CN107190061A - A kind of standard gene and its application for nematode-trapping hyphomycete Molecular Identification - Google Patents
A kind of standard gene and its application for nematode-trapping hyphomycete Molecular Identification Download PDFInfo
- Publication number
- CN107190061A CN107190061A CN201710406542.2A CN201710406542A CN107190061A CN 107190061 A CN107190061 A CN 107190061A CN 201710406542 A CN201710406542 A CN 201710406542A CN 107190061 A CN107190061 A CN 107190061A
- Authority
- CN
- China
- Prior art keywords
- nematode
- hyphomycete
- trapping
- sequence
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of standard gene sequence and authentication method for nematode-trapping hyphomycete, species Molecular Identification field.The standard detection COX1 genes, gene order SEQ ID NO.1.Using mitochondrial cytochrome oxidizing ferment I COX1 gene universal primers PenF1, AspR1 carries out PCR (PCR) amplification, then with specific primer sequences PenF1 chao：ATGCTAAAGACATTGGTA,AspR1‑chao：ACGTATACCTGGACTTC is expanded, and PCR primer is sequenced after agarose gel is verified.According to the sequence difference of COX1 genes, nematode-trapping hyphomycete can be fast and accurately identified.The present invention can fast and accurately identify the nematode-trapping hyphomycete, and strong research tool is provided for the preventing and treating of animals and plants nematode.
Description
Technical field
Field is identified the present invention relates to species molecule, and in particular to a kind of mark for nematode-trapping hyphomycete Molecular Identification
Quasi- gene and its application.
Background technology
Plant nematode disease is the plant disease that a class worldwide generally occurs, the root-knot nematode being currently known
Species just has kind more than 70, endangers 3000 various plants, and the annual loss caused by nematodiasis in the whole world is up to more than 1,000 hundred million dollars.
In nematode and the complicated correlation of fungi, specially there is a class fungi, they are caught by the trapping organs of vegetative hyphae specialization
Nematode is caught, this class fungi is referred to as nematode-trapping hyphomycete.The latest edition monograph delivered for 2014 according to Zhang etc., now
The nematode-trapping hyphomycete known has 3 category, 96 kinds, is that Arthrobotrys belongs to 54 kinds, Drechslerella category 14 respectively
Individual kind, Dactylellina belongs to 28 kinds.As very long evolution is developed, its mycelium is adaptation living environment, vegetative hyphae
Metamorphosis is various forms uniqueness, the trapping organs of delicate structure, such as sticky ball, sticky net and contractile ring structure, to prey on
Nematode.For at present, biological control nematode is undoubtedly most reliable safest means, therefore nematode-trapping hyphomycete gives birth in nematode
The important role of performer in thing prevention and control field, with special ecological significance and economic value.Because of nematode-trapping hyphomycete
Kind many comprising phorozoon category, ammonia configuration feature is various and its morphological plasticity, and the potentially polynary history of life so that some
There is no obvious microstructure difference between species, and the Molecular Phylogeny research at present to such fungi is not enough, therefore researcher
The dispute of the problem of in terms of such fungal molecule systematic growth and species identification is continuous, and also the biological agent to preventing and treating nematode is ground
Hair band carrys out many puzzlements.Therefore, it is badly in need of standard gene to set up its quick Molecular Identification, passes through morphological research and molecular data
The method being combined differentiates and classification problem to solve it.
The content of the invention
To overcome the shortcomings of that Morphological Identification nematode-trapping hyphomycete is present, the invention provides a kind of nematode-trapping silk spore
The standard gene sequence and authentication method of bacterium molecule identification, rapidly and accurately can easily obscure species by the nematode-trapping hyphomycete
Identify and, so as to provide quickly and efficiently Identification Tools for the preventing and treating of nematode.
To achieve the above object, technical scheme is as follows：
A kind of standard gene and its application for nematode-trapping hyphomycete Molecular Identification, including COX1 standard gene fragments are built
The discriminating step of vertical and sample；Wherein：
（1）According to DNA bar code technical principle, using PCR amplification method, it is ensured that the purity and reliability of band.Sequencing result
By manual check and correction, sequence assembly, and ensure that gained sequence is standard sequence.From the nematode-trapping hyphomycete sample extraction of collection
Genomic DNA, carries out the COX1 genes that PCR (PCR) amplifies sample using primer, amplified production is sequenced
Post analysis are compared, and the COX1 gene order fragments of SEQ ID NO.1 samples primer sequence amplification sample are used as standard gene.
（2）The discriminating of sample：By the way that sample sequence to be identified and standard gene are compared, based on homology and base
Set up identification rule to differentiate species in the phylogenetic tree method of clustering, obtain the similitude between sequence, similarity highest
Or the corresponding species of matching degree highest or genetic distance recently are species to be identified；It is specific as follows：
A. species are differentiated based on homological identification rule
According to sequencing result, if with the gene order SEQ ID NO.1 nucleotide differences numbers below 10, you can sentence
Break some species that described testing sample is nematode-trapping hyphomycete.
B. the phylogenetic tree method based on clustering sets up identification rule to differentiate species
Standard gene sequence and sample sequence to be identified are merged into application with the COX1 gene orders of nematode-trapping hyphomycete
MEGA or PAUP software building NJ phylogenetic trees, examine the DNA bar code sequences for not identifying sample and standard gene sequence to gather
The species of class together, if unknown sample constitutes single offspring with the species in database, are accredited as the species.
The advantage of the invention is that：
1st, preferably COX1 genes are as the most suitable DNA bar code for differentiating nematode-trapping hyphomycete, compared to other genes, COX1
Sequence have it is general, the characteristics of easily compare.
2nd, the standard gene sequence of nematode-trapping hyphomycete and the discrimination method of sample are established, compared to traditional form
Authentication method is learned, determination rates are substantially increased.This method requires low for the integrated degree of sample, and identification beacon can be measured
Change, this provides effective foundation for identification nematode-trapping hyphomycete in time.In addition, being sent out with the system based on clustering
Raw tree method is set up identification rule and identified, its reliability identified and accuracy are also significantly better than conventional Molecular Identification side
Method, compensate for the deficiency of such nematode-trapping hyphomycete Molecular Identification.
Brief description of the drawings：
Fig. 1 is sample sequence to be identified and morphology obscures kind and COX1 standard genes sequence is based on Kimura-2-parameter
The NJ trees that the genetic distance of model is built.
Embodiment：
With reference to specific example, the present invention will be further described：
Embodiment 1：Testing sample and the homological identification of nematode-trapping hyphomycete DNA bar code judging standard genetic fragment
1st, the collection and preservation of nematode-trapping hyphomycete sample：9 parts of samples from Yunnan Province of collection.
2nd, nematode-trapping hyphomycete genomic DNA is extracted：Genomic DNA is extracted using the CTAB methods improved, and with going out
The DNA concentration of sample is diluted to 0.5 μ g/ μ l by the deionized water of bacterium.
3rd, amplification of DNA fragments, carries out polymerase chain (PCR) reaction, i.e., is expanded with universal primer, outer primer is to sequence
It is classified as：
Forward primer PenF1: 5' GACAAGAAAGGTGATTTTTATCTTC3'；
Reverse primer AspR1: 5'GGTAATGATAATAATAATAATACAGC3'；
4. according to specific primer according to claim 2, it is characterised in that inner primer sequence is：
Forward primer PenF1-chao: 5' ATGCTAAAGACATTGGTA3'；
Reverse primer AspR1-chao: 5'ACGTATACCTGGACTTCT3'.
PCR reaction systems are 25 μ l：DdH2O18 μ l, the μ l of PCR Buffer 2.5, MgCl2 2.5 μ l, dNTPs 0.5
The μ l of μ l, Taq DNA polymerases 0.5, the μ l of DNA profiling 1, without dyestuff；External primer amplification program：95 DEG C of pre-degeneration 5min, 94
DEG C denaturation 40s, 37 DEG C of annealing 55s, such process annealing 2-3 is circulated, then by final annealing temperature rating in 50 DEG C, 55s, 72
DEG C extension 1min, so carry out 30 circulation, it is last 72 DEG C extension 10min, 4 DEG C preservation.Inner primer amplification condition is：95 DEG C pre-
5min, 94 DEG C of denaturation 40s are denatured, annealing temperature, which is 55 DEG C -50.5 DEG C, gradually reduces by 0.5 DEG C, and 11 circulations, will finally be moved back altogether
Fiery temperature rating is at 50 DEG C, and 25 circulations, 72 DEG C of extension 1min so carry out 30 circulations, last 72 DEG C of extensions 10min, 4 DEG C
Preserve.
5th, amplified production loading, with electrophoresis detection in 1.0% Ago-Gel, 1 × TBE electrophoresis liquids, is used
DNAmarker detects PCR fragment size.If there is the substantially clearly band of 300-400bp sizes, and without miscellaneous band, send survey
Sequence.
6th, the sequence peak figure quality obtained first with being checked in software Chromas after sequencing, determines that peak figure quality reaches number
After the requirement of analysis, the splicing of forward and reverse sequence is carried out with the SeqMan in DNASTAR software kits.Sequencing result is carried out
Manual check and correction, sequence assembly, if target gene fragment and the gene order SEQ ID NO.1 nucleotide difference numbers are 10
It is individual following, you can to judge that described test serum is nematode-trapping hyphomycete.
Embodiment 2：Set up identification rule to differentiate species with phylogenetic tree method
1st, the sequence of testing sample is obtained using step described in embodiment 1, by standard gene sequence and sample sequence to be identified
Row merge with the COX1 sequences of testing sample is based on 1000 structure systems of Kimura-2-parameter models repetition using MEGA
System development tree, the DNA bar code sequence of sample is not identified together with standard gene Sequence clustering, with non-nematode-trapping hyphomycete
Obvious difference is presented in Pseudotripoconidiumsinensis sequence, illustrates that sample to be identified can be accredited as predation
Nematode hyphomycete.
Compared with traditional Morphological Identification method, the gene order that obtains of the present invention and with method be advantageously implemented
Nematode-trapping hyphomycete is identified fast and accurately.
SEQUENCE LISTING
<110>Yunnan University
<120>One class catches standard gene and its application of disk bacterium Nematophagous fungi identification
<130> 2017
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 352
<212> DNA
<213>Cladophyll Arthrobotrys（Arthrobotry cladodesYMF1.03513）
<400> 1
agtataatta cagctcacgc tataatgatg attttcttta tggttatgcc tggtttacta 60
agtggttttg gtaatttctt attaccatta ttagtaggag gtcctgatat ggcattccct 120
agactaaata acattagttt ctgattatta gtacctagtt tattattatt tgtattctct 180
gcaacaatag aaaatggagc aggtacagga tgaactcttt acccaccatt atcaggaata 240
caatcacaca gtggaccaag tgttgattta gcaatttttg gtttacactt aagtggtatt 300
agtagtatgt taggagctat gaacttcatt acaactcttt taaatatgag aa 352
Claims (5)
1. the DNA bar code standard gene sequence of a kind of nematode-trapping hyphomycete, it is characterised in that nucleotides sequence is classified as sequence table
DNA molecular sequence shown in middle sequence 1.
2. the method that the standard gene described in application claim 1 carries out nematode-trapping hyphomycete Molecular Identification, including following 4
Step：
(1) genomic DNA is extracted from sample mycelia；
(2) genomic DNA extracted using step (1) is template, with the general external primer amplifications of nematode-trapping hyphomycete COX1,
Again PCR is carried out with specific inner primer；
(3) obtained DNA product is expanded to step (2) to be sequenced；
(4) sequencing result is carried out manually splicing and correcting, the representative strain with the nematode-trapping hyphomycete in gene order table
Sequence SEQ ID NO.1 carry out sequence analysis, if nucleotide difference number is less than 10, you can by the sample identification be catch
Eat nematode hyphomycete.
3. COX1 genes universal primer according to claim 2, it is characterised in that outer primer sequence is：
Forward primer PenF1: 5' GACAAGAAAGGTGATTTTTATCTTC3'；
Reverse primer AspR1: 5'GGTAATGATAATAATAATAATACAGC3'.
4. special primer according to claim 2, it is characterised in that inner primer sequence is：
Forward primer PenF1-chao: 5' ATGCTAAAGACATTGGTA3'；
Reverse primer AspR1-chao: 5'ACGTATACCTGGACTTCT3'.
5. PCR according to claim 2, its external primer amplification condition is：95 DEG C of pre-degeneration 5min, 94 DEG C
40s is denatured, 37 DEG C of annealing 55s, such process annealing 2-3 is circulated, then by final annealing temperature rating in 50 DEG C, 55s, 72 DEG C
Extend 1min, so carry out 30 circulations, last 72 DEG C of extensions 10min, 4 DEG C of preservations；Inner primer amplification condition is：95 DEG C of pre- changes
Property 5min, 94 DEG C denaturation 40s, annealing temperature be 55 DEG C -50.5 DEG C gradually reduce by 0.5 DEG C, altogether 11 circulation, finally will annealing
Temperature rating is at 50 DEG C, and 25 circulations, 72 DEG C of extension 1min so carry out 30 circulations, last 72 DEG C of extensions 10min, 4 DEG C of guarantors
Deposit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710406542.2A CN107190061A (en) | 2017-06-02 | 2017-06-02 | A kind of standard gene and its application for nematode-trapping hyphomycete Molecular Identification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710406542.2A CN107190061A (en) | 2017-06-02 | 2017-06-02 | A kind of standard gene and its application for nematode-trapping hyphomycete Molecular Identification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107190061A true CN107190061A (en) | 2017-09-22 |
Family
ID=59876899
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710406542.2A Pending CN107190061A (en) | 2017-06-02 | 2017-06-02 | A kind of standard gene and its application for nematode-trapping hyphomycete Molecular Identification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107190061A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110126925A (en) * | 2010-05-18 | 2011-11-24 | 한국생명공학연구원 | Pcr primer for amplifying 5'end region of mitochondrial cytochrome oxidase subunit i gene used for dna barcoding of scale insect |
| CN103898235A (en) * | 2014-04-21 | 2014-07-02 | 牡丹江友搏药业股份有限公司 | DNA (deoxyribonucleic acid) barcoding based molecular identification method of leech |
| CN105063761A (en) * | 2015-09-02 | 2015-11-18 | 云南大学 | Method for identifying predator nematophagous hyphomycete arthrobotrys through DNA bar codes |
-
2017
- 2017-06-02 CN CN201710406542.2A patent/CN107190061A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110126925A (en) * | 2010-05-18 | 2011-11-24 | 한국생명공학연구원 | Pcr primer for amplifying 5'end region of mitochondrial cytochrome oxidase subunit i gene used for dna barcoding of scale insect |
| CN103898235A (en) * | 2014-04-21 | 2014-07-02 | 牡丹江友搏药业股份有限公司 | DNA (deoxyribonucleic acid) barcoding based molecular identification method of leech |
| CN105063761A (en) * | 2015-09-02 | 2015-11-18 | 云南大学 | Method for identifying predator nematophagous hyphomycete arthrobotrys through DNA bar codes |
Non-Patent Citations (2)
| Title |
|---|
| 和晓霞: "圆盘菌无性型属的分子系统发育及其DNA条形码研究", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
| 谭贵良 等: "《现代分子生物学及组学技术在食品安全检测中的应用》", 30 June 2014 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106048071B (en) | Fungus Trichoderma Identification of Species primer and its application based on mitochondria NAD5 gene order | |
| CN113549704B (en) | Tobacco genus specific molecular marker for identifying tobacco and non-tobacco and application thereof | |
| CN108004346B (en) | Wheat gene Yr10 molecular marker and application thereof in screening wheat with wheat stripe rust resistance | |
| CN107447036B (en) | Method for identifying fusarium cucurbitacearum | |
| CN105506075B (en) | One kind SNP marker relevant to Pear black spot resistance and application | |
| CN107190061A (en) | A kind of standard gene and its application for nematode-trapping hyphomycete Molecular Identification | |
| CN109609679A (en) | Identify characteristic nucleotide sequence, nucleic acid molecular probe, kit and the method for ganoderma strain GIMS1524 | |
| CN112779274B (en) | Ribosomal RNA gene of mulberry plaster disease pathogenic bacteria and application thereof | |
| CN106011265B (en) | Molecular biology distinguishing method for two rice leaf roller larvae | |
| CN107177672B (en) | Standard gene for identifying disc fungi and application thereof | |
| CN105950776B (en) | A kind of flat mushroom strain mirror method for distinguishing and special DNA bar shaped chip segment | |
| CN112795662A (en) | Identification method of barbel grahami and application thereof | |
| Zeinalabedini et al. | First report of a set of genetic identities in Prunus rootstocks by SSR markers | |
| CN105132420B (en) | A kind of primer set for identifying corn variety purity and application | |
| CN109628625A (en) | Identify specific primer, the kit, method and its application of six younger sister hickory chicks | |
| CN109468389B (en) | Molecular biological method for identifying cotton bollworm and oriental tobacco budworm larvae and special primer pair thereof | |
| CN106702011B (en) | Molecular marker, primer and probe for identifying lepista longissima | |
| CN114958875B (en) | Screening and application of reference gene metG of citrus yellow-long pathogen | |
| Boughalleb-M’Hamdi et al. | Genetic diversity of Fusarium solani f. sp. cucurbitae the causal agent of crown and root rot of watermelon in Tunisia using ISSR markers | |
| CN112626252B (en) | InDel marker fingerprint spectrum of mushroom CV105 strain and construction method thereof | |
| CN106967793B (en) | Molecular detection method for rapidly identifying cornus wisoniana population | |
| Yu-Shi et al. | AFLP fingerprinting analysis of genetic polymorphism of 12 indigenous chicken breeds | |
| Popescu et al. | Comparative evaluation of molecular methods used for fusarium strains identification in the west part of Romania. | |
| Mukhtar et al. | Evaluation of genetic diversity among phytopathogenic isolates of Fusarium solani complex causing shisham dieback disease in Pakistan. | |
| Priti et al. | Comparison of the multi gene regions for selection of potential barcode for Bipolaris spp |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170922 |