 representative codings remedy the nucleotide sequence of the gene product of selectivity performance type sudden change 21, and the nucleotide sequence of 41 representative coding purpose RNA.

The third element, 42, also can in each width of cloth figure of Fig. 1-3, find, but its position is different.42 representative coding nucleocapsids produce the nucleotide sequence (for example, coding has the active and proteic gene of rna polymerase activity of packing) of institute's indispensable gene.Figure 1 shows that one embodiment of the invention, wherein nucleotide sequence 42 is positioned in the dsRNA sequence 31 of nucleocapsid 30 inside.In other embodiments of the present invention, as shown in Figure 2, nucleotide sequence 42 is positioned in the bacterial genomes DNA 20.In yet another embodiment of the present invention, as shown in Figure 3, bacterial cell 10 also can contain plasmid (70), and nucleotide sequence 42 is positioned on plasmid 70.

An object of the present invention is to provide bacterial packaging strains, in described bacterial strain, contain the sequence of coding dsRP procapsid, and expression is remedied the sudden change that the rdsRN of the functioning gene that suddenlys change in the described bacterial strain selects and keeps.In one embodiment, provide to be applicable to packing, the bacterial isolates of preparation and/or delivery of gene or RNA, described bacterial strain contain the genomic dna that a) contains at least a selectivity phenotype sudden change; B) have RNA packing and proteic one or more nucleocapsids of rna polymerase activity; C) the dsRNA sequence that contains in described one or more nucleocapsid inside, described dsRNA sequence encoding be at least: i) remedy the gene product of described at least a selectivity phenotype sudden change, and ii) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence; And d) coding produces the nucleotide sequence of nucleocapsid institute indispensable gene.

Another purpose of the present invention provides the method that produces rdsRN, wherein imports the recombinant RNA fragment in bacterial packaging strains, forms the reorganization nucleocapsid that contains the eukaryotic translation expression cassette thereby pack, and the mode with de novo synthesis starts rdsRN thus.

Another purpose of the present invention provides can stablize the rdsRN that duplicates in bacterial isolates.In one embodiment, reorganization double-stranded RNA nucleocapsid (rdsRN) comprises the albumen that a) has RNA packing and rna polymerase activity, and b) dsRNA sequence, it is encoded at least: i) gene product, and ii) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

A further object of the present invention provides such bacterial isolates, and it can stablize generation rdsRN, and described rdsRN contains positive allelic rdsRNA fragment and the functional eukaryotic translation expression cassette selected of one or more codings.

Another object of the present invention provides such bacterial isolates, it can stablize generation rdsRN, and described rdsRN carries α expressing viral box, for example, but be not limited only to Xi Menli gram forest virus (Semliki forest virus) (Berglund etc., Vaccine 17:497; 1999) or Venezuelan equine encephalitis (Venezuelan equine encephalitis (being appointed as " VEE " in this article)) virus (Davis etc., J Virol 70:3781; 1996); (Caley etc., J Virol71:3031; 1997).

Another object of the present invention provides to eukaryotic cell and the method for organizing administration rdsRN, and rdsRN induction of immunity in the target cell monoid reacts or cause the purposes of biological effect.

Another object of the present invention provides the bacteria carrier alive that can pack rdsRN.

Another purpose of the present invention provide can stable maintenance rdsRN the activated bacterial carrier.

Another purpose of the present invention provides the rdsRN that can duplicate in the bacteria carrier bacterial strain.

A further object of the present invention provides to mammalian cell and organizes the method for sending rdsRN.

Another object of the present invention provides the method that the bacteria carrier induction of immunity in target cell or tissue that uses the described rdsRN of carrying reacts or cause biological effect.

By the selectivity performance type sudden change that host cell of the present invention contained, in preferred embodiments, be non-response selectivity performance type sudden change.

Another purpose of the present invention provides the electroporation medium that contains described bacterium and/or described dsRN.In another embodiment, the various RNA of fluoridizing of coding dsRNA composition are provided.

These and other purposes of the present invention can become apparent because of the detailed description that is provided in this specification sheets.Shown in exemplary embodiment, it has described the bacterial packaging strains that contains coding dsRP phi-8 fragment-L sequence, and described sequence can be expressed procapsid and contain the asd sudden change that can select the rdsRN of expressive function asd gene in described bacterial strain and keep in described bacterial strain.In addition, also described the prototype rdsRN of encoding vaccine antigens and report thing, proved that also described rdsRN can influence the ability of coded antigen and the expression of report thing in the Mammals environment.

The detailed description of accompanying drawing

Fig. 1 is the synoptic diagram that contains the bacterial cell of nucleocapsid, and wherein the nucleotide sequence of coding generation nucleocapsid institute indispensable gene is arranged in the dsRNA sequence of nucleocapsid.

Fig. 2 is the synoptic diagram that contains the bacterial cell of nucleocapsid, and wherein the nucleotide sequence of coding generation nucleocapsid institute indispensable gene is arranged in the genomic dna of described cell.

Fig. 3 is the synoptic diagram that contains the bacterial cell of nucleocapsid, and wherein the nucleotide sequence of coding generation nucleocapsid institute indispensable gene is arranged in plasmid.

Figure 4 shows that the expression cassette (being respectively rS, rS2 and rM) of various phi-8 recombinant fragment-S and fragment-M.As described in embodiment part hereinafter, positive select allelotrope be asd gene and described goal gene coding be candidate's Mycobacterium tuberculosis (Mycobacterium tuberculosis) antigen and Hc-red fluorescent protein.RS and rS2 are cloned into the PstI site of pT7/T3-18.By importing pcDNA3.1 as the segmental rM of KpnI/PstI _ZEOCorresponding site to cloning.Whole recombinant fragments are positioned over transcribing under the control of T7 promotor.

Figure 5 shows that the rS expression cassette that contains α virus (Semliki Forest Virus) oneself's amplification replicon (nsp1-4 and replicative enzyme binding sequence).

Figure 6 shows that bacterial packaging strains is grown and the synoptic diagram of function.

Figure 7 shows that the invasive feature of described packaging strains and parent strain.

Figure 8 shows that the hybridization trace of before and after sex change, the full cell pyrolysis liquid of S.flexneri MPC51pLM2653 being surveyed with the procapsid specific antisera, shown the interior assembling of body of procapsid.

Figure 9 shows that the electron photomicrograph of S.flexneri MPC51pLM2653, shown the procapsid of assembling.

Figure 10 shows that the RT-PCT of the S.flexneriMPC51pLM2653 of the packing that contains rdsRN appointment LSMtb4, shown the existence of second chain synthetic (-) chain and (+) cDNA.

Figure 11 shows that the electron photomicrograph of the S.flexneriMPC51pLM2653 that contains self-replacation nucleocapsid LSMtb4.

Figure 12 shows that the electron photomicrograph of the pseudomonas syringae (Pseudomonas syringae) that contains wild-type bacterium phage phi-8, it is to adopt to contain encoding wild type fragment-S ,-M and-RNA of L carries out rebuilding after the electroporation to described bacterial strain.

Figure 13 shows that after the S.flexneriMPC51 that employing contains the rdsRN of called after LSMtb4 invades HeLa cell 14 hours and to have shown that with the fluorescence micrograph of the special antiserum(antisera) detection of antigen 85A antigen 85A is by eukaryotic cell expression.

Figure 14 shows that the fluorescence micrograph after the S.flexneriMPC51 that employing contains the rdsRN of called after LSMHc-Red invades HeLa cell 12 hours, shown in described eukaryotic cell and translated out the proteic direct fluorescence of Hc-Red from mRNA that LSMHc-Red produces.

Figure 15 shows that after the S.flexneriMPC51 that employing contains the rdsRN of called after LSMHc-Red invades HeLa cell 12 hours and to have shown the proteic expression of Hc-Red in the eukaryotic cell with the fluorescence micrograph of Hc-Red specific antisera detection.

The detailed description of the preferred embodiment of the invention

1, the structure of bacterial packaging strains

The invention provides such bacterial packaging strains, it contains can encode in described bacterial strain and expressive function double-stranded RNA phage/proteic dna sequence dna of virus (dsRP) procapsid, thereby allows the assembling of procapsid and the packing of dsRNA to form double-stranded RNA nucleocapsid (dsRN) in described packaging strains.In addition, thus can carry out genetically engineered containing to dsRNA and can encode and express for example genetically modified sequence of purpose functional gene.Described dsRNA becomes reorganization dsRNA (rdsRNA) thus, and nucleocapsid becomes reorganization dsRN (rdsRN).Packaging strains also contains the genetic mutation that can make up selectivity, the defective that causes death in described bacterial strain.Thereby can carry out genetically engineered coding and express the functioning gene that remedies by selectivity defective that described sudden change causes rdsRN, make thus and can within described bacterial packaging strains, rdsRN be selected and keep.

Following dsRNA phage element all is included within the rdsRN: fragment-L; Fragment-Spac sequence; The rna polymerase recognition sequence that fragment-S RNA relies on; Fragment-M pac sequence; The rna polymerase recognition sequence that fragment-M RNA relies on.Can the positive be selected the genetically engineered importing of allelotrope phage by hereinafter described: can select allelotrope to be connected to the positive, for example, gene on fragment-S-8 ribosome bind site, perhaps 0 ribosome bind site of the gene-1 on fragment-M, or the two all can.Can be by replace producing nonessential S of functional dsRN and M segment area other goal gene of genetically engineered importing in S and/or M fragment.Perhaps, S and M fragment can be removed fully and replace with aim sequence.In this article, " recombinant fragment " is meant genetically engineered S and/or M fragment, or replaced described S and/or the segmental aim sequence of M.

Though can use arbitrarily double-stranded RNA phage or virus to make system as herein described work, still preferably utilize the virus genomic following unit of capsule functionating usually in the exemplary phi-8 rdsRN system described in the embodiment part:

Fragment-L and on full gene,

Fragment-S and-the pac sequence of M,

Fragment-S and-3 ' the terminal polysaccharase binding sequence of M,

4. the gene 8 of fragment-S.

In phi-8 embodiment, be not that rdsRN system functionating is necessary, fragment-S and-whole encoding sequences on the M are all lacked, except gene 8.In addition, can comprise in recombinant fragment that other express the exogenous array of the essential or hope of goal gene institute, for example in eucaryon and prokaryotic organism, start the IRES element of translation respectively, Kozak and Shine-Dalgaro sequence, polyadenylation sequence, promoter sequence, enhanser, transcription terminator, leader peptide sequence, and the molecular label of protein purification, for example His label.

According to enforcement of the present invention, the mode that can dye the vivoexpression carrier or be integrated into bacterial chromosome imports bacterial packaging strains with fragment-L, and by electroporation recombinant fragment is imported in the bacterial packaging strains, as the following detailed description.

In the present invention, the bacterial isolates that therefrom obtains packaging strains is not most important, it includes but not limited to: Campylobacter subspecies (Campylobacter spp), Neisseria subspecies (Neisseriaspp), influenzae subspecies (Haemophilus spp), Aeromonas subspecies (Aeromonas spp), Francisella subspecies (Francisella spp), Yersinia subspecies (Yersinia spp), klebsiella spp subspecies (Klebsiella spp), bordetella subspecies (Bordetella spp), Legionnella subspecies (Legionella spp), coryneform bacteria subspecies (Corynebacterium spp), citric acid bacterium subspecies (Citrobacter spp), chlamydozoan (Chlamydia spp), brucella subspecies (Brucellaspp), pseudomonas subspecies (Pseudomonas spp), Helicobacter pylori subspecies (Helicobacter spp) or vibrios subspecies (Vibrio spp).

Applied specific curvature bacillus strain is not most important for the purpose of the present invention.The example that can be applicable to Campylobacter bacterial strain of the present invention includes but not limited to: campylobacter jejuni (C.jejuni) (ATCC Nos.43436,43437,43438), campylobacter hyointestinalis (C.hyointestinalis) (ATCC No.35217), campylobacter fetus (C.fetus) (ATCC No.19438) campylobacter fecalis (C.fecalis) (ATCC No.33709), C.doylei (ATCC No.49349) and large intestine Campylobacter (C.coli) (ATCC Nos.33559,43133).

Applied specific Yersinia bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Yersinia bacterial strain of the present invention comprises: yersinia entero-colitica (Y.enterocolitica) (ATCC No.9610) or Yersinia pestis (Y.pestis) (ATCC No.19428), yersinia entero-colitica (Y.enterocolitica) Ye03-R2 (al-Hendy etc., Infect.Immun., 60:870; 1992) or yersinia entero-colitica (Y.enterocolitica) aroA (O ' Gaora etc., Micro.Path., 9:105; 1990).

Applied specific klebsiella spp bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to klebsiella spp bacterial strain of the present invention comprises klebsiella pneumoniae (K.pneumoniae) (ATCC No.13884).

Applied specific bordetella bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to bordetella bacterial strain of the present invention comprises bordetella pertussis (B.pertussis), segmental bronchus sepsis Bordetella (B.bronchiseptica) (ATCC No.19395).

Applied specific Neisseria bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Neisseria bacterial strain of the present invention comprises that neisseria meningitidis (N.meningitidis) (ATCCNo.13077) and Diplococcus gonorrhoeae (N.gonorrhoeae) (ATCC No.19424), Diplococcus gonorrhoeae (N.gonorrhoeae), MS11 aro mutant (Chamberlain etc., Micro.Path., 15:51-63; 1993).

Applied specific Aeromonas bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Aeromonas bacterial strain of the present invention comprises A.salminocida (ATCC No.33658), A.schuberii (ATCC No.43700), Aeromonas hydrophila (A.hydrophila), A.eucrenophila (ATCC No.23309).

Applied specific Mark Lewis-Francis bacteria strain is not most important for the purpose of the present invention.The example that can be applicable to Mark Lewis-Francis bacteria strain of the present invention comprises that soil draws hot Francisella (F.tularensis) (ATCC No.15482).

Applied specific corynebacterium strain is not most important for the purpose of the present invention.The example that can be applicable to corynebacterium strain of the present invention comprises Corynebacterium pseudotuberculosis (C.pseudotuberculosis) (ATCC No.19410).

Applied specific citric acid bacterium bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to citric acid bacterium bacterial strain of the present invention comprises Fu Luoyindeshi citric acid fungus (C.freundii) (ATCC No.8090).

Applied specific chlamydozoan bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to chlamydozoan bacterial strain of the present invention comprises Chlamydia pneumoniae (C.pneumoniae) (ATCC No.VR1310).

Applied specific influenzae bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to influenzae bacterial strain of the present invention comprises hemophilus influenzae (H.influenzae) (Lee etc., J.Biol.Chem.270:27151; 1995), Haemophilus somnus (H.somnus) (ATCCNo.43625).

Applied specific brucella bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to brucella bacterial strain of the present invention comprises Bacillus abortus (B.abortus) (ATCCNo.23448).

Applied specific Legionnella bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Legionnella bacterial strain of the present invention comprises pneumonia Legionnella (L.pneumophila) (ATCC No.33156), or pneumonia Legionnella (L.pneumophila) mip mutant (Ott, FEMS Micro.Rev., 14:161; 1994).

Applied specific pseudomonad strain is not most important for the purpose of the present invention.The example that can be applicable to pseudomonad strain of the present invention comprises Pseudomonas aeruginosa (P.aeruginosa) (ATCC No.23267).

Applied specific Helicobacter pylori bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Helicobacter pylori bacterial strain of the present invention comprises helicobacter pylori (H.pylori) (ATCC No.43504), ferret Helicobacter pylori (H.mustelae) (ATCC No.43772).

Applied specific vibrios bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to vibrios bacterial strain of the present invention comprises vibrio cholerae (Vibrio cholerae) (ATCC No.14035), Vibrio cincinnatiensis (Vibrio cincinnatiensis) (ATCC No.35912), vibrio cholerae (V.cholerae) RSI virulence mutant strain (Taylor et at, J.Infect.Dis., 170:1518-1523; 1994) and vibrio cholerae (V.cholerae) ctxA, ace, zot, cep mutant strain (Waldor Jetal, Infect Dis., 170:278-283; 1994).

In preferred embodiments, the bacterial isolates of Kai Fa generation packaging strains has comprised having and can be used as packaging strains and as the bacterium of vaccine carrier potentiality in the present invention, enterobacteria (Enterobacteriaceae) for example, include but not limited to escherich's bacillus subspecies (Escherichia spp.), shigella subspecies (Shigella spp.) and Salmonellas subspecies (Salmonella spp.).Can make up Gram-positive and acid proof packing and carrier bacterial strain similarly from listerisa monocytogenes in mjme (Listeria monocytogenes) or mycobacterium subspecies (Mycobacterium spp).

Applied specific Escherichia bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Escherichia bacterial strain of the present invention comprises intestinal bacteria (Escherichia coli) DH5 α, and HB 101, HS-4, and 4608-58,1184-68,53638-C-17,13-80 and 6-81 (referring to, for example Sambrook etc. is mentioned above; Grant etc., mentioned above; Sansonetti etc., Ann.Microbiol. (Inst.Pasteur), 132A:351; 1982), enterotoxication intestinal bacteria (referring to, for example, Evans etc., Infect.Immun., 12:656; 1975), enteropathogenic intestinal bacteria (referring to, for example, Donnenberg etc., J.Infect.Dis., 169:831; 1994), enteroinvasive E coli (referring to, for example, Small etc., Infect Immun., 55:1674; 1987) and enterohemorrhagic Escherichia coli (referring to, for example, McKee and O ' Brien, Infect.Immun., 63:2070; 1995).

Applied specific Salmonellas bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Salmonellas bacterial strain of the present invention comprise salmonella typhi (S.typhi) (referring to, for example, ATCC No.7251), Salmonella typhimurium (S.Typhimurium) (referring to, for example, ATCC No.13311), Salmonella gallinarum Salmonella galinarum (ATCC No.9184), Salmonella enteritidis Salmonella enteriditis (referring to, for example, ATCC No.4931) and Salmonella typhimurium (Salmonella Typhimurium) (referring to, for example, ATCC No.6994), salmonella typhi (S.typhi) aroC, the aroD double-mutant (referring to, for example, Hone etc., Vacc, 9:810-816; 1991), Salmonella typhimurium (S.Typhimurium) aroA mutant (referring to, for example, Mastroeni etc., Micro.Pathol., 13:477-491; 1992).

Applied specific shigella bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to shigella bacterial strain of the present invention comprises shigella flexneri (Shigella flexneri) (referring to, for example, ATCC No.29903), shigella flexneri (Shigella flexneri) CVD1203 (referring to, for example, Noriega etc., Infect.Immun.62:5168; 1994), shigella flexneri (Shigella flexneri) 15D (referring to, for example, Sizemore etc., Science 270:299; 1995), Shigella sonnei (Shigella sonnei) (referring to, for example, ATCC No.29930), and shigella dysenteriae (Shigella dysenteriae) (referring to, for example, ATCC No.13313).

Applied specific branch bacillus strain is not most important for the purpose of the present invention.The example that can be applicable to mycobacterium bacterial strain of the present invention comprise Mycobacterium tuberculosis (Mtuberculosis) CDC 1551 bacterial strains (referring to, for example, Griffith etc., Am.J.Respir.Crit.Care Med.Aug; 152 (2): 808; 1995), Mycobacterium tuberculosis (M tuberculosis) Beijing strain (Soolingen etc., 1995), H37Rv bacterial strain (ATCC#:25618), Mycobacterium tuberculosis (M tuberculosis) pantothenic acid auxotrophic strain (Sambandamurthy, Nat.Med.2002 8 (10): 1171; 2002), Mycobacterium tuberculosis (M tuberculosis) rpoV mutants which had (Collins etc., Proc Natl Acad Sci USA.92 (17): 8036; 1995), Mycobacterium tuberculosis (M tuberculosis) leucine auxotrophic strain (Hondalus etc., Infect.Immun.68 (5): 2888; 2000), BCG Denmark bacterial strain (ATCC#35733), BCG Japanese strain (ATCC#35737), BCG, Chicago bacterial strain (ATCC#27289), BCG copenhagen strain (ATCC#:27290), BCG pasteur bacterial strain (ATCC#:35734), BCGGlaxo bacterial strain (ATCC#:35741), BCG Connaught bacterial strain (ATCC#35745), BCG Montreal strain (ATCC#35746).

Applied specific listerisa monocytogenes in mjme (Listeria monocytogenes) bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to listerisa monocytogenes in mjme of the present invention (Listeria monocytogenes) bacterial strain (for example comprises listerisa monocytogenes in mjme (L.monocytogenes) bacterial strain 10403S, Stevens etc., J.Virol 78:8210-8218; 2004) or listerisa monocytogenes in mjme (L.monocytogenes) mutant strain, for example (i) actA plcB double-mutant (Peters etc., FEMS Immunology andMedical Microbiology 35:243-253; 2003); (Angelakopoulous etc., Infectand Immunity 70:3592-3601; 2002); (ii) for dal dat double-mutant (Thompson etc., the Infect andImmunity 66:3552-3561 of alanine racemase gene and D-amino acid transaminase gene; 1998).

In that selected can be as after packaging strains parent's the bacterial strain, thereby can carry out the genetically engineered dna sequence dna of expressing the dsRP procapsid that imports to described bacterial strain to described bacterial strain, and importing the sudden change that rdsRN selects and keeps, this rdsRN can express the functioning gene that remedies sudden change in the described bacterial strain.

Usually, the genes encoding in fragment-L be to produce to have the necessary albumen of complete functional procapsid, comprise the protein gene 8 of the shell of encoding.Yet for the phi-8 phage, gene 8 is positioned on the fragment S, and gene 8 products are not essential by the assembling of phi-8 procapsid yet, and the effective self-replacation of phi-8 nucleocapsid needs functional gene 8 products.Therefore, when using the phi-8 phage when enforcement is of the present invention when, the gene 8 of fragment S can be preferably incorporated in the construct.For other phages, gene 8 activity are encoded on fragment L, and the ability of therefore expressing fragment-L mRNA is enough to produce functional nucleocapsid.The specific dsRP that obtains fragment-L is not most important to the present invention, and it includes but not limited to Phi-6 fragment L (Genbank accession number M17461), Phi-13 fragment-L (Genbank accession number AF261668), or Phi-8 fragment-L (Genbank accession number AF226851), and can be from the New York, the New York, publilc health research institute, doctor L.Mindich of department of microbiology obtains there.

Perhaps, can use Applied Biosystems ABI ^TM3900 high-throughput dna synthesizers (Foster City, CA 94404 U.S.A.) produce the cDNA sequence of encode fragment-L synthetically, and its method is provided by manufacturers.For synthetic fragment-L and recombinant fragment-S and/or-the cDNA copy of M, can produce a series of part fragments of described full length sequence and use method well known in the art to connect formation full length fragment (Ausubel etc. by PCR, mentioned above, 1990).In brief, use automatization dna synthesizer (for example, Applied BiosystemsABI ^TM3900 high-throughput dna synthesizers (Foster City, CA 94404 U.S.A.)) preparation length is the synthetic oligonucleotide (that is, be preferably its 5 ' and 3 ' end hold with 5 ' and 3 ' of coding flanking sequence oligonucleotide be complementary) of 100-200 Nucleotide.Use identical method, can synthesize the complementary oligonucleotide, thereby and form double chain oligonucleotide with complementary counterpart annealing.Can be by connecting double chain oligonucleotide to (that is those flanking sequences of encoding) thereby in conjunction with forming bigger fragment.Can carry out purifying by these big fragments of agarose gel electrophoresis team, and use the gel-purified test kit separate (for example, The QIAEX  II Gel Extraction System, Qiagen, Santa Cruz, CA, Cat.No.12385).Repeat this program up to constructing the full length DNA molecule.After each takes turns connection, thereby can improve productive rate by these fragments of pcr amplification.Method with the de novo synthesis gene construct is a technology well known in the art, and the existing description in the elsewhere (Andre etc., mentioned above, 1998); (Haas etc., mentioned above, 1996); Perhaps, can from, for example, (Midland TX) buys the synthetic gene to Midland Certified Reagent Co. commercially.

Though the detailed description of the invention application of unaltered fragment-L sequence, but those skilled in the art be it is evident that, can cause the brachymemma of described sequence or the modification of sudden change derivative can't prevent the formation of functional procapsid, thereby can state under the condition that the invention is intended to and use not departing from this.

The specific promotor that is used to express fragment-L is not very important for the purpose of the present invention, and it can be any promotor that works in the target bacterial strain, for example but be not limited only to inducible promoter, and P for example _BAD(Genbank accession number X81838) and P _PagC(Genbank accession number M55546) or constitutive promoter be P for example _Lpp(Genbank accession number V00302) and P _OmpA(Genbank accession number X02006).

(for example can use technology well known in the art, PCR, the DNA purifying, digestion with restriction enzyme, agarose gel electrophoresis, connect) at expression vector, for example among the pT7/T3-18 (Ambion, Austin, TX5 Cat.No.7201), fragment-L is imported described packaging strains, or be integrated in the karyomit(e) by the allelotrope exchange.The position of chromosomal integration is unimportant to the present invention, although in preferred embodiments, thereby the DNA of encode fragment-L expression cassette is integrated into karyomit(e) inactivation gene and (has for example produced optionally phenotype under the culture condition that limits, aroA (Genbank accession number X00557), aroC (Genbank accession number AY142231), leuD (Genbank accession number L06666) asd (Genbank accession number V00262), murI (Genbank accession number AY520970) kdsA (Genbank accession number AY174101), and htrB (Genbank accession number AF401529).The program of chromosomal integration and the method for cultivating described mutant all are documented (Hamilton etc., J.Bacteriol.171:4617; 1989); (Blomfield etc., MoI.Microbiol.5:1447; 1991).

The specific sudden change that is imported into packaging strains is not most important to the present invention, it can be to limit any sudden change that produces selectivity performance type under the culture condition, for example but be not limited only to auxotrophic mutation, aroA (Genbank accession number X00557) for example, aroC (Genbank accession number AY142231), leuD (Genbank accession number L06666) or pair cell wall are blended into the sudden change of closing important gene, for example asd (Genbank accession number V00262) or murI (Genbank accession number AY520970), or prevent to be higher than the sudden change of 32 ℃ of growths, for example htrB (Genbank accession number AF401529) in temperature.

Can use the genetic technique of any known in bacterium, to import sudden change.These technology include but are not limited to, use chemical reagent such as N-methyl-N '-nitro-N-nitrosoguanidine, acridine orange, ethidium bromide, or non-lethality is exposed to non-specific mutagenesis (Miller (Ed), 1991 of UV-light, In:A short course in bacterial genetics, Cold Spring Harbor Press, ColdSpring Harbor, NY).Perhaps, can use the standard genetic technique to introduce sudden change, for example Tn10 mutagenesis, the bacteriophage mediated by protein transduction, the allelotrope exchange of lambda particles phage mediation, or conjugal transfer (Miller (Ed), mentioned above, 1991); (Hone, etc., J.Infect.Dis.156:167; 1987); (Noriega, etc., Infect.Immun., 62:5168; 1994); (Hone, etc., Vaccine, 9:810; 1991); (Chatfield, etc., Vaccine 10:53; 1992); (Pickard, etc., Infect.Immun., 62:3984; 1994); (Odegaard, etc., J BiolChem 272:19688; 1997); (Lee, etc., J.Biol.Chem., 270:27151; 1995); (Garrett, etc., J.Biol.Chem., 273:12457; 1998).Sudden change can be point mutation, and codon is replaced, perhaps, preferably, non-response deletion mutantion.Deletion mutantion can be the disappearance of single base mutation until whole encoding sequences.In extensive sudden change, the advantage of deletion mutantion is that these sudden changes make described product have better stability.

Sudden change can be a constitutive expression, or at inducible promoters, for example promotor of temperature sensitivity heat-shocked family, or anaerobic induction nirB promotor (Harborne etc., MoI.Micro., 6:2805; 1992) but or repressible promoter, for example uapA (Gorfinkiel etc., J.Biol.Chem., 268:23376; 1993) or gcv (Stauffer etc., J.Bact, 176:6159; 1994) control under.The selection that proper method is learned depends on the target bacterial strain and is known by those skilled in the art.

For the stable growth that contains the bacteria carrier bacterial strain of rdsRN, specific culture condition is not most important to the present invention.For illustrative purpose, mutant can be grown in the liquid nutrient medium, for example TS substratum (Difco, Detroit, MI, Cat.No.244620), nutrient broth (Difco, Detroit, MI, Cat.No.233000), trypticase soya broth (Difco, Detroit, MI Cat.No.211822), uses the conventional cultivation technique (Miller that is suitable for the bacterial isolates growth, mentioned above, 1991) cultivate.Perhaps, bacterium also can be cultivated on solid medium, for example nutrient agar medium (Difco, Detroit, MI, Cat.No.212000), and tryptic soy agar (Difco, Detroit, MI, Cat.No.236920), or the basic agar of M9 (Difco, Detroit, M, Cat.No.248510).

Mycobacterium vaccine carrier strain culturing is in liquid nutrient medium, and for example (MI Cat.No.271310) or in the Saulton synthetic medium, is preferably at 37 ℃ Middlebrook7H9 for Difco, Detroit.Bacterial strain can maintain static or wave and culture.In addition, can be by adding oleic acid (0.06% v/v; Research Diagnostics Cat.No.01257) with such as Tyloxapol (0.05% v/v; Research Diagnostics Cat.No.70400) stain remover strengthens the growth velocity of mycobacterium.Can by equably with pure mycobacterium culture serial dilution in phosphate-buffered saline (being referred to herein as PBS) of 100 μ l measured quantities (for example, with 10 times of dilution methods from being diluted to 10 from pure growth ^-8) to containing the 25-30ml solid medium, for example (MD is on 3.5 inches culture plates Cat.No.221174) for BD Microbiology, Cockeyesville for Middlebrook 7H10.

Optical density(OD) under the 600nm of results bacterium is not most important, and it can and depend on the concrete bacterial strain that is adopted, substratum and culture condition from 0.1-5.0.

2.rdsRNA segmental structure

As what emphasized before, United States Patent (USP) 20040132678 depends on the generation that helper phage (that is wild-type dsRP) starts rdsRP.Under these conditions, 20040132678 provide method to produce the resRP that contains wild-type fragment-S or wild-type fragment-M.Even fragment-S and-contain the cracking function of dsRP among the M, but can not know whether these configurations can keep stablizing in mass preparation.Same unclear is how this method can be separated wild-type dsRP from rdsRP.In addition, 20040132678 do not provide as de novo synthesis mode how and start rdsRP, and how to produce and separate any guidance that contains and duplicate the stable carrier bacterial strain of rdsRN.On the contrary, the present invention is relevant with the stable preparation of rdsRN.

Usually, high viral genome size variation to about 10% can tolerate, and it makes in recombinant viral vector genome size have handiness (Domingo andHolland, Annu.Rev.Microbiol.51:151 to a certain degree; 1997).In enforcement of the present invention, among the rdsRN size of rdsRNA equal fragment-S-M and-summation of L adds or deducts about 10%.For this point is described, can use phi-8 as example.The genome size of phi-8 is 14,984bp, and therefore, for the stable rdsRN of expression phi-8 fragment-L of producing in packaging strains, in such rdsRN, the size of recombinant fragment is about 7933 ± 1500bp.

As mentioned below, this rule is not strict being suitable for because might from the phi-8 that only contains a fragment-L and a 4.5kb rdsRNA fragment-S, obtain rdsRN (Sun etc., Virology, 308:354; 2003).This explanation rdsRN can have amazing genome handiness.In above example, recombinant fragment-S comprises the sequence that is obtained from wild-type fragment-S and wild-type fragment-M.In this specific character property example, " deriving from " (for example " deriving from wild-type fragment-S ") is meant that the sequence that is present in this reorganization rdsRNA construct derives from the genome sequence of wild type phage and resets in proper order according to its wild type gene or coding characteristic.Can increase to these sequences and clone by RT-PCR, or carry out chemosynthesis according to the known array that in wild type phage, occurs from wild type phage.

Such composition can also be provided, and the genome size that it contained approaches wild type gene group size.In a method, can produce recombinant fragment-S that size is 7933 ± 1500bp.The utilization of another kind method be two kinds of rdsRNA fragments, a kind of fragment-S packaging sequence another kind that contains then contains fragment-M packaging sequence, wherein total size of recombinant fragment is 7933 ± 1500bp (Fig. 4).In two kinds of methods, have at least a kind of fragment to contain the positive allelotrope of selecting, meanwhile there are one or both recombinant fragments to carry the eukaryotic expression box.

In preferred embodiments, for example, can the segmental composition of rdsRNA be assembled by following cDNA and dna sequence dna are combined, (Fig. 4):

RdsRNA fragment-S:

1. φ-8 fragments-S sequence and gene 8 (Hoogstraten etc., mentioned above, 2000).

2. the positive that is connected in wild-type fragment-S gene 8 orf ribosome bind sites is selected allelotrope.What gene 8 was encoded is membranin, and it can keep linking to each other and be first open reading frame of wild-type fragment-S with nucleocapsid.

3. have HpaI at IRES sequence 3 ' end, EcoRI, the IRES sequence in SalI and NotI restriction enzyme (RE) site, thereby HpaI (blunt ends RE) provides the ATG initiator codon that functionally is connected in IRES

4. ox polyadenylation sequence (derives from pcDNA3.1 (Invitrogen, Carlsbad, CA, Cat.No.V860-20))

5. the rna polymerase recognition sequence that relies on of φ-8 fragments-S RNA (Hoogstraten etc., mentioned above, 2000)

RdsRNA fragment-M:

6. φ-8 fragments-M sequence and gene 8 (Hoogstraten etc., mentioned above, 2000).

7. the positive that is connected in gene 10 ribosome bind sites is selected allelotrope.Gene 10 is first open reading form of wild-type fragment-M and the membranin of coding φ-8.

8. have HpaI at IRES sequence 3 ' end, EcoRI, the IRES sequence in SalI and NotI restriction enzyme (RE) site, thereby HpaI (blunt ends RE) provides the ATG initiator codon that functionally is connected in IRES

9. ox polyadenylation sequence (derives from pcDNA3.1 (Invitrogen, Carlsbad, CA, Cat.No.V860-20))

10. the rna polymerase recognition sequence that relies on of φ-8 fragments-M RNA (Hoogstraten etc., mentioned above, 2000)

Though do not wish in theory scope to be limited to some extent, but when the size of fooled rdsRNA fragment-S is greater than 7900 ± 1500bp to a great extent, rdsRNA fragment-M is just no longer packaged, thereby because can induce the conformational change in the procapsid can discern and hold fragment-L greater than rdsRNA fragment-S of 7900 ± 1500bp, having produced the genome size thus is the rdsRN of wild type gene group size ± 10%.

Can use Applied Biosystems ABI ^TM3900 high-throughput dna synthesizers (FosterCity, CA) and the synthetic coding rdsRNA cDNA fragment sequence that produces of the method that provides of manufacturers.CDNA copy for synthetic fragment-L and recombinant fragment can produce a series of full length sequence fragment by PCR, and uses method well known in the art to connect formation full length fragment (Ausubel etc., mentioned above, 1990).In brief, can use automatization dna synthesizer (for example, Applied Biosystems ABI ^TM3900 high-throughput dna synthesizers (Foster City, CA 94404 U.S.A.)) preparation length is the synthetic property oligonucleotide (that is, be preferably its 5 ' and 3 ' end hold with 5 ' and 3 ' of coding flanking sequence oligonucleotide be complementary) of 100-200 Nucleotide.Use identical method, can synthesize the complementary oligonucleotide, thereby and form double chain oligonucleotide with complementary counterpart annealing.Can be by connecting double chain oligonucleotide to (that is those flanking sequences of encoding) thereby in conjunction with forming bigger fragment.Can carry out purifying by these big fragments of agarose gel electrophoresis team, and use the gel-purified test kit separate (for example, TheQIAEX  II Gel Extraction System, Qiagen, Santa Cruz, CA, Cat.No.12385).Repeat this program up to constructing the full length DNA molecule.After each takes turns connection, thereby can improve productive rate by these fragments of pcr amplification.Method with the de novo synthesis gene construct is a technology well known in the art, and the existing description in the elsewhere (Andre etc., mentioned above, 1998); (Haas etc., mentioned above, 1996); Perhaps, can from, for example, (Midland TX) buys synthetic gene to Midland Certified Reagent Co. commercially.

The positive allelotrope of selecting

Being integrated into the segmental specific positive selection allelotrope of rdsRNA is not most important for the purpose of the present invention, and can be any allelotrope that in packaging strains, can recover the negative sudden change of dominance again, for example but be not limited only to remedy the gene of auxotrophic mutation, aroA (Genbank accession number X00557) for example, aroC (Genbank accession number AY142231), leuD (Genbank accession number L06666), or remedy the pair cell wall and be blended into the gene that closes the important gene sudden change, asd (Genbank accession number V00262) for example, or murI (Genbank accession number AY520970), or remedy the gene that pair cell divides most important transgenation, for example ftsZ (Genbank accession number AF401529).

The source of IRES sequence

The mRNA molecule that lacks 5 ' cap modifier is difficult to be translated in eukaryotic cell, and described 5 ' cap is added in the nuclear mRNA transcript usually in nucleus and strengthens rrna identification, unless have the IRES sequence in the upstream of goal gene.The specific IRES that is used for the present invention is not most important and can be selected from any commerce that contains the IRES sequence and can obtains carrier or be selected from arbitrarily obtainable uncrossed sequence.Therefore, the IRES sequence can extensively obtain, and can use 5 ' and 3 ' end to have specific primer to being positioned at nucleotide site 665-1251 IRES among the pIRES2-EGFP, by PCR from plasmid pIRES2-EGFP (Clontech, Palo Alto, CA Cat.No.63206) obtains commercially.The sequence of plasmid pIRES2-EGFP can obtain from manufacturers (referring to Www.clontech.com).Can also use (Novagen, Madison, WI5 Cat.No.69913 to plasmid pCITE4a; Also can be referring to United States Patent (USP) the 4th, 937, No. 190) in be positioned at the CITE of nucleotide site 16-518 5 ' and 3 ' end have specific primer, obtain similar IRES by PCR from plasmid pCITE4a (complete sequence of pCITE4a can obtain from the website that is arranged in novagen.com/docs/NDIS/69913-000.HTM), at plasmid pCITE4a-c; (United States Patent (USP) the 4th, 937, No. 190); PSLIRES11 (Accession:AF171227); PPV (Accession # Y07702); PSVIRES-N (Accession #:AJOOO1 56); (Creancier etc., J.Cell Biol., 10:275-281; 2000); (Ramos and Martinez-Sala, RNA, 10:1374-1383; 1999); (Morgan etc., Nucleic Acids Res., 20:1293-1299; 1992); (Tsukiyama-Kohara etc., J.Virol., 66:1476-1483; 1992); (Jang andWimmer etc., Genes Dev., 4:1560-1572; 1990) obtain similar IRES, or in bicistronic mRNA retrovirus vector (Accession #:D88622); Or be found in and eukaryoticly for example be applicable to the fibroblast growth factor 2IRES that rigorous type tissue specificity regulates (Creancier, etc., mentioned above, 2000) or be directed to Mitochondrial H ⁺Internal ribosome entry site (Izquierdo andCuezva, Biochem.J., the 346:849 of-atp synthase β subunit mRNA 3 '-non-translational region; 2000) find similar IRES in.Owing in HCV IRES, do not have IP, can be with plasmid pIRES-G (Hobbs, S.M.CRC Centre forCancer Therapeutics, Institute of Cancer Research, Block F, 15, CotswoldRoad, Belmont, Sutton, Surrey SM2 5NG, UK) as the source of IRES, and the sequence of this plasmid is obtainable (Genebank accession number Y1 1034).

In addition, use the NCBI Nucleotide database that is positioned at ncbi.nlm.nih.gov to carry out the internet retrieval and can obtain 140 files that contain the IRES sequence with use search parameter " IRES not patent ".Finally, can use Applied Biosystems ABI ^TM3900 high-throughput dna synthesizers (Foster City, CA), the synthetic preparation of the program IRES cDNA that uses manufacturers to provide.For synthetic bigger IRES sequence, the IRES of 502bp among the pCITE4a for example forms full length sequence (Ausubel etc., mentioned above, 1990) thereby can produce a series of fragments and use method well known in the art to couple together by PCR.Also can use Applied BiosystemsABI ^TM(Foster City CA) prepares less IRES sequence, for example the 53bp IRES in hepatitis C virus (Genebank accession number 1KH6A) with program synthetic property ground in a round that manufacturers provides to 3900 high-throughput dna synthesizers.

Can insert the example of the purpose heterologous gene among the rdsRN

In the present invention, be imported into goal gene that the eukaryotic translation expression cassette the enters rdsRN immunogen of can encoding, thereby and therefore described resRN also can bring into play the function of vaccine and cause and be directed to immunogenic immune response.Immunogen can be former from the foreign immunologic of virus, bacterium and parasitics pathogenic agent, also can be endogenous immunogen, for example, but is not limited only to autoimmunization antigen or tumour antigen.Immunogen can be the native protein of total length, the chimeric fusion protein between the former and intrinsic protein of foreign immunologic, or stem from stand-in, individual chip or a plurality of fragment of virus, bacterium or parasitics pathogen immunogenic.

In this manual, " foreign immunologic is former " is meant not to be albumen or its part of normal expression in the receptor cell or tissue, for example, but is not limited only to, viral protein, bacterioprotein, parasitics albumen, cytokine, chemokine, immunomodulator or therapeutical agent.

" endogenous immunogen " is meant naturally occurring albumen or its part in the receptor cell or tissue, for example, but is not limited only to endogenous cell albumen, immunomodulator, or therapeutical agent.

Apoptosis is the necrocytosis of sequencing, with regard to its induce with consequence with regard to, far from each other with necrosis.The known apoptosis that contains exogenous antigen is aimed at these antigenic intensive cellular immunizatioies to stimulate.Sometimes be called as intersection-sensitization process (cross-priming) (Heath, W.R., et ah, Immunol Rev199:9 by containing the cellular immunization process that antigenic apoptosis causes; 2004, Gallucci, S.M et ah, Nature Biotechnology.5:1249; 1999, Albert, M.L et ah, Nature 392:86; 1988).Existing some apoptosis induced mechanism can cause the cell-mediated immunity of antigen-specific that raises.The caspase8 mediated Apoptosis has caused cellular immunization protection (Heath, W.R., et ah, the Immunol Rev199:9 of antigen-specific; 2004).The caspase8 expression that is caused in tenuigenin by rdsRN is a kind of effective means, and it can induce procedural necrocytosis in caused high-level exogenous antigen expression process by rdsRN, cause the cellular immunization of antigen-specific.Death receptor-5 (DR-5) also can be described as TRAIL-R2 (TRAIL acceptor 2) or TNFR-SF-10B (tumour necrosis factor-superfamily member 10B), it can mediate equally by caspase8 mediated Apoptosis (Sheridan, J.P., etc., Science 277:818; 1997).The apoptosis of reovirus virus induction is mediated by TRAOL-DR5, causes subsequently virus sweep (Clarke, P.S.et ah, J.Virol; 2000).The DR-5 that is caused by rdsRN expresses to induce for the antigen-specific cellular immunization that is directed to the rdsRN antigen expressed provides the intensive adjuvant effect.Thereby can also induce to connect by Fas and experience apoptosis expressing antigenic cell, it be intense stimulus (Chattergoon, M.A.et at, the Nat Biotechnology 18:974 of inducing antigen-specific cell immune response; 2000).Expressing the rdsRN of Fas or Fas tenuigenin structural domain/cd4 cell outer structure domain fusion protein can be apoptosis-induced and be directed to the antigenic antigen-specific cell immune response of being expressed by rdsRN.

Above-described enhancing by the caused cellular immunization of rdsRN mediated Apoptosis is not limited in the antigen by the specificity coding of rdsRN own, but has comprised any antigen in the cell of rdsRN expression specificity apoptosis mediators.For example,, will be possible to use the elimination of tumour and/or metastases so, reduce or prevention and induce the cellular immunity that is directed to important tumour antigen if rdsRN is delivered in the tumour cell of having induced apoptosis.

In another embodiment of the present invention, if rdsRN is delivered in inside tumor or other cells, these rdsRN can have or lack apoptosis-induced ability and have coding and produce the ability in the anti-source of external source, then can produce than the more intensive cell response of those cells, described exogenous antigen will produce strong cell immune response.These cell responses can produce immune-mediated tumor cell destruction, further crossed sensitization and induce and be directed to tumour or other important antigenic cellular immunities, remove subsequently, reduction or prophylaxis of tumours and/or metastases after.One of example of this exogenous antigen is exactly a HLA antigen, and itself and host cell HLA are different, can produce strong allos cell response.

Can be apoptosis-induced and send the antigenic reorganization of specific tumour rdsRN and can induce the strong antigen-specific cell response that is directed to these tumour antigens, be included in and need not described rdsRN is directly sent under the situation of tumour itself, break these antigenic tolerances, cause elimination, reduction or prophylaxis of tumours and/or metastases.

Apoptosis after dna damage or caspase9 can induce some antigenic tolerance (Hugues, S.E., et ah, Immunity 16:169; 2002).The tolerance induce to control or the prevention such as, but not limited to diabetes, rheumatic arthritis, Crohn's disease, the autoimmune disorder of inflammatory bowel and multiple sclerosis is most important.The generation of caspase9 or by rdsRN such as but be not limited only to the β pancreatic cell, the tolerance-induced albumen of other apoptosis mediations that produce in colorectal cell and the neurocyte can produce restrictive apoptosis, it can be induced in those cells and be directed to the tolerance with autoimmunization ability antigen target position, thus treatment or prevention autoimmune disease.To the evaluation that relates to the autoimmune response specific antigen can allow by rdsRN produce these antigens and caspase9 and can other can apoptosis-induced mediation the molecule of tolerance induce the tolerance that is directed to these autoimmunization target antigens, cause treating and/or preventing to these autoimmune diseases.

In other embodiments of the present invention, therefore, such rdsRN is provided, it is coded at least a gene in the tenuigenin of host cell, this genetic expression apoptosis promotes albumen, such as but not limited to Salmonellas SopE (Genbank accession number AAD54239, AAB51429 or AAC02071), Shigellae IpaB (Genbank accession number AAM89553 or AAM89536), caspase-8 (Genbank accession number AAD24962 or AAH06737) etc., and under condition, provide and effectively induce the method for procedural necrocytosis, thereby produced the cell-mediated immunizing power of high-level T that is directed to target antigen by described rdsRN antigen expressed.Perhaps, the rdsRN that can prepare at least a gene of encoding, it expresses DR-5, people DR-5 (Genbank accession # BAA33723) for example, simplexvirus-6 (HHV-6) DR-5 homologues (Genbank accession # CAA58423) etc. provide the intensive adjuvant effect thereby induce for the antigen-specific cellular immunity that is directed to target antigen.

In other words or in addition, can be by encode immunogen and use conventional recombinant DNA method to make up immunogen (referring to above) of synthetic gene.

Foreign immunologic former can any virus, bacterium or parasitics pathogenic agent enter the animal host, in the animal host colony or duplicate before or any molecule of expressing by virus, bacterium or parasitics pathogenic agent in the process; Described rdsRN can express immunogen or its part that is derived from virus, bacterium and parasitics pathogenic agent.These pathogenic agent can infect the mankind, domestic animal or wild animal host.

The viral pathogens that therefrom can produce virus antigen includes, but are not limited to orthomyxovirus, for example influenza virus (classification ID:59771; Retrovirus, RSV for example, HTLV-1 (classification ID:39015), and HTLV-II (classification ID:11909), papilloma virus, HPV (classification ID:337043) for example, simplexvirus, for example EBV classification ID:10295); CMV (classification ID:10358) or hsv (ATCC #:VR-1487); Slow virus, for example HIV-1 (classification ID:12721) and HTV-2 classification ID:11709); Rhabdovirus, for example rabies virus; Picornavirus, for example poliovirus (classification ID:12080); Poxvirus, for example vaccinia virus (classification ID:10245); Rotavirus (classification ID:10912); And parvovirus, for example adeno-associated virus 1 (classification ID:85106).

The example of virus antigen can find in following group, and it includes but not limited to human immune deficiency venereal disease poison antigen Nef (National Institute of Allergy and Infectious Disease HTVRepository Cat.# 183; Genbank accession # AF238278), Gag, Env (National Institute of Allergy and Infectious Disease HTV RepositoryCat.# 2433; Genbank accession # U39362), Tat (National Institute ofAllergy and Infectious Disease HIV Repository Cat.# 827; Genbankaccession # M1 3137), Tat mutant derivative, for example Tat-Δ 31-45 (Agwale etc., Proc.Natl.Acad.Sci.USA 99:10037; 2002), Rev (National Institute ofAllergy and Infectious Disease HIV Repository Cat.# 2088; And Pol (National Institute of Allergy and InfectiousDisease HIV Repository Cat.# 238 Genbankaccession # L14572); Genbank accession # AJ237568) and the T cell of gp120 and B cell epitope (Hanke and McMichael, AIDS ImmunolLett., 66:177; 1999); (Hanke, etc., Vaccine, 17:589; 1999); (Palker etc., J.Immunol., 142:3612-3619; 1989) the mosaic derivative of HTV-1 Env and gp120 is such as but not limited to syzygy (Fouts etc., J.Virol.2000, the 74:11427-11436 of gp120 and CD4; 2000); The derivative of HIV-1 env brachymemma or modification is such as but not limited to gp140 (Stamatos etc., J Virol, 72:9656-9667; 1998) or the derivative of the derivative of HIV-IEnv and/or gp140 (Binley, etc., J Virol, 76:2606-2616; 2002); (Sanders, etc., J Virol, 74:5091-5100 (2000); (Binley waits .J Virol, 74:627-643; 2000), hepatitis B virus surface antigen (Genbank accession #AF043578); (Wu etc., Proc.Natl.Acad.Sci., USA, 86:4726-4730; 1989); Wheel virus antigen, for example VP4 (Genbank accession # AJ293721); (Mackow etc., Proc.Natl.Acad.Sci., USA, 87:518-522; 1990) and VP7 (GenBank accession # AY003871); (Green etc., J.Virol., 62:1819-1823; 1988), influenza antigen, for example hemagglutinin or (GenBankaccession # AJ404627); (Pertmer and Robinson, Virology, 257:406; 1999); Nucleoprotein (GenBank accession # AJ289872); (Lin etc., Proc.Natl.Acad.Sci., 97:9654-9658; 2000) herpes simplex virus antigens, for example thymidine kinase (Genbank accession # AB047378; (Whitley etc., In:New GenerationVaccines, pages 825-854).

The bacterial pathogen that therefrom can produce bacterial antigens includes but not limited to mycobacterium subspecies (Mycobacterium spp), Helicobacter pylori subspecies (Helicobacter spp), Salmonellas subspecies (Salmonella spp), Shigellae subspecies (Shigella spp), intestinal bacteria, rickettsia subspecies (Rickettsia spp), listeria bacteria subspecies (Listeria spp), pneumonia Legionnella (Legionella pneumoniae spp), false monospore bacillus subspecies (Pseudomonas spp), vibrios subspecies (Vibrio spp), Bacillus anthracis (Bacillus anthracis spp) and Borrelia burgdoyferi (Borellia burgdorferi spp).

The example of bacterial pathogens protective antigen comprises the O antigen of enterotoxigenic Escherichia coli, for example CFA/I pili antigen (Yamamoto etc., Infect.Immun., 50:925-928; 1985) and non-toxicity B subunit (Klipstein etc., Infect.Immun., the 40:888-893 of heat-labile toxin; 1983); PRN (pertactin) (Roberts etc., Vacc, the 10:43-48 of bordetella pertussis (Bordetella pertussis); 1992), adenylate cyclase hemolysin (Guiso etc., Micro.Path., the 11:423-431 of bordetella pertussis; 1991), fragment C (Fairweather etc., Infect.Immun., the 58:1323-1326 of clostridium tetani (Clostridium tetani) tetanus toxin; 1990), OspA (Sikand etc., Pediatrics, the 108:123-128 of Borrelia burgdoyferi (Borellia burgdorferi); 2001); (Wallich etc., Infect Immun, 69:2130-2136; 2001), the protectiveness of Rickettsia prowazeki (Rickettsia prowazekii) and rickettsia exanthematotyphi (Rickettsia typhi) time crystal-S-layer proteins (Carl etc., Proc Natl Acad Sci USA, 87:8237-8241; 1990), superoxide-dismutase (being also referred to as " SOD " and " p60 ") (Hess of molten born of the same parents' element in listeria bacteria (being also referred to as " Llo " and " Hly ") and/or monocytosis Li Site bacterium (Listeriamonocytogenes), J., etc., Infect.Immun.65:1286-92; 1997); Hess, J., etc., Proc.Natl.Acad.Sci.93:1458-1463; 1996); (Bouwer etc., J.Exp.Med.175:1467-71; 1992), and the urase of Hp (Helicobacter pylori) (Gomez-Duarte etc., Vaccine 16,460-71; 1998); (Corthesy-Theulaz, etc., Infection ﹠amp; Immunity66,581-6; 1998), and Bacillus anthracis (Bacillus anthracis) protective antigen and lethal factor receptor conjugated protein (Price, etc., Infect.Immun.69,4509-4515; 2001).

Therefrom produce the antigenic parasitics pathogenic agent of parasitics and include but not limited to plasmodium subspecies (Plasmodium spp.), for example plasmodium falciparum (Plasmodium falciparum) (ATCC#:30145); Taper worm subspecies (Trypanosome spp.), for example schizotrypanum cruzi subspecies (Trypanosoma cruzi) are (ATCC#:50797); Giardia lamblia subspecies (Giardia spp.), for example giardia intestinalis (Giardia intestinalis) is (ATCC#:30888D); Ox tick subspecies (Boophilusspp.), babesia subspecies (Babesia spp.), for example babesia microti (Babesiamicroti) is (ATCC#:30221); Inner amoeba subspecies (Entamoeba spp.), for example entamoeba tetragena (Entamoeba histolytica) is (ATCC#:30015); Eimeria subspecies (Eimeria spp.), for example Eimeria maxima (Eimeria maxima) is (ATCC#40357); Leishmania subspecies (Leishmania spp.) (classification ED:38568); Schistosomicide subspecies (Schistosome spp.), cloth Shandong filaria subspecies (Brugia spp.), sheet fluke subspecies (Fascidaspp.) are disliked filaria subspecies (Dirofilaria spp.), Wuchereria subspecies (Wuchereria spp.) and (Onchocerea spp.).

The example of parasitics pathogenic agent protective antigen comprises ring sporophyte antigen (Sadoff etc., Science, the 240:336-337 of plasmodium subspecies; 1988), for example uncle Plasmodium jefferyi (P.bergerii) ring sporophyte antigen or the ring sporophyte antigen of plasmodium falciparum; Merozoite surface antigen (Spetzler etc., Int.J.Pept.Prot.Res., the 43:351-358 of plasmodium subspecies (Plasmodium spp.); 1994); Semi-lactosi specific agglutination element (Mann etc., Proc.Natl.Acad.Sci., USA, the 88:3248-3252 of entamoeba tetragena (Entamoeba histolytica); 1991), gp63 (Russell etc., J.Immunol., the 140:1274-1278 of leishmania subspecies (Leishmania spp.); 1988); (Xu and Liew, Immunol., 84:173-176; 1995), gp46 (Handman etc., Vaccine, the 18:3011-3017 of leishmania major (Leishmania major); 2000); Paramyosin (Li ef al, MoI.Biochem.Parasitol., the 49:315-323 of Wuchereria malayi (Brugia malayi); 1991), the triosephosphate isomerase of schistosoma mansoni (Schistosoma mansoni), (Shoemaker etc., Proc.Natl.Acad.Sci., USA, 89:1842-1846; 1992); Secretion sphaeroprotein sample albumen (Frenkel etc., MoI.Biochem.Parasitol., the 50:27-36 of trichostrongylus colubriformis (Trichostrongylus colubriformis); 1992); Frasciola hepatica (Hillyer etc., Exp.Parasitol., 75:176-186; 1992), schistosoma bovis (Schistosoma bovis) and Schistosoma japonicum (S.japonicum) (Bashir etc., Trop.Geog.Med., 46:255-258; 1994) glutathione-S-transferase; And the KLH of schistosoma bovis (Schistosoma bovis) and Schistosoma japonicum (S.japonicum) (Bashir etc., mentioned above, 1994).

As mentioned before this paper, the rdsRN vaccine endogenous immunogen of can encoding, described endogenous immunogen can be a cell protein arbitrarily, immunomodulator, or therapeutical agent or its part, it can be at recipient cell, include but not limited to tumour, transplant and the autoimmunity immunogen, or tumour, express in transplanting and immunogenic fragment of autoimmunity and the derivative.Therefore, in the present invention, dsRP can codes for tumor, transplant or the autoimmunity immunogen, or its part or derivative.Perhaps, the dsRP synthetic gene (preparation as indicated above) of can encoding, its tumour coding is specific, transplanting or autoimmunity antigen or its part.

The example of tumour specific antigen comprises prostate specific antigen (Gattuso etc., people Pathol., 26:123-126; 1995), TAG-72 and CEA (Guadagni etc., Int.J.Biol.Markers, 9:53-60; 1994), MAGE-1 and tyrosine oxidase (Coulie etc., J.Immunothera., 14:104-109; 1993).Recently, in mouse, show, carry out the effect that immunity provides vaccine with the antigenic non-malignant cell of expressing tumor, thereby and also help animal to produce immune response to have removed the malignant tumour (Koeppen etc. that show same antigen, Anal.N.Y.Acad.Sci., 690:244-255; 1993).

The example of transplantation antigen comprises CD3 molecule (Alegre etc., Digest.Dis.Sci., the 40:58-64 on the T cell; 1995).Proved the quick removing of circulation T cell and reversed cell-mediated transplant rejection (Alegre etc., mentioned above, 1995) with the antibody treatment of CD3 acceptor.

The antigenic example of autoimmunity comprises IAS β chain (Topham etc., Proc.Natl.Acad.Sci., USA, 91:8005-8009; 1994).From 18 amino acid whose peptides of IAS β chain mouse is carried out immunity and be proved to be protection and treatment (Topham etal, mentioned above, 1994) can be provided the mouse with experimental autoimmune encephalomyelitis with having.

In addition, the rdsRNA fragment can be built into and be used to the adjuvant of encoding, and can be used for strengthening the host to immunogenic immune response.Specific adjuvant by rdsRNA coding is not most important to the present invention, and it can be that the A subunit of Toxins,exo-, cholera (is CtxA; GenBank accession number X00171, AF175708, D30053, D30052), or its part and/or mutant derivative (for example, the A1 structural domain of 5: PN: JP2002051779 SEQID: 5 claimed protein (is CtxA1; GenBank accession number K02679), the vibrio cholerae (Vibrio cholerae) that comes from arbitrary standards (for example, vibrio cholerae (V.cholerae) bacterial strain 395, ATCC#39541) or E1 Tor vibrio cholerae (E1 Tor V.cholerae) (for example, vibrio cholerae (V.cholerae) bacterial strain 2125, ATCC#39050) bacterial strain.Perhaps, any bacteriotoxin (Krueger andBarbier, Clin.Microbiol.Rev., the 8:34 among the outside the pale of civilization toxin family member of bacterium adenosine diphosphate (ADP) ribose; 1995), may be used to substitute CtxA; The heat-labile toxin A subunit (being called EItA) of enterotoxigenic Escherichia coli (GenBank accession#M35581) for example at this, Toxins, pertussis S1 subunit (for example, ptxS1, GenBank accession#AJ007364, AJ007363, AJ006159, AJ006157, etc.); Or, adjuvant can be bordetella pertussis (Bordetella pertussis) (ATCC#8467), segmental bronchus sepsis Bordetella (Bordetella bronchiseptica) (ATCC#7773) or bordetella parapertussis (Bordetella parapertussis) adenylate cyclase hemolysin (ATCC#15237), for example, bordetella pertussis (B.pertussis) (GenBank accession number X14199), the cyaA gene of bordetella parapertussis (B.parapertussis) (GenBank accession number AJ249835) or segmental bronchus sepsis Bordetella (B.bronchiseptica) (GenBank accession number Z37112).

Can also make up the rdsRNA fragment of the Codocyte factor.Specific cells factor pair the present invention by the rdsRNA coding is not most important, and it includes but not limited to that interleukin-4 (is referred to herein as " IL-4 "; Genbank accession number AF352783 (mouse IL-4) or NM_000589 (people IL-4), IL-5 (Genbank accession number NM_010558 (mIL5) or NM_000879 (people IL-5), IL-6 (Genbank accession number M20572 (mouse IL-6) or M29150 (people IL-6), IL-10 (Genbank accession number NM-010548 (mouse IL-10) or AF418271 (people IL-10), IL-12 _P40(Genbank accession number NM_008352 (mouse IL-12p40) or AY008847 (people IL-12p40), IL-12 _P70(Genbank accession number NM_008351/NM_008352 (mouse IL-12p35/40) or AF093065/AY008847 (people IL-12p35/40), TGF β (Genbank accession number NM_011577 (mouse TGF β 1) or M60316 (people TGF β 1), and TNF α Genbank accession number X02611 (mouse TNF α) or M26331 (human TNF alpha).

In addition, can also encode in the rdsRNA fragment little inhibitory RNA or sense-rna are to regulate protein expression in target tissue.

Recombinant DNA and RNA method are also described, thus its can be used for the import feature expression cassette produce can described hereinbefore eukaryotic cell or tissue in express the rdsRNA of immunomodulatory inhibitor.

As exemplary type vaccine constructs coded in the eukaryotic expression box, also can make up virus-like particle (being called " VLP ") thereby induce and produce the protective immunological reaction be directed to viral pathogens at this.Proved that influenza VLP can be at coding hemagglutinin (HA), and oneself's assembling after the plasmid expression of neuraminidase (NA) and stromatin (M1 and M2) gene order (Latham etc., J.Virol, 75:6154-6165; 2001).Thereby so the VLP that makes up can also carry out that film merges and the sprout immune response that further in animal model, adds strong production antibody and protective immunity (Pushko etc., Vaccine.2005 Sep 2; [electronic publishing before written publication]).HIV VLP can assemble from the amino acid whose basic sequence of coding capsid protein 146-231 similarly, this is one six an amino acid whose myristylation sequence, this sequence encoding P2 peptide, the GCN4 leucine zipper motif, and gp160 coating precursor (Accola etc., J.Virol, 74:5395-5402; 2000).The major protein L1 of HPV has been proved to be able to the oneself and has been assembled into the various clones of VLP and can produces humoral immunity and cellular immunity, thereby make this proteic gene of coding become the immunogen (Shi etc. that attract people's attention, J Virol., 75 (21): 10139-10148; 2001).

3. carry the segmental structure of rdsRNA of α expressing viral box

As indicated above, rdsRN can contain Mammals accurate translation box, this expression cassette contains plasmid pSFV1 (the Invitrogen Inc. that is connected in goal gene from functional, Carlsbad, Semliki Forest virus CA) (semliki forest virus) (being referred to herein as " SFV ") oneself amplification replicon.Can be by pcr amplification the encode gene (being referred to herein as " nsp1-4 ") of SFV non-structural protein 1-4 and the replicative enzyme recognition site among the pSFV1, and connect to insert the HpaI site that is arranged in the functional IRES of being connected in of rSeg-S and is close to its downstream by blunt end, obtain rSeg-S::SFV1 (Fig. 5).SmaI restriction endonuclease sites among the plasmid rSeg::SFV1 can be used as any external source or endogenous goal gene, for example those insertion sites of the gene of mentioning above.

It should be noted that, in the rdsRN that contains the positive allelic rdsRNA fragment-S of selection and α virus nsp1-4 and about 8100bp amplicon, when goal gene surpasses 800bp (genome size surpassed wild type gene group size 10%), the absorption of fragment-L is stoped.It should be noted that in all cases the rdsRN that contains the positive allelic rdsRNA fragment-S of selection and α virus nsp1-4 and amplicon does not need rdsRNA fragment-M.

Can solve the restriction on the capacity by the packaging strains that produces the modified derivative of expressing the fragment L that lacks 5 ' pac sequence.Such sequence can be expressed and produce the necessary albumen of procapsid but can not pack in nucleocapsid, thereby the capacity of extra 7000bp is provided in the rdsRN that described bacterial strain produced.

Modification fragment-L in these constructs can be at expression vector, pT7/T3-18 (Ambion for example, Austin, TX, Cat.No.7201) import packaging strains in, or by using those skilled in the art's known method to be integrated into karyomit(e) (Hamilton etc., mentioned above, 1989) by the allelotrope exchange; (Blomfield etc., mentioned above, 1991).The position of chromosomal integration is unimportant for this area, although in preferred embodiments, thereby under the DNA of encode fragment-L expression cassette gene that has been integrated into the karyomit(e) inactivation and the culture condition determined, produced optionally phenotype, aroA (Genbank accession number X00557) for example, aroC (Genbank accession number AY142231), leuD (Genbank accession number L06666) asd (Genbank accession number V00262), murI (Genbank accession number AY520970) kdsA (Genbank accession number AY174101) and htrB (Genbank accession number AF401529).The method of the program of chromosomal integration and these mutant of cultivation all has detailed record (Hamilton etc., J.Bacteriol.171:4617; 1989); (Blomfield etc., MoI.Microbiol.5:1447; 1991).

4. produce the method for rdsRN in the mode of de novo synthesis

In packaging strains, produce the RNA that rdsRNA institute must full detail also being absorbed into procapsid subsequently produces rdsRN by importing coding.RRNA can be directly import or can on the non-replicating plasmid, encode, it can import packaging strains altogether.The gene of encode fragment-L and consequent procapsid may reside on the plasmid in the packaging strains and maybe can be integrated on the karyomit(e) of packaging strains.Perhaps, the positive chain RNA of encode fragment-L can with coding recombinant fragment-S and-positive chain RNA of M together is imported into packaging strains.In case procapsid integrated fragment-S and-the reorganization ssRNA (being called as ssRNA in this article) of M, it must have enough sizes and have suitable packaging sequence, thereby produce the signal that absorbs fragment-L mRNA, the latter is integrated subsequently and the ssRNA of all packings is converted to dsRNA, has caused the generation of rdsRN.At this moment, rdsRN can produce recombinant fragment-S and-M mRNA and fragment-L mRNA; The latter can express the albumen of forming procapsid, and it can absorb integrates recombinant fragment and fragment-L mRNA, produces extra rdsRN (Fig. 6) thereby be transformed into dsRNA then.

Can external synthetic recombinant fragment mRNA be imported packaging strains by electroporation.Preferably, (Madison WI) produces and to fluoridize RNA transcribe rna from the linear DNA template body outside for Durascribe, Epicentre, and it is the RNA that tolerates nuclease can to use fluorizated rNTP.Final concentration with every kind of 5mM is integrated into fluorizated dUTP and dCTP in the reaction mixture.Though fNTP is preferably, have the rNTP of any modification of nuclease resistance, for example the rNTP of sulfydryl or amino hexyl replacement can be used for the present invention.Therefore, those skilled in the art can use the NTP with nuclease resistance of any modification to replace fluorizated NTP.

RNA or preferably fluoridize RNA and can encode and remedy at least a gene product of described at least a selectivity phenotype sudden change and can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.In preferred embodiments, fluoridize the RNA coding and remedy described at least a selectivity phenotype sudden change, promptly be used for the stable at least a gene product that produces the gene-8 (SEQ ID 7) of nucleocapsid; And can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

For rdsRN is being imported in the described packaging strains, produced the electroporation medium, comprise following composition:

(i) density is 10 ⁸-10 ¹¹Cfu/ml is used to pack, import and produce the electroreception attitude bacterial isolates of rdsRN, contains

A) contain at least a genomic dna that can not reply the sudden change of selectivity phenotype;

B) coding produces the nucleotide sequence of procapsid institute indispensable gene; And

C) contain proteic one or more procapsids that RNA packs active and rna polymerase activity;

(ii) coding remedies the 1ng-1mg of described at least a selectivity phenotype mutator gene product, is preferably 1mcg-100mcg, more preferably 5mcg-40mcg RNA and can being operatively connected in the purpose RNA of eukaryotic translation homing sequence.

In preferred embodiments, rdsRN is imported in the described packaging strains, employing be the electroporation medium, comprise following composition

(i) density is 10 ⁸-10 ¹¹Cfu/ml is used to pack, import and produce the electroreception attitude bacterial isolates of rdsRN, contains

A) contain at least a genomic dna that can not reply the sudden change of selectivity phenotype;

B) coding produces the nucleotide sequence of procapsid institute indispensable gene; And

C) contain proteic one or more procapsids that RNA packs active and rna polymerase activity;

(ii) coding remedies described at least a selectivity phenotype sudden change, be used for stablizing the 1ng-1mg of the gene product of the gene-8 (SEQ ID 7) that nucleocapsid produces, be preferably 1mcg-100mcg, more preferably 5mcg-40mcg RNA and can being operatively connected in the purpose RNA of eukaryotic translation homing sequence.

Perhaps, rdsRN is imported in the described packaging strains, employing be the electroporation medium, comprise following composition

(i) density is 10 ⁸-10 ¹¹Cfu/ml is used to pack, import and produce the electroreception attitude bacterial isolates of rdsRN, contains

A) contain at least a genomic dna that can not reply the sudden change of selectivity phenotype;

Coding remedies described at least a selectivity phenotype sudden change, promptly produce the necessary nucleic acid sequence encoding gene of procapsid, be used for stablizing the 1ng-1mg of gene-8 (the SEQ ID 7) gene product that nucleocapsid produces, be preferably 1mcg-100mcg, more preferably 5mcg-40mcg RNA and can being operatively connected in the purpose RNA of eukaryotic translation homing sequence.

In another preferred embodiment, rdsRN is imported in the described packaging strains, employing be the electroporation medium, comprise following composition

(i) density is 10 ⁸-10 ¹¹Cfu/ml is used to pack, import and produce the electroreception attitude bacterial isolates of rdsRN, contains

A) contain at least a genomic dna that can not reply the sudden change of selectivity phenotype;

B) coding produces the nucleotide sequence of procapsid institute indispensable gene; And

C) have active and proteic one or more procapsids of rna polymerase activity of RNA packing;

(ii) coding remedies described at least a selectivity phenotype sudden change, be used for stablizing the 1ng-1mg that nucleocapsid produces gene-8 (SEQ ID 7) gene product, be preferably 1mcg-100mcg, more preferably 5mcg-40mcg fluoridizes RNA and can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

In another preferred embodiment, rdsRN is imported in the described packaging strains, employing be the electroporation medium, constitute by following composition

(i) density is 10 ⁸-10 ¹¹Cfu/ml is used to pack, import and produce the electroreception attitude bacterial isolates of rdsRN, contains

A) contain at least a genomic dna that can not reply the sudden change of selectivity phenotype;

(ii) coding remedies described at least a selectivity phenotype sudden change, procapsid produces necessary nucleic acid sequence encoding gene, be used for stablizing the 1ng-1mg of gene-8 (the SEQ ID 7) gene product that nucleocapsid produces, be preferably 1mcg-100mcg, more preferably 5mcg-40mcg fluoridizes RNA; And can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

Be used for described RNA or preferred, fluoridizing the method that the RNA electroporation enters described packaging strains is not most important to the present invention, and can use standard program well known in the art finish (Ausubel etc., mentioned above, 1990; Sambrook, mentioned above).After electroporation, can with the electroporation medium with reply substratum and mix, as described in the document (Ausubel etc., mentioned above, 1990; Sambrook, mentioned above), and hatched 30 minutes-4 hours at 37 ℃, be preferably 2 hours.

only allow to carry and the express recombinant fragment under the positive condition of selecting allelic strain growth, can on solid medium, be separated to electric transformant (for example, tryptic soy agar (being referred to herein as TSA), Difco, Detroit, MI)..

The bacterial isolates that will contain rdsRN under 25 ℃-44 ℃ temperature range was cultivated 16-96 hour; Yet, preferably at 28 ℃ transformant was cultivated 48 hours earlier.Subsequently by standard method to growing in bacterium colony on the selectivity solid medium and separate and purifying (Ausubel etc., mentioned above, 1990); (Sambrook, mentioned above).In order to verify that selected isolate carries the functional rdsRN of purpose, can use and be designed to specific amplification and include but not limited to chain specificity packaging sequence, the positive allelotrope of selecting, the primer of the normal chain of IRES and goal gene and negative (second) chain RNA sequence screens one isolate by RT-PCR.The method that the RNA preparation is analyzed is that those skilled in the art are known, and is as mentioned below.Cultivate independent isolate in can liquid medium within (for example, tryptic soy meat sugar (being referred to herein as " TSB "), Difco MO), and at the optical density(OD) (OD of 600nm ₆₀₀) reach and collect the gained culture after the 0.001-4.0, with the OD of aseptic TSB ₆₀₀In contrast.Can use and report with those skilled in the art's known method in the elsewhere and from these cultures, to separate nucleocapsid (Gottlieb etc., J.Bacterid 172:5774; 1990); (Sun etc., mentioned above, 2003).Use Clone Manager  software 4.1 versions (Scientific andEducational Software Inc., Durham, NC) or the PCR primer analyzed of OLIGO 4.0 primer analysis software (all rights reserved for Wojciech Rychlik) design.This software can make PCR primer design and the specific DNA fragments that need operate be complementary.(Hercules carries out RT-PCR on CA), and sets primer annealing among the described RT-PCT according to standard program, prolongs and the sex change time (Ausubel etc., mentioned above) at Bio RadiCycler.Use standard program the RT-PCR product to be analyzed (Ausubel etc., mentioned above, 1990) subsequently by agarose gel electrophoresis; (Sambrook, mentioned above).If certain clone shows explanation rdsRNA fragment stable maintenance in the suitable R T-PCR of described bacterial strain collection of illustrative plates, then be defined as positive colony.Can use the standard DNA sequence measurement that the RT-PCR product is further measured, as described below.

After the evaluation of finishing desired transformant, independent bacterial strain can be stored in and preserve in the substratum, it is the TS that contains 10-30% (v/v) glycerine.Can use aseptic cotton swab to gather in the crops bacterial isolates from solid medium, and with 10 ⁸-10 ⁹The density of cfu/ml is resuspended in preserves in the substratum, and resuspended thing is stored in-80 ℃.

Can use method well known in the art and the detailed disclosed method in elsewhere purifying from described carrier bacterial strain obtain different batches purifying rdsRN (Mindich, etc., J Virol 66,2605-10; 1992); (Mindich, etc., Virology 212:213-217; 1995); (Mindich, etc., J Bacteriol 181:4505-4508; 1999); (Qiao, etc., Virology 275:218-224; 2000); (Qiao, etc., Virology 227:103-110; 1997); (Olkkonen, etc., Proc Natl Acad Sci USA 87:9173-9177; 1990); (Onodera, etc., J Virol66,190-196; 1992).

5. thereby use rdsRN to induce and cause biological action in vivo

The concrete grammar that is used to prepare novel rdsRP expression system herein is not most important to the present invention, and can be selected from physiological buffer (Feigner etc., U.S.Patent#5589466 (1996); Aluminum phosphate or Adju-Phos (aluminum hydroxyphosphate) (for example, Ulmer etc., Vaccine, 18:18; 2000), single phosphoric acid acyl fat A (is also referred to as MPL or MPLA; Schneerson etc., J.Immunol., 147:2136-2140; 1991); (for example, Sasaki etc., Inf.Immunol., 65:3520-3528; 1997); (Lodmell etc., Vaccine, 18:1059-1066; 2000), the QS-21 saponin(e (for example, Sasaki, etc., J.Virol., 72:4931; 1998); Dexamethasone (dexamethasone) (for example, Malone, etc., J.Biol.Chem.269:29903; 1994); CpG dna sequence dna (Davis etc., J.Immunol., 15:870; 1998); Or lipopolysaccharides (LPS) antagonist (Hone etc., mentioned above 1997).

Can pass through in intravenously, intramuscular, intracutaneous, intraperitoneal, the nose and the dabbling mode in oral cavity, the direct administration of rdsRN is entered eukaryotic cell, animal tissues or tissue.The ad hoc approach that is used for the rdsRN construct is imported target cell or tissue as herein described is not most important to the present invention, and described immunization method before can being selected from (Wolff, etc., Biotechniques 11:474-85; 1991); (Johnston and Tang, Methods Cell Biol 43:353-365; 1994); (Yang and Sun, Nat Med 1:481-483; 1995); (Qiu, etc., Gene Ther.3:262-8; 1996); (Larsen, etc., J.Virol.72:1704-8; 1998); (Shata andHone, J.Virol.75:9665-9670; 2001); (Shata, etc., Vaccine 20:623-629; 2001); (Ogra, etc., J Virol 71:3031-3038; 1997); (Buge, etc., J.Virol.71:8531-8541; 1997); (Belyakov, etc., Nat.Med.7,1320-1326; 2001); (Lambert, etc., Vaccine 19:3033-3042; 2001); (Kaneko, etc., Virology267:8-16; 2000); (Belyakov, etc., Proc Natl Acad Sci USA 96:4512-4517; 1999).

Include, but not limited to the immune response of protectiveness or modulability by the particular biological effect of covering of the present invention, therapeutic response, and the host protein downward modulation (for example siRNA) or the up-regulated (for example cytokine-expressing) of expressing.At the beginning, with 10 ²-10 ⁹The dosage of nucleocapsid particles adopts suitable administration rdsRN, and is for example oral, subcutaneous in the nose, intramuscular, or by invasive virus vector (Sizemore etc., Science.1995 Oct 13; 270 (5234): 299-302).The variation of dosage number can change according to tiring of individual rdsRN, and can be the single in interval 2-4 week, twice or three dosed administration therapies.Each expression study all comprises the negative control rdsRN that does not contain goal gene, and the dna vaccine vector that can be used as the coding goal gene of positive control.

The method of the biological action of the genetic expression of mensuration rdsRN coding is known in the field in biosystem.For example, in order to measure serum IgG and IgA reaction to gp120, can 10,20,30,40,50,60,70 and 80 days collection serum before immunity and after the immunity.Be collected into the independent test tube from the about 400-500 μ of the tail vein collection l hemopathy of every mouse, it solidified by hatch 4 hours on ice.In whizzer after centrifugal 5 minutes, with serum transfers to new pipe and be stored in-80 ℃.Can use after immunity the faecal particles of regularly collecting and vaginadouche thing to measure mucous membrane IgG and IgA for by goal gene expressed antigenic reaction (Srinivasan etc., Biol.Reprod.53:462; 1995); (Staats etc., J.Immunol.157:462; 1996).Can use next quantitative IgG of standard ELISA and IgA reaction (Abacioglu etc., ADDS Res.Hum.Retrovir.10:371 to gp120 in serum and the mucous membrane sample; 1994); (Pincus etc., AIDS Res.Hum.Retrovir.12:1041; 1996).Ovalbumin can be included among each ELISA as negative control antigen.In addition, each ELISA also comprises positive control serum under the suitable situation, and faecal particles or vagina cleaning matter sample.Can from 10 μ g by the albumen of destination gene expression be mixed with 10 μ g Toxins,exo-, choleras and carry out collecting the intranasally inoculated animal positive control (Yamamoto etc., Proc.Natl.Acad.Sci.94:5267; 1997).Get inverse by the last serum dilution that the 490nm absorption value is produced increase and can calculate the terminal point titre, described absorption value adds 3 times of standard differences greater than the mean number of negative control row.

In order to measure the immunizing power of cell, can use from adenoid enrichment CD4 ⁺And CD8 ⁺The T cell suspension is analyzed t cell responses (Wu etc., the AIDS Res.Hum.Retrovir.13:1187 that measures antigen-specific by the specific ELISPOT of cytokine; 1997).Such analysis can determine secretion IL-2, IL-4, IL-5, IL-6, the quantity of the T cells with antigenic specificity of IL-10 and IFN-γ.All ELISPOT analyze and are to use the commercial obtainable (R﹠amp that mAbs carries out that captures and detect; D Systems and Pharmingen), as (Wu etc., Infect.Immun.63:4933 as described in the reference; 1995) and before with being (Xu-Amano etc., J.Exp.Med.178:1309; 1993); (Okahashi etc., Infect.Immun.64:1516; 1996).Each is analyzed and all comprises mitogen (Con A) and ovalbumin contrast.

6. use the bacteria carrier induction of immunity reaction or the generation biological action in target cell or tissue that carry rdsRN

Can realize rdsRN sending and the expression of coded sequence in target eukaryotic cell, tissue or organism by inoculating with the rdsRN that carries in non-virulent or the attenuated bacteria vaccine carrier.The purpose biologically includes, but not limited to the immune response of protectiveness or modulability, therapeutic response, and the downward modulation (for example siRNA) or the up-regulated (for example cytokine-expressing) of host protein expression.

In the present invention, the bacterial isolates that therefrom obtains the bacterial vaccine carrier is not most important, it includes but not limited to: Campylobacter subspecies (Campylobacter spp), Neisseria subspecies (Neisseria spp), influenzae subspecies (Haemophilus spp), aerogenesis Zymomonas mobilis subspecies (Aeromonas spp), Francisella subspecies (Francisella spp), Yersinia subspecies (Yersinia spp), klebsiella spp subspecies (Klebsiella spp), bordetella subspecies (Bordetella spp), Legionnella subspecies (Legionella spp), coryneform bacteria subspecies (Corynebacterium spp), citric acid bacterium subspecies (Citrobacter spp), chlamydozoan (Chlamydia spp), brucella subspecies (Brucella spp), pseudomonas subspecies (Pseudomonas spp), Helicobacter pylori subspecies (Helicobacter spp) or vibrios subspecies (Vibriospp).

Applied specific curvature bacillus strain is not most important for the purpose of the present invention.The example that can be applicable to Campylobacter bacterial strain of the present invention includes but not limited to: campylobacter jejuni (C.jejuni) (ATCC Nos.43436,43437,43438), campylobacter hyointestinalis (C.hyointestinalis) (ATCC No.35217), campylobacter fetus (C.fetus) (ATCC No.19438) campylobacter fecalis (C.fecalis) (ATCC No.33709), C.doylei (ATCC No.49349) and large intestine Campylobacter (C.coli) (ATCC Nos.33559,43133).

Applied specific Yersinia bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Yersinia bacterial strain of the present invention comprises: yersinia entero-colitica (Y.enterocolitica) (ATCC No.9610) or Yersinia pestis (Y.pestis) (ATCC No.19428), yersinia entero-colitica Ye03-R2 (al-Hendy etc., Infect.Immun., 60:870; 1992) or yersinia entero-colitica aroA (O ' Gaora etc., Micro.Path., 9:105; 1990).

Applied specific klebsiella spp bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to klebsiella spp bacterial strain of the present invention comprises klebsiella pneumoniae (K.pneumoniae) (ATCC No.13884).

Applied specific bordetella bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to bordetella bacterial strain of the present invention comprises bordetella pertussis (B.pertussis), segmental bronchus sepsis Bordetella (B.bronchiseptica) (ATCC No.19395).

Applied specific Neisseria bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Neisseria bacterial strain of the present invention comprises that neisseria meningitidis (N.meningitidis) (ATCCNo.13077) and Diplococcus gonorrhoeae (N.gonorrhoeae) (ATCC No.19424), Diplococcus gonorrhoeae MS11 aro mutant (Chamberlain etc., Micro.Path., 15:51-63; 1993).

Applied specific aerogenesis aeromonas strain is not most important for the purpose of the present invention.The example that can be applicable to aerogenesis aeromonas strain of the present invention comprises A.salminocida (ATCC No.33658), A.schuberii (ATCC No.43700), have a liking for aquatic products Aeromonas (A.hydrophila), A.eucrenophila (ATCC No.23309).

Applied specific Mark Lewis-Francis bacteria strain is not most important for the purpose of the present invention.The example that can be applicable to Mark Lewis-Francis bacteria strain of the present invention comprises that soil draws hot Francisella (F.tularensis) (ATCC No.15482).

Applied specific corynebacterium strain is not most important for the purpose of the present invention.The example that can be applicable to corynebacterium strain of the present invention comprises Corynebacterium pseudotuberculosis (C.pseudotuberculosis) (ATCC No.19410).

Applied specific citric acid bacterium bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to citric acid bacterium bacterial strain of the present invention comprises Fu Luoyindeshi citric acid fungus (C.freundii) (ATCC No.8090).

Applied specific chlamydozoan bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to chlamydozoan bacterial strain of the present invention comprises Chlamydia pneumoniae (C.pneumoniae) (ATCC No.VR1310).

Applied specific influenzae bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to influenzae bacterial strain of the present invention comprises hemophilus influenzae (H.influenzae) (Lee etc., J.Biol.Chem.270:27151; 1995), Haemophilus somnus (H.somnus) (ATCCNo.43625).

Applied specific brucella bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to brucella bacterial strain of the present invention comprises Bacillus abortus (B.abortus) (ATCCNo.23448).

Applied specific Legionnella bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Legionnella bacterial strain of the present invention comprises pneumonia Legionnella (L.pneumophila) (ATCC No.33156), or pneumonia Legionnella mip mutant (Ott, FEMS Micro.Rev., 14:161; 1994).

Applied specific pseudomonad strain is not most important for the purpose of the present invention.The example that can be applicable to pseudomonad strain of the present invention comprises Pseudomonas aeruginosa (P.aeruginosa) (ATCC No.23267).

Applied specific Helicobacter pylori bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Helicobacter pylori bacterial strain of the present invention comprises helicobacter pylori (H.pylori) (ATCC No.43504), ferret Helicobacter pylori (H.mustelae) (ATCC No.43772).

Applied specific vibrios bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to vibrios bacterial strain of the present invention comprises vibrio cholerae (Vibrio cholerae) (ATCC No.14035), Vibrio cincinnatiensis (Vibrio cincinnatiensis) (ATCC No.35912), vibrio cholerae RSI virulence mutant (Taylor etc., J.Infect.Dis., 170:1518-1523; 1994) and vibrio cholerae ctxA, ace, zot, cep mutant (Waldor J etc., Infect Dis., 170:278-283; 1994).

In preferred embodiments, the bacterial isolates that produces packaging strains of the present invention has comprised that demonstration has the attenuation derivative of the bacterium that can be used as the vaccine carrier potentiality, enterobacteria (Enterobacteriaceae) for example, include but not limited to escherich's bacillus subspecies (Escherichia spp.), shigella subspecies (Shigella spp.) and Salmonellas subspecies (Salmonella spp.).Can make up Gram-positive and acid resistance packing and carrier bacterial strain similarly from listerisa monocytogenes in mjme (Listeria monocytogenes) or mycobacterium subspecies (Mycobacterium spp).

Applied specific Escherichia bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Escherichia bacterial strain of the present invention comprises intestinal bacteria (Escherichia coli) DH5 α, and HB 101, HS-4,4608-58,1184-68,53638-C-17,13-80 and 6-81 (Sambrook etc. for example, mentioned above 2001); (Sansonetti etc., Ann.Microbiol. (Inst.Pasteur), 132A:351; 1982), enterotoxication intestinal bacteria (Evans etc., Infect.Immun., 12:656; 1975), enteropathogenic intestinal bacteria (Donnenberg etc., J.Infect.Dis., 169:831; 1994), and enterohemorrhagic Escherichia coli (McKee and O ' Brien, Infect.Immun., 63:2070; 1995).

Applied specific Salmonellas bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to Salmonellas bacterial strain of the present invention comprises salmonella typhi (S.typhi) (ATCC No.7251), Salmonella typhimurium (S.Typhimurium) (ATCC No.13311), Salmonella gallinarum (Salmonella galinarum) (ATCC No.9184), Salmonella enteritidis (Salmonellaenteriditis) (ATCC No.4931) and Salmonella typhimurium (ATCC No.6994), salmonella typhi aroC, aroD double-mutant (Hone etc., Vacc, 9:810-816; 1991), Salmonella typhimurium aroA mutant (Mastroeni etc., Micro.Pathol., 13:477-491; 1992).

Applied specific shigella bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to shigella bacterial strain of the present invention comprises shigella flexneri (Shigella flexneri) (ATCCNo.29903), shigella flexneri CVD1203 (Noriega etc., Infect.Immun.62:5168; 1994), shigella flexneri 15D (Sizemore etc., Science 270:299; 1995), Shigella sonnei (Shigella sonnei) (ATCC No.29930), and shigella dysenteriae (Shigella dysenteriae) (ATCC No.13313).

Applied specific branch bacillus strain is not most important for the purpose of the present invention.The example that can be applicable to mycobacterium bacterial strain of the present invention comprises Mycobacterium tuberculosis (Mtuberculosis) CDC 1551 bacterial strains (Griffith etc., Am.J.Respir.Crit.Care Med.Aug; 152 (2): 808; 1995), Mycobacterium tuberculosis Beijing strain (Soolingen etc., 1995) H37Rv bacterial strains (ATCC#:25618), Mycobacterium tuberculosis pantothenic acid auxotrophic strain (Sambandamurthy, Nat.Med.2002 8 (10): 1171; 2002), Mycobacterium tuberculosis rpoV mutants which had (Collins etc., Proc Natl Acad Sci USA.92 (17): 8036; 1995), Mycobacterium tuberculosis leucine auxotrophic strain (Hondalus etc., Infect.Immun.68 (5): 2888; 2000), BCG Denmark bacterial strain (ATCC#35733), BCG Japanese strain (ATCC#35737), BCG, Chicago bacterial strain (ATCC#27289), BCG copenhagen strain (ATCC#:27290), BCG pasteur bacterial strain (ATCC#:35734), BCGGlaxo bacterial strain (ATCC#:35741), BCG Connaught bacterial strain (ATCC#35745), BCG Montreal strain (ATCC#35746).

Applied specific listerisa monocytogenes in mjme (Listeria monocytogenes) bacterial strain is not most important for the purpose of the present invention.The example that can be applicable to listerisa monocytogenes in mjme bacterial strain of the present invention comprises listerisa monocytogenes in mjme bacterial strain 10403S (for example, Stevens etc., J.Virol 78:8210-8218; 2004) or mutant listerisa monocytogenes in mjme bacterial strain, for example (i) actA plcB double-mutant (Peters etc., FEMS Immunologyand Medical Microbiology 35:243-253; 2003); (Angelakopoulous etc., Infect and Immunity 70:3592-3601; 2002); (ii) for dal dat double-mutant (Thompson etc., the Infect andImmunity 66:3552-3561 of alanine racemase gene and D-amino acid transaminase gene; 1998).

To intestinal bacteria, Salmonellas, mycobacterium, the method for Shigellae and Li Si body bacterium attenuation is not most important to the present invention, and is those skilled in the art known (Evans etc., mentioned above, 1975); (Noriega etal, mentioned above, 1994); (Hone etc., mentioned above, 1991).

In case selected the bacterial vaccine carrier bacterial strain of non-virulent or attenuation, thereby just can modify as the rdsRN packaging strains to this bacterial strain.Can use the strategy of above-detailed to finish this process, fragment-L the sequence that promptly needs to express the dsRP procapsid imports described bacterial strain, and introduce the sudden change of can right rdsRN selecting and keeping, the functioning gene that described rdsRN expresses remedies the defective that sudden change produces in the described bacterial strain.

In order to produce the bacterial strain of packing and the desired rdsRN of stable maintenance, can external synthetic recombinant fragment RNA be imported packaging strains by electroporation, and only allowing to carry in the recombinant fragment and expressing under the positive condition of selecting allelic strain growth and (for example on solid medium, separate transformant, at that time, the trypsinized soy agar can only allow the growth of asd and murI mutant, and wild type gene remedies the gene of genomic deficiency, Difco, Detroit, MI, Cat.No.244520).Above also provide generation rdsRNA fragment, all method of the synthetic and electroporation of external mRNA.In order to verify that isolate carries purpose rdsRN, individual isolate (for example can be incubated at liquid nutrient medium, TS, Difco, Detroit, MI, Cat.No.244620) in, and use elsewhere reported method and those skilled in the art's known method from described culture, to separate nucleocapsid (Gottlieb etc., mentioned above, 1990); (Sun etc., mentioned above, 2003).Can use commercial obtainable RNA to extract test kit and from nucleocapsid, separate dsRNA, and use the described recombinant fragment of amplification inside to determine segmental primer, the positive allelotrope of selecting includes but not limited to increase, IRES, and the PCR primer of goal gene, screen by RT-PCR, describe in detail as mentioned.If certain clone shows explanation rdsRNA fragment stable maintenance in the suitable RT-PCR collection of illustrative plates of described bacterial strain, then be defined as positive colony.Can use the standard DNA sequence measurement that the RT-PCR product is further measured, as described below

For the stable growth that contains the bacterial vaccine carrier bacterial strain of rdsRN, specific culture condition is not most important to the present invention.For illustrative purpose, mutant can be grown in the liquid nutrient medium, for example LB substratum (Difco, Detroit, MI, Cat.No.244620), nutrient broth (Difco, Detroit, MI, Cat.No.233000), trypticase soya broth (Difco, Detroit, MI, Cat.No.211822), use be the conventional cultivation technique (Miller that is suitable for bacterial isolates growth, mentioned above, 1991).Perhaps, bacterium also can be cultivated on solid medium, for example nutrient agar medium (Difco, Detroit, MI, Cat.No.212000), and tryptic soy agar (Difco, Detroit, MI, Cat.No.236920), or the basic agar of M9 (Difco, Detroit, M, Cat.No.248510).

Mycobacterium vaccine carrier strain culturing is in liquid nutrient medium, and for example (MI Cat.No.271310) or in the Saulton synthetic medium, is preferably at 37 ℃ Middlebrook7H9 for Difco, Detroit.Bacterial strain can be kept static or wave and culture.In addition, can be by adding oleic acid (0.06% v/v; Research Diagnostics Cat.No.01257) with such as Tyloxapol (0.05% v/v; Research Diagnostics Cat.No.70400) stain remover strengthens the growth velocity of mycobacterium.Can by equably with mycobacterium culture serial dilution in phosphate-buffered saline (being referred to herein as PBS) of 100 μ l five equilibriums (for example, with 10 times of dilution methods from being diluted to 10 from pure growth ^-8) to containing the 25-30ml solid medium, for example (MD on 3.5 inches culture plates Cat.No.221174), thereby estimates the purity of mycobacterium culture to Middlebrook 7H10 for BD Microbiology, Cockeyesville.

RdsRN of the present invention intends carrying out the bacterial vaccine carrier amount of administration can be with the difference of object kind, and needs the different of the disease of treatment and discomfort and change.Usually, the dosage that is adopted is about 10 ³-10 ¹¹The organism of living is preferably about 10 ³-10 ⁹Has active organism.

The bacteria carrier that carries rdsRN usually all with medicine acceptable carrier or together administration of thinner.Certain drug acceptable carrier that is adopted or thinner are not most important to the present invention.The example of thinner comprises phosphate-buffered saline, be used for the damping fluid of agonistic buffering hydrochloric acid in gastric juice under one's belt, for example contain the citrate buffer solution (pH 7.0) of sucrose, independent bicarbonate buffer (pH 7.0) (Levine etc., J.Clin.Invest, 79:888-902; 1987); (Black etc., J.Infect.Dis., 155:1260-1265; 1987), or contain xitix, the bicarbonate buffer of lactic acid and optional aspartame (pH 7.0) (Levine etc., Lancet, II:467-470; 1988).The example of carrier comprises albumen, the albumen of finding in the skimmed milk for example, sugar, for example sucrose or polyvinylpyrrolidone.The concentration of usually, can about 0.1-90% (w/v) but being preferably 1-10% (w/v) is used these carriers.

Can in appropriate animal model (for example, BATS/cJ mouse, rabbit, cavy or rhesus monkey), measure the biologic activity of carrier bacterial strain.At the beginning, with 10 ²-10 ⁹The dosed administration rdsRN carrier bacterial strain of cfu, and adopt suitable administration (for example, can be, Salmonellas and Shigellae, and) by subcutaneous injection administration rBCG carrier by mode administration intestinal bacteria in the stomach or in the nose.The number of dosage can be along with the effectiveness of individual carrier bacterial strain, and tire difference and the difference of coded purpose recombinant products.

It is known in the field measuring the immunity of rdsRN coded product and the method for other biological reaction.In order to measure serum IgG and IgA reaction to gp120, can 10,20,30,40,50,60,70 and 80 days collection serum before immunity and after the immunity.Be collected into the independent test tube from the about 400-500 μ of the tail vein collection l hemopathy of every mouse, it solidified by hatch 4 hours on ice.In whizzer after centrifugal 5 minutes, with serum transfers to new pipe and be stored in-80 ℃.Can use before or after immunity the faecal particles of regularly collecting and vaginadouche thing to measure mucous membrane IgG and IgA for by goal gene expressed antigenic reaction (Srinivasan etc., Biol.Reprod.53:462; 1995); (Staats etc., J.Immunol.157:462; 1996).Can use standard ELISA to come in quantitative serum and the mucous membrane sample IgG and IgA to reaction (Abacioglu etc., the ADDS Res.Hum.Retrovir.10:371 of gp120; 1994); (Pincus etc., AIDS Res.Hum.Retrovir.12:1041; 1996).Ovalbumin can be included among each ELISA as negative control antigen.In addition, each ELISA also comprises positive control serum under the suitable situation, and faecal particles or vagina cleaning thing sample.Can from 10 μ g by the albumen of destination gene expression be mixed with 10 μ g Toxins,exo-, choleras and carry out collecting positive control the intranasally inoculated animal, as (Yamamoto etc., Proc.Natl.Acad.Sci.94:5267 as described in the document; 1997).Get inverse by the last serum dilution that the 490nm absorption value is produced increase and can calculate the terminal point titre, described absorption value adds 3 times of standard differences greater than the mean number of negative control row.

Can be by cell within a cell factor dyeing (being also referred to as cell within a cell factor cell technology) or by ELISPOT (Letsch A. etc., Methods 31:143-49; 2003) measure cellular immunity.Two kinds of methods all allow the antigen specific immune response is carried out quantitatively, although ICS also needs to add the specific CD4 of antigen ⁺And CD8 ⁺The T cell carries out the synchronous ability that characterizes on phenotype.Such analysis can determine secretion IL-2, IL-4, IL-5, IL-6, the quantity of the T cells with antigenic specificity of IL-10 and IFN-γ (Wu etc., AIDS Res.Hum.Retrovir.13:1187; 1997).Can use and commercial obtainablely capture and detect mAbs and carry out ELISPOT and analyze (R﹠amp; D Systems and Pharmingen), as (Wu etc., Infect.Immun.63:4933 as described in the reference; 1995) and used before (Xu-Amano etc., J.Exp.Med.178:1309; 1993); (Okahashi etc., Infect.Immun.64:1516; 1996).Each is analyzed and all comprises mitogen (Con A) and ovalbumin contrast.

7. recombinant DNA technology

Be used to purchase the recombinant DNA method of building packaging strains, bacteria carrier and rdsRN and include, but not limited to PCR, restriction enzyme (being referred to herein as " RE ") digestion, DNA connects, agarose gel electrophoresis, DNA purifying, and dideoxy nucleotide order-checking, as (Miller, A Short Course in Bacterial Genetics, Cold Spring HarborLaboratory Press as described in the elsewhere, Cold Spring Harbor, NY; 1992); (Bothwell etc., mentioned above); And (Ausubel etc., mentioned above), bacteriophage mediated by protein transduction (deBoer, mentioned above); (Miller, mentioned above, 1992) and (Ausubel etc., mentioned above), or (Bothwell etc., mentioned above) of chemistry; (Ausubel etc., mentioned above); (Feigner etc., mentioned above); And Farhood, mentioned above), electroporation (Bothwell etc., mentioned above); (Ausubel etc., mentioned above); (Sambrook, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY; 1992) and physics transformation technology (Johnston etc., mentioned above); (Bothwell etc., mentioned above).Gene can be incorporated into (deEoQretal, Cell, 56:641-649 on the phage; 1989), (Curtiss etc., mentioned above) or montage are gone on the karyomit(e) of target bacterial strain (Hone etc., mentioned above) on the plasmid vector.

Can use Applied Biosystems ABI ^TM3900 high-throughput dna synthesizers (FosterCity, CA 94404 U.S.A.) synthetic gene sequence, its method is provided by manufacturers.For synthetic bigger sequence, promptly, can produce a series of full length sequence fragments by PCR, and use method well known in the art to connect the formation full length sequence greater than the sequence of 200bp.Yet less sequence promptly less than the sequence of 200bp, can be used Applied BiosystemsABI ^TM3900 high-throughput dna synthesizers (Foster City, CA 94404 U.S.A.) are synthetic in a round, and its method is provided by manufacturers.

Can use BioRad Gene-Pulser  to be set to 200 Ω, (BioRadLaboratories, Hercules CA) import bacterial isolates [38] by electroporation with recombinant plasmid for 25 μ F and 2.5kV.Can use standard automatization sequencing technologies (Applied Biosystems automatization sequenator 373A) that the nucleotide sequence of cDNA sequence is verified.Can use Applied BiosystemsABI ^TMThe synthetic dna primer that is used for dna sequencing and polymerase chain reaction (being called " PCR " herein) of 3900 high-throughput dna synthesizers (Foster City, CA 94404 U.S.A.).

The following examples that provided only are used as illustrative purpose, and should not carry out any restriction to scope of the present invention.

Embodiment

Embodiment 1: recombinant DNA method

Use restriction enzyme (being " RE ") herein according to manufacturers's explanation; (New EnglandBiolabs, Beverly, MA), the T4 dna ligase (New England Biolabs, Beverly, MA) and the Taq polysaccharase (Life Technologies, Gaithersburg, MD); According to the explanation of manufacturers use on a small scale (Qiagen MiniprepR kit, Santa Clarita, CA) or extensive (Qiagen MidiprepR kit, Santa Clarita, CA) the plasmid DNA purification kit prepare plasmid DNA (Qiagen, Santa Clarita, CA); Nuclease free, the deionized water that molecular biology is pure, Tris-HCl (pH 7.5), EDTA pH 8.0,1M MgCl ₂, 100% (v/v) ethanol, ultrapure agarose and agarose gel electrophoresis damping fluid are all available from Life Technologies, Gaithersburg, MD.Carry out digestion with restriction enzyme according to known method, PCR, DNA ligation and agarose gel electrophoresis (Sambrook, etc., mentioned above, 1989); (Ausubel, etc., mentioned above, 1990).In the following embodiments, the nucleotide sequence checking to each described recombinant plasmid dna sequence is to use Applied Biosystems automatization sequenator 373A to finish by the automatization dna sequencing technology of routine.

The PCR primer is available from Integrated DNA Technologies (Coralville, IA) or University of Maryland Biopolymer Facility (Baltimore, MD) and can use Applied Biosystems dna synthesizer (model 373A) to synthesize.The PCR primer uses with the concentration of 200 μ M, the annealing temperature of PCR reaction is then used Clone manager software 4.1 versions (Scientific and Educational Software Inc., Durham, NC) or OLIGO primer analysis software 4.0 versions determine.At Bio Rad iCycler (Hercules, CA) enterprising performing PCR.Be used for the amplification PCR primer and be to use Clone Manager  software 4.1 versions (Scientific and Educational Software Inc., Durham, NC) OLIGO primer analysis software 4.0 versions designs.This software can design the PCR primer and can discern and the corresponding to restriction endonuclease sites of operated specific DNA.PCR be Bio RadiCycler (Hercules finishes on CA), the primer annealing among the PCR, extend and the sex change time according to standard program setting (Ausubel etc., mentioned above).Use standard program digestion with restriction enzyme and PCR to be analyzed (Ausubel etc., mentioned above) subsequently by agarose gel electrophoresis; (Sambrook, mentioned above).

Intestinal bacteria Top10 and DH5 α available from Invitrogen (Carlsbad, CA) bacterial strain SCS110 then available from Stratagene (La Jolla, CA).It can be used as the host at recombinant plasmid described in following examples.(BioRad Laboratories, Hercules CA) are set at 200 Ω, and 25 μ F and 1.8kV transform or chemical conversion by electroporation, as (Ausubel etc., mentioned above) as described in the document recombinant plasmid are imported intestinal bacteria can to use Gene Pulser.

Unless stated otherwise, bacterial isolates all be grown in tryptic soy agar (Difco, Detroit, MI) go up or trypticase soya broth (Difco, Detroit, MI) in, under suitable temperature.As required, in substratum, replenish 100 μ g/ml penbritins, and 50 μ g/ml kantlex and/or paraxin 20 μ g/ml (Sigma, St.Louis, MO).Bacterial isolates is with about 10 ⁹The concentration of colony-forming unit (being referred to herein as " cfu ")/ml is suspended in and contains 30% (v/v) glycerine (Sigma, St.Louis, trypticase soya broth MO) (Difco) are stored in-80 ℃.

The reagent inventory

KpnI (New England Biolabs, Beverly, MA, Cat.Nos.R0142S), PstI (New England Biolabs, Beverly, MA, Cat.No.R0140S), trypticase soya broth (Difco, Detroit, MI, Cat.No.211822), tryptic soy agar (Difco, Detroit, MI, Cat.No.236920), Miniprep  plasmid DNA purification kit (Qiagen, Valencia, CA, Cat.No.27106), glycerine (Sigma, St.Louis, MO, Cat.No.G5516), HpaI (New England Biolabs, Beverly, MA, Cat.No.R0105S), calf intestine alkaline phosphatase (New England Biolabs, Beverly, MA, Cat.No.M0290S), Vent _R archaeal dna polymerase (New England Biolabs, Cat.No.M0254S), QIAquick PCR purification kit (Qiagen, Cat.No.28106, Valencia, CA), diaminopimelic acid (Sigma-Aldrich, St.Louis, MO, Cat.No.D1377), BglII (NeW England Biolabs, Beverly, MA, Cat No.RO 144S), IPTG (Invitrogen, Carlsbad, CA, Cat.No.15529-019), cell culture lytic reagent (Promega, Madison, WI Cat.No.E1531), N,O-Diacetylmuramidase (Sigma, St.Louis, MO, Cat.No.L6876), potassiumphosphate (Sigma, St.Louis, MO, Cat.No.P5379), magnesium chloride (Sigma, St.Louis, MO, Cat.No.M1028) DraIII (NewEngland Biolabs, Beverly, MA, Cat.No.R0510S), PstI (New EnglandBiolabs, Beverly, MA, Cat.No.V0279S), Proteinase K (Ambion, Austin, TX, Cat.No.2542-2548), Durascribe T7 transcript reagent box (Epicentre, Madison, WI), Durascribe SP6 transcript reagent box (Epicentre, Madison, WI), MEGAscript  T7 transcript reagent box (Ambion, Austin, TX, Cat.No.1334), MEGAscript  SP6 transcript reagent box (Ambion, Austin, TX, Cat No.1330), MEGAclear pillar (Ambion, Austin, TX, Cat No.1908), BrightStar biotinylated rna millennium marker (Ambion, Austin, TX, Cat.No.7170), BrightStar nylon membrane (Ambion, Austin, TX, Cat.No.10102), BrightStar biological detection reagent kit (Ambion, Austin, TX, Cat.No.1930), Tris-HCl damping fluid (Quality Biological, Gaithersburg, MD, Cat.No.351-007-100), magnesium chloride (Sigma-Aldrich, St.Louis, MO, Cat.No.M 1787), ammonium acetate (Sigma-Aldrich, St.Louis, MO, Cat.No.A2706), sodium-chlor (Sigma-Aldrich, St.Louis, MO, Cat.No.S7653), Repone K (Sigma-Aldrich, St.Louis, MO, Cat.No.P3911), dithiothreitol (DTT) (Sigma-Aldrich, St.Louis, MO, Cat.No.D9779), EDTA (Sigma-Aldrich, St.Louis, MO, Cat.No.E8008), Macrogol 4000 (Fluka, Buchs, Switzerland, Cat.No.95904), SUPERase RNase inhibitor (Ambion, Austin, TX, cat.No 2694,), vitamin H-14-CTP (Invitrogen, Carlsbad, CA, Cat.No.19519-016), RNase ONE rnase (Promega, Madison, WI, Cat.No.M4261)

Embodiment 2: remedy the asd sudden change and express fluorescence reporter and Mycobacterium tuberculosis antigen and the segmental structure of the antigenic rdsRNA of LCMV

The purpose of this research is the exploitation recombinant fragment, and it can be integrated into (Mindich etc., J.Bacterid, 181:4505 based on the genomic prototype rdsRN of phi-8 dsRNA; 1999); (Mindich, Microbiol.MoI.Biol.Rev, 63:149; 1999); (Hoogstraten etc., Virology, 272:218; 2000); (Sun etc., Virology, 308:354; 2003).As mentioned above, the genome of phi-8 is by three fragment: S, and M and L form.Can make up prototype rdsRN, therefore the RNA polymerase that relies on by the RNA of wild-type fragment-L (being referred to herein as " wtL ") coding passenger's gene (passenger gene) of expressing be cloned into recombinant fragment-M and-S (being hereinafter referred to as " rM " and " rS " in this article).RM and rS all respectively the coding wild-type aspartate-semialdehyde dehydrogenase gene that is connected in gene 10 and gene 8 bacterial ribosome binding sites (be referred to herein as " asd ", GenBank#V00262) (referring to Fig. 4) and the functional goal gene (that is, fluorescin HcRed and mycobacterium antigen TBS) that is connected in hepatitis C virus IRES.It should be noted that, fragment-M and-phage structure gene on the S be not incorporated on rM or the rS at the very start, replaced the asd allelotrope of rS and stablized described rdsRN although specialize the gene 8 that has used wild-type fragment-S in the process in the later stage of the present invention.5 ' and 3 ' flank of asd allelotrope and IRES::HcRed and Mtb antigen encoding sequence is respectively untranslated sequence and the synthetic homing sequence of strand RNA of coding pac.In other words, the 5 ' flank of the reporter gene on the rM is that pac sequence and the 3 ' flank of fragment M are the terminator sequence of fragment M.Similarly, rS is the reporter gene formation (Fig. 5) of the pac sequence of fragment S and the terminator sequence that 3 ' flank is fragment-S gene by 5 ' flank.It should be noted that such structure only to allow the generation of rdsRN and can not form phage or rdsRP particle.

Can use synthetic DNA and standard recombinant dna technology, PCR for example, RT-PCR, site directiveness mutagenesis, Restriction Enzyme digestion, gel electrophoresis connects, the dideoxy nucleotide order-checking, and bacterium transforms the structure of finishing recombinant fragment, as described in embodiment 1.

Can pass through Midland Certified Reagent Co., (Midland, TX) synthetic recombinant fragment-S (rS).The modification of adopting the following stated has obtained 5 '-and 3 '-sequence from the cDNA copy (being so kind as to give GenBank accession number AF226853 by Dr.Leonard Mindich) of phi-8 fragment-S.Direction 5 ' to 3 ', rS (SEQ ID NO:1) forms (Fig. 4) by following fusion composition:

(i) the S pac sequence of gene 8 and ribosome bind site (being referred to herein as " RBS ") are preceding 187 Nucleotide of fragment-S (GenBank accession number AF226853), and absorbed necessary (Hoogstraten etc. by procapsid, mentioned above, 2000).RBS is that translation initiation is necessary in the prokaryotic cell prokaryocyte.

(ii) in order to carry out the positive functional asd gene of selecting that is connected in above-mentioned RBS in Δ asd intestinal bacteria X6212 kind.Described asd sequence comes from the 240-1343 base of GenBank accession number V00262.

(iii) be used for starting the hepatitis C virus internal ribosome entry site of translation at eukaryotic cell.This sequence has been crossed over the 36-341 base of GenBank accession number AJ242651.

(iv) be used to mix the multiple clone site (MCS) of passenger's gene.

(Xi Menli gram forest virus (SemlikiForest virus) 3 ' non-translational region that v) is used for rS mRNA polyadenylic acidization; The 1-261 base of GenBank accession no.V01398.

(it is rna stability and combined necessary with the phi-8 polysaccharase before the synthetic starting of strand RNA for the vi) 3 ' terminator sequence of phi-8 fragment-S, i.e. the 3081-3192 base of fragment-S (GenBank accession number AF226853).

Use the T4 dna ligase, will connect into by the synthetic DNA fragment that mentioned component constituted PstI-digestion pT7/T3-18 DNA (Cat.No.7201, Ambion, Austin, TX) in, as described in embodiment 1.After connecting, use electroporation (embodiment 1) that DNA is imported coli strain DH5 α-E (Invitrogen, Carlsbad, CA, Cat.No.11319-019), by on the TSA that is supplemented with penbritin (100 μ g/ml), cultivate 16-24 hour separation transformant at 37 ℃.Can identify successful connection product by from the 2ml culture, separating super coiled DNA, described culture is with puncture gained mono-clonal and described toothpick put into the aseptic TSB that is supplemented with penbritin (100 μ g/ml) and inoculate of aseptic toothpick; Culture was cultivated 16-24 hour in 37 ℃ of vibrations (200opm).Abandon the liquid supernatant liquor after centrifugal, and bacterial precipitation is resuspended in 100 μ l Miniprep  plasmid DNA purification kits, and (CA is among solution P1 Cat.No.27106) for Qiagen, Valencia.Then according to the guidance extraction and the plasmid DNA purification (referring to Qiagen, Valencia, CA, Cat.no.27106 Guide Book) of manufacturers.According to the guidance of manufacturers,, and use damping fluid that manufacturers provides and hatched 1 hour at 37 ℃ with the plasmid DNA of restriction enzyme PstI (New EnglandBiolabs, Beverly, MA, Cat no.R0140S) digestion purifying.Carry out branch (referring to embodiment 1) and the plasmid that shows suitable collection of illustrative plates is further characterized (embodiment 1) by the dna fragmentation of agarose gel electrophoresis as previously mentioned by dideoxy sequencing to gained.This method identifies 4 isolates of plasmid pT7/T3-18 that independently carry the DNA of coding rS.Four kinds of isolates that plasmid in these isolates is designated as AF1 and will carries this plasmid are gone up line and were cultivated 16-24 hour at 37 ℃ at the TSA that is supplemented with penbritin (100 μ g/ml).Use subsequently aseptic cotton carrier collect bacterium (Puritan, Guilford, ME, Cat.No.25-8061WC), with about 10 ⁹The density of cfu/ml is suspended in and contains 30% (v/v) glycerine (MO among TSB Cat.No.G5516), is stored in-80 ℃ with the aliquot of 1ml for Sigma, St.Louis.

Carry out pcr amplification by 1-1294bp and made up second rS (rS2) phi-8 wild-type fragment-S sequence (GenBank accession number AF226853), this S sequence is to be connected in hepatitis C IRES and to be positioned at the downstream of rS (bp1301-2020) sequence by the BglII site, (rS2, SEQ ID NO:3) as mentioned above.This construct is connected into PstI site and the transformed into escherichia coli Top10 of pT7T3-18.Analyze transformant as mentioned above, and 6 correct isolates are called pAF1S2.

Except 5 ' pac and 3 ' terminator sequence come from wild-type fragment-M respectively, Nucleotide 1-262 and the 4677-4741 of GenBank accession number AF226852, recombinant fragment-M (rM, SEQID NO:2) and rS are closely similar.Therefore, just as rS, rM is constituted (referring to Fig. 4) by phi-85 ' pac and 3 ' terminator sequence as the exogenous array of its flank.2060bprM (SEQ ID NO:2) is cloned into plasmid pcDNA3.1 _Zeo(+) (Invitrogen, Cat.No.V860-20, Carlsbad, KpnI CA) and PstI site (being respectively New EnglandBiolabs, Beverly, MA, Cat.Nos.R0142S and R0140S).Employing is applicable to that the method for rS identifies the recombinant plasmid that carries suitable inset, and with novel plasmid called after pAF19.

In order to make up the eukaryotic expression box, (MA Cat.No.R0105S) digests pAF1 for New England Biolabs, Beverly to use HpaI and NotI.Such digestion with restriction enzyme has caused the directed cloning site within the multiple clone site, thereby makes, in case connected, Hc-Red gene and mycobacterium antigen packing just can directly be in HCV IRES the downstream and with its functional connection.After digestion, can use calf intestine alkaline phosphatase (NewEngland Biolabs, Beverly, MA, thus Cat.No.M0290S) the terminal dephosphorylation of linear plasmid is prevented recirculation.In 0.8% sepharose, dephosphorylized plasmid is carried out purifying by gel extraction subsequently by electrophoresis.

2.0kb mycobacterium antigen fusion sequence (TBS) be to use Accuprime archaeal dna polymerase (Invitrogen, Carlsbad, CA) by PCR from plasmid pAdApt35.Bsu.TB.S (Crucell) with comprised HpaI and the primer amplification of NotI restriction endonuclease sites obtains.Verified the size of extension increasing sequence by agarose gel electrophoresis, and (Valencia CA) has carried out purifying for Qiagen, Cat.No.28106 to use QIAquick PCR purification kit according to the guidance of manufacturers.

(New England Biolabs, Cat.No.M0202S) will the encode fragment of TB.S connects into dephosphorylized pAF1, and the gained plasmid is appointed as pSTB2 to use the T4 dna ligase.

Can use above-mentioned recombinant DNA technology, TBS antigen fusion sequence and HC-Red encoding sequence are inserted HpaI site (Fig. 4) on the entrained pAF19 of rM similarly.The gained plasmid is called as pMTB7 and pMHc-Red.

Use restriction enzyme SphI and PsiI to make plasmid pSTB2 and pLM2775 (encoding wild type fragment-S) linearizing, and gained linearizing fragment is carried out purifying and extraction by agarose gel electrophoresis.Can use SphI and PsiI that plasmid pSTB7 and pMHc-Red are carried out linearizing similarly.Guidance according to manufacturers, each linearizing dna sequence dna from four kinds of digestion with restriction enzyme all can be used as Durascribe T7 (Epicentre, Madison, WI) template of in-vitro transcription reaction, thereby produce wtS, the rM of the rM of the rS of coding for antigens TBS, coding for antigens TBS and coding Hc-Red fluoridizes rna transcription originally.

Similarly, but the 3rd group of rdsRNA fragment of the glycoprotein antigen GP-1 of construction expression lymphocytic choriomeningitis virus (lymphocyticchoriomenengitis virus) (being referred to herein as " LCMV ") and GP-2.Can go up the fragment that pcr amplification obtains 1511bp from the plasmid pCMV-GP that coding is positioned at GP polyprotein precursor on the LCMV genome macrochromosome.This sequence be to use the Accuprime archaeal dna polymerase (Invitrogen, Carlsbad, CA) and comprise that the primer amplification of HpaI and NotI restriction endonuclease sites obtains.Verified the size of extension increasing sequence by agarose gel electrophoresis, and (Valencia CA) has carried out purifying for Qiagen, Cat.No.28106 to use QIAquick PCR purification kit according to the guidance of manufacturers.Use restriction enzyme HpaI and NotI (New England Biolabs, Beverly, MA, Cat.No.R0105S), and use calf intestine alkaline phosphatase (New England Biolabs, Beverly to plasmid pAF1S2 and pAF19 linearizing, MA, Cat.No.M0290S) dephosphorylation.Similarly, use HpaI and NotI digest the GP encoding sequence and connect in linearizing pAF1S2 and the AF19 plasmid, obtain plasmid pSGP1 and pMGP2.The GP polyprotein precursor-gene of the HCV IRES of these plasmids so encoded respectively functional rS2 of being connected in and rM.

Use RE ' s KpnI and PsiI that pSGP1 and pMGP2 are digested respectively, thereby as the template of in-vitro transcription.According to the guidance of manufacturers, (WI) the in-vitro transcription test kit produces from every kind of plasmid and fluoridizes rna transcription originally for Epicentre, Madison can to use DurascribeT7.The transcript of gained encoded thus GP-1 and GP-2 antigen sequence within rS2 and rM.

Embodiment 3: the structure of bacterial strain is packed and sent to prototype

The purpose of this research is to make up the prototype bacterial packaging strains.Shigella flexneri (Shigellaflexneri) has non-response karyomit(e) asd mark and inserts deletion mutantion, thereby caused to produce the defective of aspartate-semialdehyde dehydrogenase (being referred to herein as " ASD "), and lack ability (Sizemore etc., the Vaccine.1997 Jun of synthetic cell wall composition diaminopimelic acid (being referred to herein as " DAP ") thus; 15 (8): 804-7).Lack under the condition that heredity remedies growth needs in substratum, replenish 50 μ g/ml DAP (Sigma-Aldrich, St.Louis, MO, Cat.No.D1377).

Though Shigellae is only selected as example, its invasion property feature and make it become the ideal delivery vector equally for the natural trend of mucosal immunity cell.Just as the asd sudden change need remedy by the allelic rdsRN of coding asd, come this bacterial strain of attenuation to make it enter mammalian cell cracking afterwards and discharge rdsRN thereby be necessary to make up second chromosome damage equally.By pcr amplification about 1kb zone of murI gene (coding glutamate racemase) upstream and downstream, the PCR primer by coding NheI site connects, and connects into pCVD442 (refX) under the help of coding SstI and XbaI site primer.By engaging the gained plasmid is shifted with shigella flexneri (S.flexneri).By antibiotics resistance, sucrose susceptibility and pcr analysis identify integrating altogether, and resolve by method known in the field, thereby produced asd, murI bacterial strain MPC51.MurI sudden change makes cell can not synthesize peptidoglycan components D-L-glutamic acid, and need replenish 50 μ g/ml D-L-glutamic acid could obtain to grow normally in the basic growth medium of M9.HeLa cell invasion analyze the described bacterial strain of explanation be have an invasion property but can not prolong intracellular survival (Fig. 7)

Can carry out trans remedying by the expression of coding asd among the rdsRN in order to determine whether this auxotroph demand, can use pLM2653 to transform shigella flexneri (S.flexneri) MPC51, pLM2653 is to express wtL mRNA under the control of SP6 promotor and is the essential and sufficient proteic plasmid of the condition phi-8 (Sun etc. of generation assembling procapsid institute, Virology, 308:354; 2003).Import plasmid pLM2653 by electroporation, and select by adding 100 μ g/ml penbritins.

Can assembling measure by natural and the cell lysate SDS-sex change being carried out difference is filtered and to the procapsid among the MPC51pLM2653, it is to carry out (Fig. 8) that immunoblotting is analyzed by the antiserum(antisera) that uses the procapsid protein-specific.In brief,, can illustrate that procapsid albumen (87kDa and 34Da) can not be the film of 100kDa by shut off value because the desired molecular weight of every kind of procapsid is 15MDa, unless with 10%SDS lysate is handled, thus illustrated that (Fig. 8) takes place in assembling.In addition, the transmission electron microscope photo of thin layer section MPC51pLM2653 has clearly illustrated that the procapsid particle (Fig. 9) of a large amount of about 60nM.

Embodiment 4: the segmental ssRNA of the rdsRNA that will encode imports the prototype packaging strains and start functional self-replacation rdsRN in described bacterial strain

Research purpose in the present embodiment is a kind of method of exploitation, thereby starts in bacterial packaging strains and keep rdsRN.The construct that selected strategy relates to the ssRNA (+) of coding rM and rS described in the external synthetic embodiment 2 transforms packaging strains, shigella flexneri (S.flexneri) MPC51pLM2653 (embodiment 3).After entering MPC51pLM2653, the packaged procapsid that enters of ssRNA (+), it is synthetic meanwhile to finish minus strand, has made up rdsRN (Fig. 6) thus.Described rdsRN has synthesized coding wtL subsequently, the mRNA of rM and rS mRNA (being ssRNA (+)), and this mRNA can be from described rdsRN passive secretion to the carrier strain cell (Fig. 6).These transcripts are by expressing wtL, and rM and rS have produced more procapsid, and described wtL, rM and rS carry functional asd gene, and it remedies the asd sudden change among the MPC51, has eliminated the necessary DAP of growth thus.WtL, rM and rS mRNA are packed in the procapsid too, have formed extra rdsRN thus.

Use standard technique (Ausubel etc., mentioned above) to prepare the electroreception attitude cell of MPC51pLM2653.In brief, mono-clonal grown at 37 ℃ be supplemented with penbritin (100 μ g/ml), (MO is in M9 minimum medium Cat.No.D1377) for Sigma-Aldrich, St.Louis for kantlex (50 μ g/ml) and 50 μ g/ml DAP.With OD ₆₀₀＜0.1 50ml culture begins, at the logarithmic phase collecting cell, at OD ₆₀₀0.3-0.6 between.Cell is washed one time with ice-cooled 5mM EDTA, 10% glycerine (v/v), uses ice-cooled 10% glycerine (v/v) to give a baby a bath on the third day after its birth time then, all centrifugal with 4000xg after washing at every turn.After washing the last time and rotating, cell is resuspended in 10% (v/v) glycerine, carries out packing and be stored in-80 ℃ with 200 μ l.

Being used for the rS of electroporation MPC51pLM2653 and the ssRNA (+) of rM uses linearizing pSTB2 and pMTB7 as the external synthetic of dna profiling, as described in embodiment 2 respectively.With 2 μ g ssRNA (+) (1.0 μ g rS+1.0 μ g rM) electroporation MPC51 pLM2653 cell.Electroporation is to use Gene-Pulser, is set to 200 Ω, and (BioRad, Hercules CA) carry out for 25mcF and 1.8kV.Allow cell not contain antibiotic SOC substratum (Carlsbad recovered 2 hours in CA) for cat#15544-034, Invitrogen being supplemented with 50 μ g/mlDAP at 28 ℃.Afterwards, have suitable microbiotic, replenishing 50 μ g/ml D-L-glutamic acid and be lower than and support MPC51 pLM2653 to grow under the condition of 0.1 μ g/ml DAP of necessary DAP minimum concentration, cell is dispersed on the M9 agar.Allow cell to grow at 25-27 ℃, it is transferred to M9 Ap/Kn/D-L-glutamic acid and DAP is added to 0.01 μ g/ml or taking-up then.At 22-25 ℃ of culturing cell, because pLM2653, institute's DCRP is an amicillin resistance, and owing to asd expression of gene on rS and rM, institute's DCRP is the non-dependence of DAP-.

In order to improve growth characteristics, use from pMTB7 and the ssRNA that comes as the plasmid pLM2775 in-vitro transcription of the encoding wild type fragment-S in the source of gene 8 MPC51pLM2653 is carried out electroporation.Carry out this program and growth step subsequently as mentioned above, the DAP-independent form MPC51 bacterial strain of gained carries the rdsRN (Figure 10) of called after LSMtb4.

Similarly, can be from being connected in the proteic pMHc-Red in-vitro transcription of Hc-Red of rM IRES and the ssRNA electroporation MPC51pLM2653 that comes as the plasmid pLM2775 of the encoding wild type fragment-S in the source of gene 8 with from encoding function.Carry out this program and growth step subsequently as mentioned above, the DAP-independent form MPC51 bacterial strain of gained carries the rdsRN of called after LSMHc-Red.

In the 3rd example, the ssRNA that comes from the coding antigenic rS2 of LCMV GP (comprising gene-8) construct pSGP1 in-vitro transcription is used to alleviate to the demand from gene-8 sequence of wtS.As described above in Example, can use from pSGP1 and RNA electroporation shigella flexneri (S.flexneri) MPC51pLM2653 that comes from the pMGP2 in-vitro transcription.Carry out growth step subsequently as mentioned above, the DAP-independent form MPC51 bacterial strain of gained carries the rdsRN of called after LSgpMgp.By using the specific antiserum(antisera) of nucleocapsid that full cell lysate is carried out immunoblotting and use is specific to (+) chain of rS2 and rM and the primer of (-) chain carries out the existence that RT-PCR has proved conclusively rdsRN.

It should be noted that, unless be attended by the plasmid of wtL ssRNA or coding wtL, plasmid with the wtL that encodes perhaps carried out conversion to the target bacterial strain, otherwise, with the ssRNA of the rS of arbitrary combination and rM in-vitro transcription MPC51 was carried out electroporation and can not produce transformant.In addition, before MPC51pLM2653 was carried out electroporation, the ssRNA that handles in-vitro transcription with RNAse A can cause being recovered to transformant.As showing the RNA electroporation, by the cell-free transcription folder electroporation of all three kinds of wild-type fragments being entered pseudomonas syringae (Pseudomonas syringae) (natural host of phi-8) with above-mentioned identical method as the efficient that produces rdsRN and the other example of effect.This has caused the reconstruct of wild-type cracking bacteriophage phi-8, as by plaque from the lawn of electroporation gained form and from the inner wild type phage particulate of electroporation gained pseudomonas syringae transmission electron microscope view proved (Figure 12).

As if the DAP-independent form come from by asd on different rdsRN coding rS and/or the rM RNA ⁺The amplification of gene.In fact, use the primer to minus strand or positive chain RNA specific amplification, the RT-PCR that the total RNA that carries above-mentioned rdsRN bacterial strain is carried out analyzes the recovery that has caused rS and rM cDNA.Recall, the minus strand in phage is synthetic to be occurred over just after the absorption of whole three kinds of genomic fragments.In this specification sheets of submission, in surpassing 3 months cultured continuously, the shigella flexneri (S.flexneri) that carries rdsRN LSMtb4 and LSMHc-Red still keeps the DAP-dependent/non-dependent.Finally, these constructs produce continuously can detected glutelin by immunoblotting, and has seen the assembling (Figure 11) of nucleocapsid by transmission electron microscope.

To sum up, therefore, these presentation of results remedying of asd disappearance in MPC51pLM2653 is that RNA absorbs and packing and the result of rdsNC self-replacation function in packaging strains.These find that further these methods of proof produce the rdsRN that can keep in obtained strains.

Embodiment 5: the expression of rdsRN encoding sequence in mammalian cell

Though scope of the present invention is not limited to by using bacterial packaging strains that rdsRN is delivered in mammalian tissues or the organism, but because its natural invasive in numerous tissue culture cells systems and animal model, for the purpose (embodiment 3 and 4) of example is utilized the invasive bacterium-shigella flexneri of attenuation (Shigella flexneri) MPC51.Thereby as described in the embodiment 3 to this bacterial strain carry out through engineering approaches can be after invading eukaryotic cell the cracking bacterial cell, thereby and in avoiding endocytic vesicle rdsRN is released in the eukaryotic tenuigenin.

As first-line evidence, selection be the MPC51 that carries rdsRN LSMtb4.What this rdsRN construct was encoded is the Mycobacterium tuberculosis antigen packing that is called as TBS.The definite formation of this packing is not most important to the present invention, yet for indicative purpose, the component of this antigen packing is the sequence of proteins encoded antigen 85A.As described in embodiment 2, the antigen packing is connected in HCV IRES sequence, and is under the translation control of this sequence.The shortage that the TBS construct is expressed within the bacterial isolates that carries this rdsRN (MPC51+LSMtb4) can (UK) immunoblotting of the full cell lysate of detection antigen 85A proves for Abeam, Cambridge by using polyclonal antiserum.

At 37 ℃, 5%CO ₂, on the cover glass of 6-hole tissue culture flasks, with HeLa cell (Invitrogen, Carlsbad is CA) at DMEM+10% foetal calf serum (FBS) (Invitrogen, Carlsbad, CA)+1% (Invitrogen, Carlsbad CA) grow at least 60% and converge microbiotic/antimycotic solution.Meanwhile, at 28 ℃, under oscillating condition, in 50ml M9, shigella flexneri (S.flexneri) MPC51+LSMtb4 is grown to OD ₆₀₀Be at least 0.6.Before invading analysis 24 hours, substratum is removed from the HeLa cell and used DMEM+10%FBS to replace.Before invading 2 hours, use DMEM to replace the HeLa cell culture medium, leave standstill growth with the bacterial cultures dilution and at 37 ℃.Use N ₂With the O in the incubator for tissue culture ₂Concentration is reduced to 1%, will add the HeLa culture with 100 infection multiplicity (MOI) with the MPC51+LSMtb4 suspension among the washed DMEM of PBS, and hatch 1 hour.Simultaneously, shigella flexneri 15D (asd) and the MPC51pLM2653 bacterial suspension with similar preparation adds in the hole of HeLa cell in an identical manner.

After one hour invasive is hatched; wash the HeLa cell twice with PBS; change gentamicin sulphate (Sigma, St.Louis, MO) 1 hour any residual bacterial cell of substratum (DMEM+FBS) and additional 150 μ g/ml to kill not intrusion and not protected by the HeLa cell.At this concentration gentamicin antiseptic-germicide that is wide spectrum, but can not pass eukaryotic cell membrane.After one hour, use fresh DMEM+FBS to replace substratum, and tissue culture cells is positioned over 37 ℃, 5%CO ₂Hatched 14 hours.

Take out cover glass then with HeLa cell, PBS (pH 7.4) with 2% Paraformaldehyde 96 is fixing, the Triton-X100 (pH 7.4) that is dissolved in PBS with .1% permeates, and uses 3%BSA, 5% normal goats serum, the PBS sealing of 0.05% sodiumazide (pH 7.4) 2 hours, use was diluted in 1%BSA with 1: 100,3%NGS, antigen 85A specific antisera (the IgY) (Abeam of the PBS of 0.05% sodiumazide (pH 7.4), Cambridge MA) surveys.Use subsequently to be diluted in 1%BSA at 1: 100,3%NGS, the FITC-link coupled rabbit of the PBS of 0.05% sodiumazide (pH 7.4) resists-IgY Abeam, Cambridge, MA) pair cell is counter surveys (counter-probed), and uses fluorescent microscope to detect.Be not exposed to any bacterium, shigella flexneri 15D, or the contrast HeLa groups of cells of MPC51pLM2653 does not show the indicative fluorescence that antigen 85A expresses.The HeLa cell that is exposed to invasive MPC51+LSMtb4 has bright fluorescence (Figure 13) in cell, indication antigen 85A expresses the part as the TBS antigen coalescence protein.It should be noted that the expression that in Shigellae packing/carrier bacterial strain, does not detect antigen 85A once more, and after 14 hours hatch, be not recovered to Shigellae alive.This is the definite evidence that rdsRN produces the Mammals translation of recombinant fragment mRNA.

To be similar to mode mentioned above, use MPC51+LSMHc-Red to invade the HeLa cell, MPC51+LSMHc-Red has direct fluorescence Hc-Red gene order coded on its rM fragment.After intrusion exposed 12 hours, HeLa cell cover glass was fixed and observes under fluorescent microscope.Shigella flexneri 15D, or the MPC51pLM2653 control group does not show Hc-Red fluorescence; The HeLa cell that MPC51+LSMHc-Red exposes then has direct fluorescence (Figure 14).Because being Hc-Red, the further evidence of this fluorescence expresses, so with the HeLa cell fixation and use the specific antibody of Hc-Red to survey, and use anti-detection of secondary antibodies binding substances.Again, the cell that only is exposed to MPC51+LSMHc-Red has fluorescence (Figure 15).In addition, use immunoblotting that can not be independent or the direct fluorescent microscope analyzing and testing of MPC51+LSMHc-Red Hc-Red express.By direct viewing fluorescence and proteic immunodetection, the result of these combinations provides the RNA of rdsRN coding to translate into proteinic evidence at mammalian cell.At last, because the Shigellae that does not have or only have minority to live can be recovered at this time point, exposed RNA has definite transformation period, and have only (+) chain or mRNA can be translated into coded albumen, the source of the information of very clear translation is the mRNA that is produced by rdsRN after the bacterial strain cracking is packed/sent to the HeLa cell interior.

Embodiment 6: the exemplary sequence of recombinant fragment-S and recombinant fragment-S2

With reference to Fig. 4, below be to can be used for implementing the exemplary sequence that the present invention makes up recombinant fragment-S (rS).

PstI：

ctgcag

The bacteriophage phi-8 fragment-Spac of gene-8 and ribosome bind site 187 (the 1-187 base of fragment-S, GenBank accession number AF226853):

gaaattttca?aatcttttga?ctatttcgct?ggcatagctc?ttcggagtga?agccttccct

gaaaggcgcg?aaggtcccca?ccagctcggg?gtgattcgtg?acatttcctg?ggatctcgga

gtcagctttg?tctctaggag?actgagcgtt?cggtctcagg?tttaaactga?gattgaggat

Aaagaca (SEQ ID NO:1) → be connected in asd gene

Intestinal bacteria asd (the 240-1343 base of GenBank accession number V00262):

atgaaaaatgt?tggttttatc?ggctggcgcg?gtatggtcgg?ctccgttctc?atgcaacgca

tggttgaaga?gcgcgacttc?gacgccattc?gccctgtctt?cttttctact?tctcagcttg?gccaggctgc

gccgtctttt?ggcggaacca?ctggcacact?tcaggatgcc?tttgatctgg?aggcgctaaa

ggccctcgat?atcattgtga?cctgtcaggg?cggcgattat?accaacgaaa?tctatccaaa

gcttcgtgaa?agcggatggc?aaggttactg?gattgacgca?gcatcgtctc?tgcgcatgaa

agatgacgcc?atcatcattc?ttgaccccgt?caatcaggac?gtcattaccg?acggattaaa

taatggcatc?aggacttttg?ttggcggtaa?ctgtaccgta?agcctgatgt?tgatgtcgtt?gggtggttta

ttcgccaatg?atcttgttga?ttgggtgtcc?gttgcaacct?accaggccgc?ttccggcggt

ggtgcgcgac?atatgcgtga?gttattaacc?cagatgggcc?atctgtatgg?ccatgtggca

gatgaactcg?cgaccccgtc?ctctgctatt?ctcgatatcg?aacgcaaagt?cacaacctta

acccgtagcg?gtgagctgcc?ggtggataac?tttggcgtgc?cgctggcggg?tagcctgatt

ccgtggatcg?acaaacagct?cgataacggt?cagagccgcg?aagagtggaa?agggcaggcg

gaaaccaaca?agatcctcaa?cacatcttcc?gtaattccgg?tagatggttt?atgtgtgcgt

gtcggggcat?tgcgctgcca?cagccaggca?ttcactatta?aattgaaaaa?agatgtgtct

attccgaccg?tggaagaact?gctggctgcg?cacaatccgt?gggcgaaagt?cgttccgaac

gatcgggaaa?tcactatgcg?tgagctaacc?ccagctgccg?ttaccggcac?gctgaccacg

ccggtaggcc?gcctgcgtaa?gctgaatatg?ggaccagagt?tcctgtcagc?ctttaccgtg

ggcgaccagc?tgctgtgggg?ggccgcggag?ccgctgcgtc?ggatgcttcg?tcaactggcg

Taa (SEQ ID NO:2) → be connected in IRES

Hepatitis C virus-IRES (the 36-341 base of GenBank accession number AJ242651):

atcactcccc?tgtgaggaac?tactgtcttc?acgcagaaag?cgcctagcca

tggcgttagtatgagtgtcg?tgcagcctcc?aggacccccc?ctcccgggag?agccatagtg

gtctgcggaaccggtgagta?caccggaatt?gccaggacga?ccgggtcctt?tcttggatca

acccgctcaatgcctggaga?tttgggcgtg?cccccgccag?actgctagcc?gagtagtgtt

gggtcgcgaaaggccttgtg?gtactgcctg?atagggtgct?tgcgagtgcc?ccgggaggtc

Tcgtagaccgtgcaccatg (SEQ ID NO:3) → be connected in multiple clone site

Multiple clone site and terminator codon:

atg?gtt?aac?gcg?gcc?gct?taa?tta?ata?aat?aaa?taa(SEQ?ID?NO：4)

→ be connected in SFV-3 ' non-translational region

Xi Menli restrains forest virus 3 ' non-translational region (the 1-262 base of GenBank accession number V01398):

gttagggta?ggcaatggca?ttgatatagc?aagaaaattg?aaaacagaaa?aagttagggt

aagcaatggc?atataaccat?aactgtataa?cttgtaacaa?agcgcaacaa?gacctgcgca

attggccccg?tggtccgcct?cacggaaact?cggggcaact?catattgaca?cattaattgg

caataattgg?aagcttacat?aagcttaatt?cgacgaataa?ttggattttt?attttatttt?gcaattggtt

Tttaatattt cc (SEQ ID NO:5) → be connected in φ 8 fragments-S 3 ' RNApol binding site

Phi-8 fragment-S 3 ' polymerase binding site point (the 3081-3192 base of GenBank accession number AF226853):

gcttagcggc?aatcgaaccc?tccg?xcataagg?aggtttagca?aatccgcggc?tcttatgagc

tgtccgaaag?gacaacccga?aagggggagc?gaggacttcg?gtcctccgct?cc(SEQ?ID?NO：6)

PstI：

ctgcag

With reference to Fig. 4, below be to can be used for implementing the exemplary sequence that the present invention makes up the recombinant fragment-S2 (rS2) of encoding wild type phage phi-8 gene 8.

PstI：

ctgcag

Bacteriophage phi-8 fragment-S pac (1-187bp of GenBank accession number AF226853):

gaaattttcaaatcttttgactatttcgctggcatagctcttcggagtgaagccttccctgaaaggcgcgaag

gtccccaccagctcggggtgattcgtgacatttcctgggatctcggagtcagctttgtctctaggagactga

gcgttcggtctcaggtttaaactgagattgaggataaagaca

(SEQ?ID?NO：1)

The bacteriophage phi-8 gene 8 of fragment-S (bp188-1291 of GenBank accession number AF226853):

atgggtagaatctttcaactgttgatgcgcttaggcgttaaacagggtgcagcaagtgttggtaaagccggg

atcgatgctggtagcaagcgattgctccagcagatcatgtccaaagacggtgctattcagctgtctaaggc

actcggtttcaccgctgtggagcagatgtcgagtgaagtgctcgaagcgtatctctatgagatcgttgagca

tcttctgctcgtcgacgaggccacgttggccgatgcgcttatggcgtgtatcaccgatgcaggtgatatcgc

cattgagcgtctgcttccttccgtagaggatgtcgacaaaggcgaggcgcttgccgccacgctgactgtcg

tcttggctctcttctcgatgaacaaagaacaagctgaagagcttaaacgttcgatggcatcgaaaggcttga

gtccggaccgggttaccctcggaggacagaccctgttgaccgtcaagtccactggtactggcctgacaga

gtatgacgctcaaggcaagaatggcgtccctcgcgggatgtctgctaacaagcgtactgcattgttcttcgt

gctgtacacagtgatcagtacttcctggtccgtatacgatcactatggtgaggttaaagctggtctcgcacga

ggcgagctacctcccagtgctgatcgtgttgaattgcgggcccccggttcctccgtaagtgcgatcgagcg

tgagacacaacgcgcactgcaagaagaacagccgcgtgcattgccttcgggcagccgcaccgcggaac

gggttgctgggccgacgcagggtgatgtccccgtgctcacacctccgccaggtcgattcaccttcaccgg

tgagggcgaccatcgtcccgatttcgcacaactcgctcgccagaacgacactgatggcgttgtgcggatc

attgaactggatcgcattccagatgcaaggaaaatattagtcgatggtgaccatgactacttgctggacgcc

gctcaacagcgcgtcgctgccgatatcggggtatcgcccgagtcagtaggtcgattcgctgctctggtagc

cagtatcatcaacgcgaaggagaagcgttcg?tgatgc(SEQ?ID?NO：7)

BglII：

agatct

→ be connected in IRES

Hepatitis C virus-IRES (36-341bp of GenBank accession number AJ242651):

atcactcccc?tgtgaggaac?tactgtcttc?acgcagaaag?cgcctagcca

tggcgttagtatgagtgtcg?tgcagcctcc?aggacccccc?ctcccgggag?agccatagtg

gtctgcggaaccggtgagta?caccggaatt?gccaggacga?ccgggtcctt?tcttggatca

acccgctcaatgcctggaga?tttgggcgtg?cccccgccag?actgctagcc?gagtagtgtt

gggtcgcgaaaggccttgtg?gtactgcctg?atagggtgct?tgcgagtgcc?ccgggaggtc

Tcgtagaccgtgcaccatg (SEQ ID NO:3) → be connected in multiple clone site

Multiple clone site and terminator codon:

atg?gtt?aac?gcg?gcc?gct?taa?tta?ata?aat?aaa?taa(SEQ?ID?NO：4)

→ be connected in SFV-3 ' non-translational region

Xi Menli restrains forest virus 3 ' non-translational region (the 1-262 base of GenBank accession number V01398):

gttagggta?ggcaatggca?ttgatatagc?aagaaaattg?aaaacagaaa?aagttagggt

aagcaatggc?atataaccat?aactgtataa?cttgtaacaa?agcgcaacaa?gacctgcgca

attggccccg?tggtccgcct?cacggaaact?cggggcaact?catattgaca?cattaattgg

caataattgg?aagcttacat?aagcttaatt?cgacgaataa?ttggattttt?attttatttt?gcaattggtt

Tttaatattt cc (SEQ ID NO:5) → be connected in φ 8 fragments-S 3 ' RNApol binding site

Phi-8 fragment-S 3 ' polymerase binding site point (the 3081-3192 base of GenBank accession number AF226853):

gcttagcggc?aatcgaaccc?tccg?xcataagg?aggtttagca?aatccgcggc?tcttatgagc

tgtccgaaag?gacaacccga?aagggggagc?gaggacttcg?gtcctccgct?cc(SEQ?ID?NO：6)

PstI：

ctgcag

Embodiment 7: the exemplary sequence of recombinant fragment-M

With reference to Fig. 4, below be to can be used for implementing the exemplary sequence that the present invention makes up recombinant fragment-M.

KpnI：

Ggtacc → be connected in fragment M pac

The fragment M pac sequence of gene 10 and ribosome bind site (1-262bp of GenBank accession number AF226852):

gaaattttcaaagtctttcggcaataagggtggaaatttcaaagagggtcgagccgacgaacctctgtaga

accgggaagtgcctgtctttacttgcgagagcaattgaactagggcagc

accgggggtcgataagcgcagaagtgaggcgcggggattgaagcaaatcacctaagcgtaaacgacgg

acctcgagggtggcggagt?ctacataggatcccctagctactagacagaaac

Cattcctaacaaggagatgcac (SEQ ID NO:8) → be connected in BgI II

BglII：

Agatct → be connected in asd gene

Intestinal bacteria asd (240-1343bp of GenBank accession number V00262):

atgaaaaatgt?tggttttatc?ggctggcgcg?gtatggtcgg?ctccgttctc?atgcaacgca

tggttgaaga?gcgcgacttc?gacgccattc?gccctgtctt?cttttctact?tctcagcttg?gccaggctgc

gccgtctttt?ggcggaacca?ctggcacact?tcaggatgcc?tttgatctgg?aggcgctaaa

ggccctcgat?atcattgtga?cctgtcaggg?cggcgattat?accaacgaaa?tctatccaaa

gcttcgtgaa?agcggatggc?aaggttactg?gattgacgca?gcatcgtctc?tgcgcatgaa

agatgacgcc?atcatcattc?ttgaccccgt?caatcaggac?gtcattaccg?acggattaaa

taatggcatc?aggacttttg?ttggcggtaa?ctgtaccgta?agcctgatgt?tgatgtcgtt?gggtggttta

ttcgccaatg?atcttgttga?ttgggtgtcc?gttgcaacct?accaggccgc?ttccggcggt

ggtgcgcgac?atatgcgtga?gttattaacc?cagatgggcc?atctgtatgg?ccatgtggca

gatgaactcg?cgaccccgtc?ctctgctatt?ctcgatatcg?aacgcaaagt?cacaacctta

acccgtagcg?gtgagctgcc?ggtggataac?tttggcgtgc?cgctggcggg?tagcctgatt

ccgtggatcg?acaaacagct?cgataacggt?cagagccgcg?aagagtggaa?agggcaggcg

gaaaccaaca?agatcctcaa?cacatcttcc?gtaattccgg?tagatggttt?atgtgtgcgt

gtcggggcat?tgcgctgcca?cagccaggca?ttcactatta?aattgaaaaa?agatgtgtct

attccgaccg?tggaagaact?gctggctgcg?cacaatccgt?gggcgaaagt?cgttccgaac

gatcgggaaa?tcactatgcg?tgagctaacc?ccagctgccg?ttaccggcac?gctgaccacg

ccggtaggcc?gcctgcgtaa?gctgaatatg?ggaccagagt?tcctgtcagc?ctttaccgtg

ggcgaccagc?tgctgtgggg?ggccgcggag?ccgctgcgtc?ggatgcttcg?tcaactggcg

taa(SEQ?ID?NO：9)

→ be connected in AscI

AscI：

Ggcgcgcc-＞→ be connected in HCV-IRES

Hepatitis C virus-IRES (36-341bp of GenBank accession number AJ242651):

atcactcccc?tgtgaggaac?tactgtcttc?acgcagaaag?cgcctagcca?tggcgttagt

atgagtgtcg?tgcagcctcc?aggacccccc?ctcccgggag?agccatagtg?gtctgcggaa

ccggtgagta?caccggaatt?gccaggacga?ccgggtcctt?tcttggatca?acccgctcaa

tgcctggaga?tttgggcgtg?cccccgccag?actgctagcc?gagtagtgtt?gggtcgcgaa

aggccttgtg?gtactgcctg?atagggtgct?tgcgagtgcc?ccgggaggtc?tcgtagaccg

Tgcacc (SEQ ID NO:10) → be connected in multiple clone site

Multiple clone site:

Atg gtt aac gcg gcc gct taa tta ata aat aaa taa (SEQ ID NO:11) → be connected in SFV 3 ' non-translated sequence

Xi Menli restrains forest virus 3 ' non-translational region (the 1-262 base of GenBank accession number V01398):

gttagggta?ggcaatggca?ttgatatagc?aagaaaattg?aaaacagaaa?aagttagggt

aagcaatggc?atataaccat?aactgtataa?cttgtaacaa?agcgcaacaa?gacctgcgca

attggccccg?tggtccgcct?cacggaaact?cggggcaact?catattgaca?cattaattgg

caataattgg?aagcttacat?aagcttaatt?cgacgaataa?ttggattttt?attttatttt?gcaattggtt

tttaatattt?cc

(SEQ ID NO:12) → be connected in 3 ' polymerase binding site point of Phi-8

Phi-8 fragment M 3 ' polymerase binding site point (4677-4741bp of GenBank accession number AF226852):

Actgttgataaacaggacccggaagggtaacccgagagggggagtgaggcttcggc ctccacttc (SEQ ID NO:13) → be connected in PstI

PstI：

ctgcag

The extraction of embodiment 8:rdsRN and purifying

In order to prove that bacterial strain MPC51 LSMtb4 has produced nucleocapsid, mono-clonal can be grown at 28 ℃ and be supplemented with penbritin (100 μ g/ml), in the M9 substratum of kantlex (50 μ g/ml) and D-L-glutamic acid (50 μ g/ml).With OD ₆₀₀＜0.1 begins to cultivate, at the logarithmic phase collecting cell, at OD ₆₀₀0.6-0.8 between.At centrifugal 5 minutes collecting cells of 8000rpm.For lysing cell, bacterium is resuspended in 5ml PBS, and in French cell press (Thermo Electron) with 20, the 000psi lysing cell.With lysate 8, centrifugal 5 minutes of 000xg, and supernatant liquor is used to contain the 10mM potassiumphosphate, and (pH 7.3; Sigma, St.Louis, MO, Cat.No.P5379) and 10-30% (w/v) saccharose gradient of 1mM magnesium chloride (MO, Cat.No.M1 028 for Sigma, St.Louis).Described gradient is positioned over Avanti J-30i whizzer, and (CA is in JS24.15 rotor Cat.No.363118) for Beckman Coulter, Fullerton.At 23 ℃, 23, after centrifugal 90 minutes of the 000rpm, nucleocapsid has formed tangible band, with its collection and be kept at-80 ℃ respectively.Residue content in the pipe is distributed into the 1ml aliquot and is stored in-80 ℃.Can be by using the specific antiserum(antisera) of shell to carry out immunoblotting and using the primer that designs amplification (+) chain and (-) chain LSMtb4 RNA to confirm the existence of rdsRN in these aliquots by RT-PCR.

Hereinafter designed the improvement that the rdsRN purification process is carried out.Grow to OD600=0.8 at 28 ℃ of 500ml cultures that will carry the shigella flexneri MPC51 of rdsRN LSMtb4, and with cell precipitation.Can use multistep to filter and centrifugal process purifying rdsRN.(Lake Wills, WI) lysing cell precipitates, and clarifies by centrifugal at first to use Invensys APV Microfluidyzer.(Millipore Inc., Billerica MA) handle clarifying supernatant liquor by tangential flow filtration (TFF) to use the Pellicon system with 0.45 μ m aperture elements (Millipore#P2HVMPC 05, or Equivalent) then.Use Benzonase (25 ℃ 30 minutes) digestion free nucleic acid.

Use second filtration step to concentrate rdsRN then and wash medium component off, the nucleic acid of digestion and nuclease.Can use the tangential flow filtration that the 100kDa spirrillum is twined ultrafiltration module (Millipore#CDUF 006 LH, or Equivalent) to concentrate described product, and be in the specific damping fluid of phosphate-buffered saline or other selectable clients buffer-exchanged.After tangential flow filtration, can half partial purification rdsRN be precipitated by adding NaCl or PEG, be resuspended in then in the phosphoric acid buffer of small volume (Hoogstraten etc., Virology, 272:218-224,2000).Can use the PEG precipitation of part (10-25%) and the gradient purifying that resuspended material carries out two kinds of small-sized analytical scale subsequently.Resuspended rdsRN can be placed on the sucrose handled and the opti-prep gradient and centrifugal spending the night.Collect rdsRN band (being identified) by immunoblotting and RT-PCR analysis, and by removal gradient material that the signatory specified damping fluid in laboratory is dialysed.Use Q-ion exchange chromatography and/or ActicleanEtox then ^TM(Sterogene, Carlsbad, CA) to the material of purifying (comprise before the gradient and after the gradient) thus handle and remove residual intracellular toxin (if necessary).RdsRN to purifying carries out five equilibrium and is stored in 4 ℃ at last.

Each stage in purge process is all got aliquot, and analyzes by immunoblotting and RT-PCR.

The immunogenicity of embodiment 9:rdsRN in mouse

Known the present invention is based on the RNA polymerase of the RNA dependence of bacteriophage, should determine whether that still the phi-8 polysaccharase has function in eukaryote.The nucleocapsid that can use purifying is to 6-8 BALB/c mouse (the The Jackson Laboratory in age in week, Bar Harbor, ME, Cat.No.000651) carry out immunity, can produce the ability of packing the antibody of TBS at mycobacterium antigen coded on rS and rM thereby measure purified nucleocapsid.Totally 5 groups, every group of 5 mouse carry out following immunity: the unprecedented capsid of 10 μ g, 10ng nucleocapsid, 100ng nucleocapsid, 1 μ g nucleocapsid and 10 μ g nucleocapsids.Mouse was accepted initial immunity at 0 day, accepted twice booster immunization at 14 days and 42 days.All immunity all are by the nucleocapsid intramuscularly being gone into the back leg of every mouse.

In order to measure antigenic humoral response, before each immunity, collect serum and collect serum with 10 days interval afterwards for TBS.Amount with every about 100 μ l of mouse is gathered blood from the tail vein of every mouse, and hatches 4 hours to grumeleuse on ice.In whizzer after centrifugal 5 minutes, with serum transfers to new pipe and be stored in-20 ℃.

Can use solid phase ELISA to come quantitative IgG for the antigenic reaction of TBS.Be suspended in PBS and be used for bag with the concentration of 2 μ g/ml solubility mycobacterium antigen by 96-hole microtitre elisa plate with purifying.Use 0.05% (v/v) TBS-Tween solution to wash then four times 4 ℃ of overnight incubation described plate.Use blotto (PBS of 5% (w/v) degreasing dry powder) to plate sealing 1 hour in room temperature then.Then as mentioned above, use TBS-Tween solution to wash plate.Dilute serum in blotto is joined in the plate with two parts of multiple forms since three times of serial dilutions of 1: 30, so the volume of each aperture is 100 μ l.Before each ELISA, all preimmune serum is comprised as negative control.In room temperature plate was hatched 2 hours, wash four times with TBS-Tween solution then.In order to measure, secondary antibodies be the affinity purification of alkali phosphatase enzyme mark goat anti-mouse IgG (heavy chain is specific) (Accurate Chemical and ScientificCorporation, Westbury, NY, Cat.No.SBA103004).Secondary antibodies was diluted with 1: 2000 in 2% (w/v) degreasing dry powder and 5% (v/v) sheep blood serum at TBS, added 100 μ l and incubated at room 1 hour in each aperture.Develop the color by continuous 15 minutes hatching in 100 μ l substrates, 100 μ l augmentors of the ELISA amplification system (Cat No.19589-019) by Invitrogen increase then.(Molecular Devices, Sunnyvale CA) measure absorbancy at 490nm to use SpectraMax titer plate spectrophotometer.Get inverse by the last serum dilution that the 490nm absorption value is produced increase and can calculate the terminal point titre, its mean number greater than the negative control row adds 3 times of standard differences.

Can lead to and cross cytokine dyeing (being also referred to as cell within a cell factor cell technology) in the small cell or pass through ELISPOT (Letsch A. etc., Methods 31:143-49; 2003) measure cellular immunity.Two kinds of methods all allow the antigen specific immune response is carried out quantitatively, although ICS also needs to be added on the phenotype to the specific CD4 of antigen ⁺And CD8 ⁺The synchronizing capacity that the T cell characterizes.Such analysis can determine secretion IL-2, IL-4, IL-5, IL-6, the quantity of the T cells with antigenic specificity of IL-10 and IFN-(Wu etc., AIDS Res.Hum.Retrovir.13:1187; 1997).Can use and commercial obtainablely capture and detect mAbs and carry out ELISPOT and analyze (R﹠amp; D Systems and Pharmingen), as (Wu etc., Infect.Immun.63:4933 as described in the reference; 1995) and used before document described (Xu-Amano etc., J.Exp.Med.178:1309; 1993); (Okahashi etc., Infect.Immun.64:1516; 1996).Each is analyzed and all comprises mitogen (Con A) and ovalbumin contrast.

Embodiment 10: fragment-L expresses

Embodiment 3 and 4 as mentioned is described, and fragment-wtL is used as the extrachromosomal replication plasmid and imports bacterial packaging strains.Clearly, can be by being integrated into the method that bacterial chromosome obtains more stable expression wtL.The brachymemma copy that lacks the wtL of pac sequence can be integrated into karyomit(e), thereby make up the bacterial strain that produces procapsid, in this case, thus total length wild-type or recombinant fragment-L RNA must be entered intasome with rM and rS RNA by electroporation subsequently finishes whole three kinds of segmental packings.Perhaps, total length wtL can be integrated into karyomit(e), thereby eliminates the needs of introducing wtL RNA subsequently by electroporation.

But use temperature susceptibility plasmid (being referred to herein as " TS ") is realized chromosomal integration by homologous recombination, this plasmid can only duplicate under permissible temperature (30 ℃), and can not non-again temperature of allowing duplicate under (42 ℃ or more than) (Kretschmer etc., J.Bacterid.124:225; 1975); (Hashimoto and Sekiguchi, J.Bacterid.127:1561; 1976).The example of TS plasmid comprises pMAK705, pTSA29, pTSC29, pTSK29, its be all pSC101 derivative (Hamilton etc., J.Bacterid.171:4617; 1989); (Phillips, Plasmid 41:78; 1999).

Use in the allelotrope exchange has a detailed description (Hashimoto and Sekiguchi, J.Bacteriol.127:1561 in the elsewhere about the TS plasmid; 1976); (Hamilton etc., J.Bacteriol.171:4617; 1989); (Phillips, Plasmid 41:78; 1999).In brief, thus the wtL sequence clone is gone into the TS plasmid makes that its flank is a gene order to be lacked.To carry then to some extent that the plasmid electroporation of clone gene enters target bacteria, thereby and cell allowed to integrate altogether to form 42 ℃ of growths, that is, and the initial recombination event between karyomit(e) and plasmid homologous sequence.By cell being grown in be supplemented with on the substratum that carries antibiotic marker on the described plasmid cointegrate is screened.Because described plasmid does not duplicate at 42 ℃, then has only common intasome (cointegrates) just to have antibiotics resistance.Cointegrate carries the replication origin of plasmid in the karyomit(e), has antibiotic situation following time when cointegrate grows at 30 ℃ subsequently, is deleterious from its pair cell that duplicates that carries out.Therefore, in the time of 30 ℃, the regeneration that has caused plasmid of second recombination event (elimination).Can measure monoclonal antibiotics resistances at 42 ℃ then, make the clone of antibiotic sensitive no longer have and be integrated into chromosomal plasmid.For to curing, these cells can be grown in 42 ℃ and do not add microbiotic by the cell of the reorganization plasmid that produces for the second time.

In another approach, the TS plasmid can be used to express wtL and embodiment 3 is closely similar, yet described bacterium can only grow under the temperature of admissibility at first.WtL is cloned into the bacterium promotor, for example under the control of T7, in this case, can expresses at 30 ℃.After importing rM and rS RNA, can pack and duplicate two kinds of RNA by the procapsid of wtL coding by electroporation.Then can be by growing and do not add the plasmid that microbiotic is handled (cure) cell at 42 ℃.The no material granulocyte of gained can continue replicated rna and can be used as the bacterial vaccine carrier that does not carry the adjusting content relevant with plasmid, for example imports antibiotics resistance.

Though at length at this, and can invention has been described with reference to its specific embodiment, but various changes of under the situation that does not depart from the connotation and extension of the present invention, carrying out and to modify those skilled in the art still be conspicuous.

Claims (83)

1. be used for packing, the bacterial isolates of generation and/or delivery of gene or RNA comprises:

A) contain the genomic dna that at least a selectivity phenotype is suddenlyd change;

B) coding produces the nucleotide sequence of nucleocapsid institute indispensable gene;

C) comprise proteic one or more nucleocapsids with RNA packing and rna polymerase activity; And

D) be included in the dsRNA sequence of described one or more nucleocapsid inside, described dsRNA sequence is encoded at least:

I) remedy the gene product that described at least a selectivity phenotype is suddenlyd change, and

Ii) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

2. the bacterial isolates of claim 1, wherein the coding described nucleotide sequence that produces nucleocapsid institute indispensable gene is present within described one or more nucleocapsids.

3. the bacterial cell of claim 1, wherein the coding described nucleotide sequence that produces nucleocapsid institute indispensable gene is present within the described genomic dna.

4. the bacterial cell of claim 1, wherein said bacterial cell further contains plasmid, and wherein the coding described nucleotide sequence that produces nucleocapsid institute indispensable gene is the part of described plasmid.

5. the bacterial strain of claim 1, wherein the coding described nucleotide sequence that produces nucleocapsid institute indispensable gene contains fragment-L or its functional mutants of RNA phage.

6. the bacterial isolates of claim 1, wherein the dsRNA sequence that is comprised in described one or more nucleocapsid inside contains fragment-S or RNA phage or the fragment-M of virus or at least a portion of the two of RNA.

7. the bacterial isolates of claim 6, wherein the described part of fragment-S is fragment-S pac sequence.

8. the bacterial isolates of claim 6, wherein the described part of fragment-S is the polymerase recognition sequence that fragment-S RNA relies on.

9. the bacterial isolates of claim 6, wherein the described part of fragment-M is fragment-M pac sequence.

10. the bacterial isolates of claim 6, wherein the described part of fragment-M is the polymerase recognition sequence that fragment-MRNA relies on.

11. the bacterial isolates of claim 1, wherein said selectivity phenotype sudden change is an auxotrophic mutation.

12. the bacterial isolates of claim 11, wherein said auxotrophic mutation is selected from aroA, aroC, leuD, asd and murI.

13. the bacterial isolates of claim 1, wherein said selectivity phenotype sudden change are the synthetic sudden changes of cell walls.

14. the bacterial isolates of claim 13, the synthetic sudden change of wherein said cell walls is selected from asd and murI.

15. the bacterial isolates of claim 1, wherein said selectivity phenotype sudden change is to stop to be higher than the sudden change of growing under 32 ℃ of conditions in temperature.

16. the bacterial isolates of claim 15, wherein stoping and being higher than the described selectivity phenotype sudden change of growing under 32 ℃ of conditions in temperature is htrB.

17. the bacterial isolates of claim 1, the described nucleotide sequence that wherein has the described albumen of RNA packing and rna polymerase activity and encode generation phage or virus nucleocapsid institute indispensable gene derives from and is selected from Phi-6, Phi-7, Phi-8, Phi-9, Phi-10, Phi-11, the phage of Phi-12 and Phi-13.

18. the bacterial isolates of claim 1, wherein said bacterial isolates is obtained from and is selected from campylobacter (Campylobacter), neisseria (Neisseria), hemophilus (Haemophilus), aerogenesis zygosaccharomyces (Aeromonas), Mark Lewis-Francis Pseudomonas (Francisella), Yersinia (Yersinia), Klebsiella (Klebsiella), Bordetella (Bordetella), Legionella (Legionella), corynebacterium (Corynebacterium), chlamydozoan (Chlamydia), Brucella (Brucella), Rhodopseudomonas (Pseudomonas), Helicobacterium (Helicobacter), Citrobacter (Citrobacter), Vibrio (Vibrio), Escherichia (Escherichia), Shigella (Shigella), salmonella (Salmonella), the bacterium kind of listeria (Listeria) and mycobacterium (Mycobacterium).

19. the bacterial isolates of claim 1, wherein said purpose RNA coding is selected from virus antigen, bacterial antigens, parasite antigen, tumour antigen, graft antigen, autoimmunization antigen, the albumen of adjuvant and cytokine.

20. reorganization double-stranded RNA nucleocapsid (rdsRN), it contains:

A) have the albumen of RNA packing and rna polymerase activity, and

B) dsRNA sequence, it is encoded at least:

I) gene product, and

Ii) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

21. the rdsRN of claim 20 further comprises the nucleotide sequence that coding produces nucleocapsid institute indispensable gene.

22. the rdsRN of claim 21, wherein said nucleotide sequence contain fragment-L or its functional mutants of RNA phage.

23. the rdsRN of claim 20, wherein said dsRNA sequence contains fragment-S or fragment-M of RNA phage or at least a portion of the two of RNA phage.

24. the rdsRN of claim 23, wherein the described part of fragment-S is fragment-S pac sequence, gene 8, or wild-type fragment-S.

25. the rdsRN of claim 23, wherein the described part of fragment-S is the polymerase recognition sequence that fragment-S RNA relies on.

26. the rdsRN of claim 23, wherein the described part of fragment-M is fragment-M pac sequence.

27. the rdsRN of claim 23, wherein the described part of fragment-M is the polymerase recognition sequence that fragment-M RNA relies on.

28. the rdsRN of claim 20, wherein said gene product remedies the phenotype the selected sudden change in the host cell.

29. the rdsRN of claim 28, wherein said phenotype sudden change is selected from aroA, aroC and leuD.

30. the rdsRN of claim 20, the synthetic sudden change of wherein said goal gene encoding cell wall.

31. the rdsRN of claim 30, the synthetic sudden change of wherein said cell walls is selected from asd and murI.

32. the rdsRN of claim 20, wherein said goal gene coding stops and is higher than the sudden change of growing under 32 ℃ of conditions in temperature.

33. the rdsRN of claim 32, wherein said goal gene is htrB.

34. the rdsRN of claim 20, the described albumen that wherein has RNA packing and rna polymerase activity derives from and is selected from Phi-6, the phage of Phi-8 and Phi-13.

35. the rdsRN of claim 20, wherein said purpose RNA coding is selected from virus antigen, bacterial antigens, parasite antigen, tumour antigen, transplantation antigen, autoimmunization antigen, the albumen of adjuvant and cytokine.

36. the rdsRN of claim 20, wherein one or more described dsRNA sequences are fluorizated.

37. vaccine preparation contains,

Bacterial cell, it contains

A) contain the genomic dna that at least a selectivity phenotype is suddenlyd change;

B) coding produces the nucleotide sequence of nucleocapsid institute indispensable gene;

C) comprise proteic one or more nucleocapsids with RNA packing and rna polymerase activity; And

D) the dsRNA sequence that contains in described nucleocapsid inside, described RNA sequence is encoded at least:

I) gene product, and

Ii) can be operatively connected in the immunogenic RNA of the coding of eukaryotic translation homing sequence.

38. the vaccine preparation of claim 37, wherein one or more described dsRNA sequences are fluorizated.

39. vaccine preparation contains,

Reorganization double-stranded RNA nucleocapsid (rdsRNs), it contains

A) has the albumen of RNA packing and rna polymerase activity;

B) dsRNA sequence, it is encoded at least:

I) remedy the gene product that at least a selectivity phenotype is suddenlyd change, and

Ii) can be operatively connected in the immunogenic RNA of the coding of eukaryotic translation homing sequence; And

Iii) coding produces the nucleotide sequence of phage or virus nucleocapsid institute indispensable gene.

40. make up method, may further comprise the steps as the recombinant bacteria of bacterial packaging strains:

In the genomic dna of bacterium, import at least a selectivity phenotype sudden change;

Thereby described bacterium is carried out the genetically engineered DNA that makes it to contain encoding function double-stranded RNA phage nucleocapsid protein; And

In described bacterium, insert mRNA fragment, described mRNA fragment coding

The i coding remedies at least a gene of the functional product of described at least a selectivity phenotype sudden change; And

The functional double-stranded RNA phage of ii nucleocapsid protein.

The goal gene 41. the method for claim 40, wherein said mRNA fragment are further encoded.

42. mutant bacterial, its inside contain one or more dna sequence dnas of expressing the dsRP procapsid and the sudden change that can select and keep rdsRN, described rdsRN expresses the functional gene that remedies described sudden change.

43. the bacterial isolates of claim 14, the synthetic sudden change of wherein said cell walls is asd.

44. the bacterial isolates of claim 17 wherein has the gene 8 that RNA packs and the described nucleotide sequence of the described albumen of rna polymerase activity and coding generation phage or virus nucleocapsid institute indispensable gene derives from phage Phi-8 and comprise phage Phi-8.

45. the bacterial isolates of claim 18, wherein said bacterial isolates derives from Shigella.

46. the bacterial isolates of claim 19, wherein said albumen is bacterial antigens.

47. the bacterial cell of claim 46, wherein said bacterial antigens are tuberculosis antigens.

48. the rdsRN of claim 31, the synthetic sudden change of wherein said cell walls is asd.

49. the rdsRN of claim 34 wherein has the gene 8 that RNA packs and the described albumen of rna polymerase activity derives from phage Phi-8 and comprise phage Phi-8.

50. the rdsRN of claim 35, wherein said albumen is bacterial antigens.

51. the rdsRN of claim 50, wherein said bacterial antigens are tuberculosis antigens.

52. the bacterial isolates of claim 1, wherein said purpose RNA coding apoptosis strengthens albumen.

53. the bacterial isolates of claim 52, wherein said apoptosis strengthen albumen and are selected from caspase8, death receptor-5, Fas and Fas tenuigenin structural domain/cd4 cell outer structure domain fusion protein.

The tolerance-induced albumen 54. the bacterial isolates of claim 1, wherein said purpose RNA are encoded.

55. the bacterial isolates of claim 54, wherein said tolerance-induced albumen is caspase 9.

56. the reorganization double-stranded RNA nucleocapsid of claim 20, wherein said purpose RNA coding apoptosis strengthens albumen.

The tolerance-induced albumen 57. the reorganization double-stranded RNA nucleocapsid of claim 20, wherein said purpose RNA are encoded.

58. the bacterial isolates of claim 1, wherein said dsRNA contains ribonuclease resistant rna.

59. the bacterial isolates of claim 58, wherein said ribonuclease resistant rna are fluorizated RNA.

60. the reorganization double-stranded RNA nucleocapsid of claim 20, wherein said dsRNA contains ribonuclease resistant rna.

61. the reorganization double-stranded RNA nucleocapsid of claim 60, wherein said ribonuclease resistant rna is fluorizated RNA.

62. be used for packing, import and produce the bacterial isolates of rdsRN, contain

A) contain the genomic dna that at least a selectivity phenotype is suddenlyd change;

B) coding produces the nucleotide sequence of procapsid institute indispensable gene; And

C) comprise proteic one or more procapsids with RNA packing and rna polymerase activity.

63. what be used to import rdsRN fluoridizes the RNA sequence, it is encoded at least:

I) remedy the gene product that at least a selectivity phenotype is suddenlyd change; And

Ii) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

64. fluoridize the RNA sequence, it is encoded at least:

I) remedy the gene product that at least a selectivity phenotype is suddenlyd change;

Ii) be used for the stable gene-8 (SEQ ID NO:7) that produces nucleocapsid; And

Iii) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

65. fluoridize the RNA sequence, it is encoded at least:

I) produce the necessary gene of nucleocapsid;

Ii) remedy the gene product of at least a selectivity phenotype sudden change;

Iii) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

66. fluoridize the RNA sequence, it is encoded at least:

I) produce the necessary gene of nucleocapsid;

Ii) remedy the gene product of described at least a selectivity phenotype sudden change;

Iii) be used for the stable gene-8 (SEQ ID NO:7) that produces nucleocapsid; And

Iv) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

67. the electroporation medium, it contains

I) be used to pack, import and produce the bacterial isolates of rdsRN, it contains

A) contain the genomic dna that at least a selectivity phenotype is suddenlyd change;

B) coding produces the nucleotide sequence of procapsid institute indispensable gene; And

C) comprise and have RNA packing and proteic one or more procapsids of rna polymerase activity; And

Ii) fluorizated RNA sequence, it is encoded at least

A) remedy the gene product that described at least a selectivity phenotype is suddenlyd change,

B) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

68. the electroporation medium, it contains

I) be used to pack, import and produce the bacterial isolates of rdsRN, it contains

A) contain the genomic dna that at least a selectivity phenotype is suddenlyd change;

B) coding produces the nucleotide sequence of procapsid institute indispensable gene; And

C) comprise proteic one or more procapsids with RNA packing and rna polymerase activity; And

Ii) fluorizated RNA sequence, it is encoded at least

A) remedy the gene product that described at least a selectivity phenotype is suddenlyd change,

B) be used for the stable gene-8 (SEQ ID NO:7) that produces nucleocapsid; And

C) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

69. the electroporation medium, it contains

I) be used to pack, import and produce the bacterial isolates of rdsRN, it contains

A) contain the genomic dna that at least a selectivity phenotype is suddenlyd change;

B) coding produces the nucleotide sequence of procapsid institute indispensable gene; And

C) comprise proteic one or more procapsids with RNA packing and rna polymerase activity; And

Ii) fluorizated RNA sequence, it is encoded at least

A) produce the necessary gene of nucleocapsid;

B) remedy the gene product that described at least a selectivity phenotype is suddenlyd change;

C) be used for the stable gene-8 (SEQ ID NO:7) that produces nucleocapsid; And

D) can be operatively connected in the purpose RNA of eukaryotic translation homing sequence.

70. the bacterial isolates of claim 1, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

71. the rdsRN of claim 28, wherein said selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

72. the vaccine preparation of claim 37, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

73. the vaccine preparation of claim 39, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

74. the method for claim 40, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

75. the bacterial isolates of claim 62, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

76. claim 63 fluoridize the RNA sequence, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

77. claim 63 fluoridize the RNA sequence, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

78. claim 64 fluoridize the RNA sequence, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

79. claim 65 fluoridize the RNA sequence, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

80. claim 66 fluoridize the RNA sequence, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

81. the electroporation medium of claim 67, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

82. the electroporation medium of claim 68, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change

83. the electroporation medium of claim 69, wherein said at least a selectivity phenotype sudden change is non-response selectivity phenotype sudden change.

Images