CN107188939A - Application of the PSA3 albumen in participating in PSI assembling and maintaining PSI stable - Google Patents
Application of the PSA3 albumen in participating in PSI assembling and maintaining PSI stable Download PDFInfo
- Publication number
- CN107188939A CN107188939A CN201710337873.5A CN201710337873A CN107188939A CN 107188939 A CN107188939 A CN 107188939A CN 201710337873 A CN201710337873 A CN 201710337873A CN 107188939 A CN107188939 A CN 107188939A
- Authority
- CN
- China
- Prior art keywords
- complex
- photosystemi
- albumen
- psa3
- photosynthetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/01—Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8269—Photosynthesis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Plant Pathology (AREA)
- Physiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Botany (AREA)
- Bioinformatics & Computational Biology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses application of the PSA3 albumen in participating in PSI assembling and maintaining PSI stable.The application of present invention protection calcium balance regulatory factor (PSA3 albumen) first, be：(a1) assembling of photosystemⅰ complex (PS I) is participated in；(a2) formation of photosystemⅰ complex (PS I) is participated in；(a3) stability of photosystemⅰ complex (PS I) is maintained.The inventors found that, lacking PSA3 albumen prevents photosystemⅰ complex from correctly assembling, it is degraded rapidly so as to PsaA albumen, furthermore, it is understood that PSA3 albumen and the common assembling in the PSI thylakoid membrane matrix side auxiliary PSI complexs assembled of PYG7 albumen and stably.The present invention has major application value for photosynthetic eucaryote PS I research.
Description
Technical field
The present invention relates to application of the PSA3 albumen in participating in PSI assembling and maintaining PSI stable.
Background technology
Two major class quasi-sac film protein complexs are widely present in cyanobacteria, algae and plant, one multiple for photosystemⅰ
Fit (PS I), another is Photosystem I I complexs (PSII).
PSI about 600kD, are made up of two a little bit smaller sub- complexs.Almost half subunits of PSI are all green by leaf
Body genome encoding.Two of PSI sub- complexs are respectively：1. core complex, is responsible for the plastid from thylakoids cavity side
Lan Su shifts electronics to the ferredoxin of matrix side；2. LHCI complexs, are responsible for capture light energy.Core complex is by 9
Memebrane protein (PsaA, PsaB, PsaF-PsaL) and 3 peripheral subunit (PsaC, PsaD and PsaE) compositions.LHCI complexs by
The four kinds of Lhca albumen and part Lhcb albumen composition of nucleus coding, Lhca albumen are located inside thylakoid membrane.PsaA and
PsaB participates in separation of charge and electro transfer in the form of heterodimer, and other subunits of core complex are centered around PsaA/
Around PsaB heterodimers participate in PSI stabilization and and LHCI complexs combination.PSI is probably green comprising 200 kinds of leaves
The prosthetic groups such as element, carotenoid, iron-sulfur cluster and plastoquinone.
In the prior art, PSI biology is known little about it.Evidence suggests：PSI assembling in photosynthetic eucaryote
Originate in the formation of PsaA/PsaB dimers on film；Subsequent PsaC, PsaD and PsaE constitute so-called " matrix bridge " and are added to base
On the PsaA/PsaB dimers of matter side；In last step, other subunits are assembled into PSI.Up to the present,
Six albumen are identified, is responsible for PSI accumulation and participates in the different phase of PSI assembling process, encoded including plastid
Protein Y cf3 and Ycf4, and protein Y 3IP1, PYG7/Ycf37, PPD1 and PSA2 that nucleus is encoded.Ycf3, Ycf4 and
Y3IP1 is combined in the matrix side of thylakoid membrane, and there are some researches show they take part in the assembling process of PSI matrix bridges.PPD1 and
PSA2 is attached to the blister cavities side of thylakoid membrane.PYG7 is an inner membrane protein, recent research indicate that, PYG7 is homologous in chlamydomonas
Body is responsible for PSI biological generation, especially under aerobic conditions and iron-sulfur cluster can be prevented to be oxidized in an assembling process.
The content of the invention
It is an object of the invention to provide application of the PSA3 albumen in participating in PSI assembling and maintaining PSI stable.
The application of present invention protection calcium balance regulatory factor (PSA3 albumen) first, be following (a1) into (a6) at least
It is a kind of：
(a1) assembling of photosystemⅰ complex (PS I) is participated in；
(a2) formation of photosystemⅰ complex (PS I) is participated in；
(a3) stability of photosystemⅰ complex (PS I) is maintained；
(a4) it is used for the product for preparing the assembling for participating in photosystemⅰ complex (PS I)；
(a5) it is used for the product for preparing the formation for participating in photosystemⅰ complex (PS I)；
(a6) it is used for the product for preparing the stability for maintaining photosystemⅰ complex (PS I).
The application of the present invention also protection calcium balance regulatory factor (PSA3 albumen), be following (b1) into (b10) at least
It is a kind of：
(b1) assembling of photosystemⅰ complex (PS I) in photosynthetic eucaryote is participated in；
(b2) formation of photosystemⅰ complex (PS I) in photosynthetic eucaryote is participated in；
(b3) stability of photosystemⅰ complex (PS I) in photosynthetic eucaryote is maintained；
(b4) level of photosystemⅰ complex (PS I) in photosynthetic eucaryote is maintained；
(b5) level of PsaA albumen in photosynthetic eucaryote is maintained；
(b6) it is used to prepare the product for participating in the assembling of photosystemⅰ complex (PS I) in photosynthetic eucaryote；
(b7) it is used to prepare the product for participating in the formation of photosystemⅰ complex (PS I) in photosynthetic eucaryote；
(b8) it is used to prepare the product for maintaining the stability of photosystemⅰ complex (PS I) in photosynthetic eucaryote；
(b9) it is used to prepare the product for maintaining the level of photosystemⅰ complex (PS I) in photosynthetic eucaryote；
(b10) it is used to prepare the product for maintaining the level of PsaA albumen in photosynthetic eucaryote.
The application of the present invention also protection calcium balance regulatory factor (PSA3 albumen), is at least one of following (c1) into (c6)
Kind：
(c1) with PYG7 protein bindings；
(c2) PYG7 albumen is detected；
(c3) purify or be enriched with PYG7 albumen；
(c4) product for combining PYG7 albumen is prepared；
(c5) product for detecting PYG7 albumen is prepared；
(c6) product for purifying or being enriched with PYG7 albumen is prepared.
The application of the present invention also protection calcium balance regulatory factor (PSA3 albumen) and PYG7 albumen, is following (d1) to (d6)
At least one of：
(d1) the common assembling for participating in photosystemⅰ complex (PS I)；
(d2) the common formation for participating in photosystemⅰ complex (PS I)；
(d3) stability of common maintenance photosystemⅰ complex (PS I)；
(d4) it is used for the product for preparing the assembling for participating in photosystemⅰ complex (PS I)；
(d5) it is used for the product for preparing the formation for participating in photosystemⅰ complex (PS I)；
(d6) it is used for the product for preparing the stability for maintaining photosystemⅰ complex (PS I).
The present invention also protection calcium balance regulatory factor (PSA3 albumen) and PYG7 albumen application, be as follows (e1) extremely
At least one of (e10)：
(e1) assembling of photosystemⅰ complex (PS I) in photosynthetic eucaryote is participated in jointly；
(e2) formation of photosystemⅰ complex (PS I) in photosynthetic eucaryote is participated in jointly；
(e3) stability of photosystemⅰ complex (PS I) in photosynthetic eucaryote is maintained jointly；
(e4) level of photosystemⅰ complex (PS I) in photosynthetic eucaryote is maintained jointly；
(e5) level of PsaA albumen in photosynthetic eucaryote is maintained jointly；
(e6) it is used to prepare the product for participating in the assembling of photosystemⅰ complex (PS I) in photosynthetic eucaryote；
(e7) it is used to prepare the product for participating in the formation of photosystemⅰ complex (PS I) in photosynthetic eucaryote；
(e8) it is used to prepare the product for maintaining the stability of photosystemⅰ complex (PS I) in photosynthetic eucaryote；
(e9) it is used to prepare the product for maintaining the level of photosystemⅰ complex (PS I) in photosynthetic eucaryote；
(e10) it is used to prepare the product for maintaining the level of PsaA albumen in photosynthetic eucaryote.
The present invention, which is also protected, a kind of prepares the impaired photosynthetic Eukaryotic method of photosystemⅰ complex, including following step
Suddenly：The gene of the coded Ca balance adjustment factor (PSA3 albumen) in photosynthetic eukaryotic gene group is knocked out, photosystemⅰ is obtained and is combined
The impaired photosynthetic eucaryote of body.
The present invention, which is also protected, a kind of prepares the impaired photosynthetic Eukaryotic method of photosystemⅰ complex, including following step
Suddenly：The gene of the coded Ca balance adjustment factor (PSA3 albumen) in photosynthetic eukaryotic gene group is mutated, photosystemⅰ is obtained and is combined
The impaired photosynthetic eucaryote of body.
The present invention, which is also protected, a kind of prepares the impaired photosynthetic Eukaryotic method of photosystemⅰ complex, including following step
Suddenly：Suppress the activity of calcium balance regulatory factor in photosynthetic eucaryote (PSA3 albumen), obtain the impaired light of photosystemⅰ complex
Close eucaryote.
The present invention also protects a kind of polypeptide fragment, by 54 amino acid of calcium balance regulatory factor (PSA3 albumen) C-terminal
Residue is constituted.The polypeptide fragment concretely sequence table the 224-277 amino acids residue of sequence 3 composition polypeptide piece
Section.
The present invention also protects the application of the polypeptide fragment, is following (f1) or (f2)：
(f1) combination of calcium balance regulatory factor (PSA3 albumen) and PYG7 albumen is participated in；
(f2) it is used for the product for preparing the combination for participating in calcium balance regulatory factor (PSA3 albumen) and PYG7 albumen.
Photosynthetic eucaryote described in any of the above concretely plant, such as corn or arabidopsis.
The calcium balance regulatory factor (PSA3 albumen) concretely following (g1) or (g2) or (g3) or (g4) or (g5)：
(g1) protein shown in the sequence 1 of sequence table；
(g2) protein shown in the sequence 3 of sequence table；
(g3) fused protein obtained in N-terminal or/and C-terminal the connection label of (g1)；
(g4) fused protein obtained in N-terminal or/and C-terminal the connection label of (g2)；
(g5) substitution by (g1) or (g2) or (g3) or (g4) by one or several amino acid residues and/or missing
And/or add and related to the assembling of photosystemⅰ complex (PS I) by its derivative protein.
The PYG7 albumen can be following (h1) or (h2) or (h3)：
(h1) protein shown in the sequence 5 of sequence table；
(h2) fused protein obtained in N-terminal or/and C-terminal the connection label of (h1)；
(h3) by (h1) or (h2) by the substitution and/or missing and/or addition of one or several amino acid residues and with
(h1) with identical function by its derivative protein.
Label is specifically shown in Table 1 described in any of the above.
The sequence of the label of table 1
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (being usually 5) | RRRRR |
| Poly-His | 2-10 (being usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
The gene of the coded Ca balance adjustment factor (PSA3 albumen) described in any of the above can for following (j1) or (j2) or
Or (j4) (j3)：
(j1) DNA molecular of the code area as shown in sequence 2 in sequence table；
(j2) DNA molecular of the code area as shown in sequence 4 in sequence table；
(j3) DNA sequence dna limited under strict conditions with (j1) or (j2) hybridizes and the DNA of code for said proteins divides
Son；
(j4) DNA sequence dna limited with (j1) or (j2) has the DNA of more than 90% homology and code for said proteins
Molecule.
Above-mentioned stringent condition can be that 0.1%SDS solution is miscellaneous in DNA or RNA with 0.1 × SSPE (or 0.1 × SSC)
Hand over and hybridize in experiment at 65 DEG C and wash film.
Cause the specific deletion of PS I in corn and arabidopsis after PSA3 gene mutations.Ribosomes model experiment and isotope
Pulse labeling experimental analysis shows that the synthesis rate of the PSI subunits of chloroplaset coding does not change in mutant, and this shows
PSA3 protein functions are included in the biological generating process after PSI is translated.PSA3 albumen is positioned at the matrix of Thylakoid membrane
Side, complex size where it is slightly smaller than ripe PSI complexs.Yeast two-hybrid and bimolecular fluorescence complementary experiment card
Bright PSA3 albumen and PYG7 interactions between protein, and PSA3 albumen and PYG7 albumen is found positioned at similar mass size respectively
In thylakoid membrane related complexes.In summary, it was found by the inventors of the present invention that lacking PSA3 albumen photosystemⅰ is combined
Body can not be assembled correctly, so that PsaA albumen is degraded rapidly, furthermore, it is understood that PSA3 albumen and PYG7 albumen exist jointly
The assembling and stably of the thylakoid membrane matrix side auxiliary PSI complexs of PSI assemblings.The present invention is for photosynthetic eucaryote PS's I
Research has major application value.
Brief description of the drawings
Fig. 1 is the phenotype of the plant to be measured in tri-leaf period in embodiment 2.
Fig. 2 is Western blot detection Zm-PSA3 protein levels in embodiment 2.
Fig. 3 detects the water of PsaA albumen, D2 albumen, PetA albumen and AtpB albumen for Western blot in embodiment 2
It is flat.
Fig. 4 is the result of phenotypic evaluation in embodiment 3.
Fig. 5 is the result of Western blot detections in embodiment 3.
Fig. 6 be embodiment 4 in first to electrophoresis result.
Fig. 7 be embodiment 4 in second to electrophoresis result.
Fig. 8 is the result of embodiment 5.
Fig. 9 is the result of embodiment 6.
Figure 10 is the result of embodiment 7.
Figure 11 is the result of embodiment 8.
Figure 12 is the result of embodiment 9.
Embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, is conventional method unless otherwise specified.Test material used in following embodiments, is certainly unless otherwise specified
What routine biochemistry reagent shop was commercially available.Quantitative test in following examples, is respectively provided with three repetition experiments, as a result makes even
Average.
The C-terminal fusion His of Zm-PSA3 albumen shown in sequence 1 in sequence table6Label, then exempts from as immunogene
Epidemic disease rabbit, obtains the polyclonal antibody of Zm-PSA3 albumen, abbreviation Zm-PSA3 antibody.
Primary antibody for detecting PsaA albumen：AS06172, Agrisera.Primary antibody for detecting D2 albumen：AS06
146PRE, Agrisera.Primary antibody for detecting PetA albumen：AS06119, Agrisera.For detecting AtpA/AtpB albumen
Primary antibody：AS05 085PRE, Agrisera.Primary antibody for detecting PsaD albumen：AS09 461, Agrisera.For detecting
The primary antibody of FLAG labels：AS15 2871,Agrisera.Primary antibody for detecting PsaC：AS10 939,Agrisera.For examining
Survey PsaF primary antibody：AS06 104,Agrisera.Primary antibody for detecting PsaK：AS04 049,Agrisera.For detecting
PsaL primary antibody：AS06 108,Agrisera.
Embodiment 1, the function of PSA3 albumen are found
The present inventor constructs the Maize mutant storehouse of Mu transposons induction, and therefrom screening can not carry out photosynthetic work
Mutant strain (plant with yellow phenotype), is divided into using the insertion of deep sequencing method identification of M u- transposons with phenotype
From identifying several insertion mutations.There is an insertion point near the initiation codon of specific gene in one mutant strain,
The mutant strain is named as mutant strain first.Another mutant strain has one at the 3rd extron of identical specific gene and inserted
Angle of striking, mutant strain second is named as by the mutant strain.Mutant strain first and mutant strain second lack PSI reaction centers albumen (PsaA eggs
In vain), but PSII cores subunit, Cytochrome b_6f complex, atp synthase and Rubisco levels and wild strain are basically identical,
Plant leaf shows elevated chlorophyll fluorescence, cultivates dead after three weeks in soil after seed energy exhausts.As a result show,
The specific gene coding participates in the albumen that PS I is assembled/stablized, and the specific gene is named as into Zm-PSA3 gene (open readings
Frame is as shown in the sequence 2 of sequence table), the protein of the gene code is named as the Zm-PSA3 albumen (sequence 1 of such as sequence table
It is shown).The original annotation of protein is interpreted as calcium balance regulatory factor (calcium homeostasis shown in the sequence 1 of sequence table
regulator).Zm-PSA3 genes are recessive gene, and yellow phenotype occurs for the plant of homozygous genotype.Zm-PSA3 genes are main
Express, matched with the developmental stage for activating chloroplaset in young leaf tissue.
The homologous gene of Zm-PSA3 genes is found in arabidopsis gene group, At-PSA3 genes are named as
(AT3G55250, ORFs is as shown in the sequence 4 of sequence table), At-PSA3 eggs are named as by the protein of the gene code
In vain (as shown in the sequence 3 of sequence table, 1-45 are signal peptide, and 46-277 are maturation protein).The institute of sequence 3 of sequence table
Show that the original annotation of protein is interpreted as calcium balance regulatory factor (calcium homeostasis regulator).At-PSA3 albumen is deposited
It is in chloroplast protein group.From arabidopsis SALK mutant libraries, (the SALK collection, network address is：http://
Signal.salk.edu) (numbering is SAIL_503_ to the commercially available mutant arabidopsis that T-DNA insertions occur in AT3G55250
B01；The background plant of mutant arabidopsis is Columbia ecotype arabidopsis, Col-0), it is named as At-psa3 mutation
Body.Through genome sequencing, compared with Columbia ecotype arabidopsis, the difference of At-psa3 mutant is only that a dye
Colour solid inserts T-DNA (before insertion position is " AGCTTCTTAAAG ", positioned at the 3rd of gene in At-PSA3 genes
At extron), any insertion does not occur for another item chromosome.The homozygosis offspring of At-psa3 mutant (send out by i.e. two chromosomes
Give birth to the T-DNA insertions) yellow phenotype is shown, it is transplanted in soil dead quickly.The homozygosis offspring of At-psa3 mutant
(i.e. two chromosomes there occurs the T-DNA insertion) sowing in the MS culture mediums containing 2% sucrose, plant occur it is grayish green,
Slow-growing phenotype, blade has high chlorophyll fluorescence, lacks PSI PsaA albumen.
The comparison of embodiment 2, mutant Zea mays and wild-type corn
Using corn HiII seed embryo as acceptor, Zm-PSA3 genes are knocked out using CAS9 technologies orientation, mutant are obtained beautiful
Rice, is named as Zm-psa3 mutant.Through genome sequencing, compared with corn HiII, the difference of Zm-psa3 mutant
The Zm-PSA3 genes being only that in item chromosome lose encoding function, the Zm-PSA3 genes and acceptor of another item chromosome
It is identical.
Plant to be measured is respectively：Homozygosis offspring (the Zm- in i.e. two chromosomes of corn HiII and Zm-psa3 mutant
PSA3 genes lose encoding function).
1st, phenotypic evaluation
The phenotype of the plant to be measured in tri-leaf period is shown in Fig. 1.In Fig. 1, left side plant is corn HiII, and right side plant is Zm-
The homozygosis offspring of psa3 mutant.Compared with corn HiII, the homozygosis offspring of Zm-psa3 mutant is slow-growing.
Phenotype (the ginseng of tri-leaf period plant to be measured is observed using mini-PAM chlorophyll fluorometer (Walz)
Examine document：Meurer J,Meierhoff K,Westhoff P(1996)Isolation of high-chlorophyll-
fluorescence mutants of Arabidopsis thaliana and their characterisation by
spectroscopy,immunoblotting and northern hybridisation.Planta 198:385-396).With
Corn HiII is compared, and the blade of the homozygosis offspring of Zm-psa3 mutant has high chlorophyll fluorescence.
2nd, the identification of Zm-PSA3 protein levels
The total protein of tri-leaf period plant leaf to be measured is extracted, SDS-PAGE and Western blot are carried out, Zm-PSA3 is detected
Protein level, is as a result shown in Fig. 2.In Fig. 2,1 corresponding corn HiII, the homozygosis offspring of 2 corresponding Zm-psa3 mutant.Corn HiII
Middle Zm-PSA3 albumen correspondence about 26kDa band.Zm-PSA3 albumen is can't detect in the homozygosis offspring of Zm-psa3 mutant.
3rd, other expressing quantities are detected
The total protein of tri-leaf period plant leaf to be measured is extracted, SDS-PAGE and Western blot are carried out, PsaA eggs are detected
In vain, the level of D2 albumen, PetA albumen and AtpB albumen.As a result Fig. 3 is seen.In Fig. 3,1 corresponding corn HiII, 2 corresponding Zm-psa3
The homozygosis offspring of mutant.Compared with corn HiII, PsaA protein levels significantly drop in the homozygosis offspring of Zm-psa3 mutant
Low, the level of D2 albumen, PetA albumen and AtpB albumen is without significant difference.
Embodiment 3, wildtype Arabidopsis thaliana, saltant type arabidopsis and the comparison for covering strain arabidopsis
Refer to pCAMBIA1300-flag carriers document (respective name in the literature be " a modified
pCAMBIA1300containing either the Myc or Flag coding sequence”)：Zhao Y,Xie S,
Li X,Wang C,Chen Z,Lai J,Gong Z.。REPRESSOR OF SILENCING5Encodes a Member of
the Small Heat Shock Protein Family and Is Required for DNA Demethylation in
Arabidopsis.Plant Cell.2014Jun；26(6):2660-2675..
First, the acquisition of strain is covered
1st, the double chain DNA molecule shown in the sequence 4 of sequence table from the nucleotides of 5 ' end 1-831 is inserted
Between XbaI the and SalI restriction enzyme sites of pCAMBIA1300-flag carriers, recombinant plasmid is obtained.According to sequencing result, to restructuring
Plasmid carries out structure and is described as follows：Sequence is inserted between XbaI the and SalI restriction enzyme sites of pCAMBIA1300-flag carriers
DNA molecular shown in the sequence 4 of table from the nucleotides of 5 ' end 1-831, the DNA molecular and the partial nucleotide on carrier framework
Acid fusion, expression C-terminal merges the At-PSA3 albumen (abbreviation PSA3-FLAG albumen) of three FLAG labels.
2nd, the recombinant plasmid for obtaining step 1 imports Agrobacterium GV3101, obtains recombinational agrobacterium.
3rd, genetic transformation is carried out to At-psa3 mutant using dipping in the recombinational agrobacterium that colored method obtains step 2, collected again
The seed of raw plant (T0 is for seed).
4th, T0 is T1 for plant for the plant that seed grows up to, and T1 obtains T1 for seed for plant selfing, and T1 is long for seed
Into plant be T2 for plant, T2 obtains T2 for seed for plant selfing, and T2 is T3 for plant for the plant that seed grows up to.
Performing PCR identification is entered for plant for the T2 of plant and random sampling to T1 and (genomic DNA is extracted, using F1 and R1 groups
Into primer pair enter performing PCR amplification, if obtaining 800-900bp amplified production, be accredited as the positive), if a certain T1 generation plant
The T2 of strain and its sampling Detection is accredited as the positive for plant, and the T1 is a covering strain for plant and its self progeny.
F1：ATATCTAGAATGGTGGTTGTCACTCACATC；
R1：ATAGTCGACAAGACTCTATGTTTTGTTGTTGAAGG.
2nd, related identification
Plant to be measured is respectively：(i.e. two chromosomes there occurs the T-DNA to the homozygosis offspring of At-psa3 mutant
Insertion), Columbia ecotype arabidopsis, covering strain in background plant for " two chromosomes there occurs the T-DNA insert
Enter " Mutants homozygous T3 for plant.
For identifying side of the background plant for the Mutants homozygous of " two chromosomes there occurs the T-DNA insertions "
Method：Genomic DNA is extracted, primer pair first (F2 and R2 compositions) is respectively adopted and primer pair B (F3 and R2 compositions) enters performing PCR expansion
Increase, if can not realize amplification using primer pair first and can realize amplification using primer pair B, be accredited as the positive.
F2：TTGAACATTGATGCGCCAAC；
R2：CCATACGGCAAACACCATCT；
F3：TAGCATCTGAATTTCATAACCAATCTCGATACAC.
The phenotype for sprouting the plant to be measured after 3 weeks is shown in Fig. 4 A.
The table of the plant to be measured after sprouting 3 weeks is observed using mini-PAM chlorophyll fluorometer (Walz)
Type (bibliography：Meurer J,Meierhoff K,Westhoff P(1996)Isolation of high-
chlorophyll-fluorescence mutants of Arabidopsis thaliana and their
characterisation by spectroscopy,immunoblotting and northern
hybridisation.Planta 198:385-396).Photo is shown in Fig. 4 B.
Compared with Columbia ecotype arabidopsis, the homozygosis offspring of At-psa3 mutant is slow-growing, green with high leaf
Plain fluorescence.The T3 of covering strain has covered the above-mentioned phenotype of the homozygosis offspring of At-psa3 mutant for plant, is given birth to Colombia
State type is basically identical.
The total protein of the blade of the plant to be measured after sprouting 3 weeks is extracted, SDS-PAGE and Western blot, detection is carried out
PsaA albumen, D2 albumen, PetA albumen, the level of AtpA albumen and PSA3-FLAG albumen.As a result Fig. 5 is seen.In Fig. 5,1 correspondence
Columbia ecotype arabidopsis, the homozygosis offspring of 2 corresponding A t-psa3 mutant, the T3 of 3 correspondence covering strains is for plant.With
Columbia ecotype arabidopsis is compared, and PsaA protein levels are significantly reduced in the homozygosis offspring of At-psa3 mutant, D2 eggs
In vain, the level of PetA albumen and AtpA albumen is without significant difference.Cover the T3 of strain for PsaA albumen in plant, D2 albumen,
The level of PetA albumen and AtpA albumen is with Columbia ecotype arabidopsis without significant difference.
Embodiment 4, PSA3 albumen are responsible for PSI protein aggregation and worked in PSI assembling intermediates
Test material is respectively：Homozygosis offspring (i.e. two dyes for the Zm-psa3 mutant that corn HiII, embodiment 2 are obtained
Zm-PSA3 genes in colour solid lose encoding function), Columbia ecotype arabidopsis, the homozygosis of At-psa3 mutant
Offspring (i.e. two chromosomes there occurs the T-DNA insertions).
1st, the fresh blade of the corn trials material in tri-leaf period is taken, the arabidopsis test material after sprouting three weeks is taken
Fresh blade, extracts quasi-sac film protein (bibliography respectively：The molecule machine of the assemblings of Peng Lianwei, LPA1 regulation and control arabidopsis PS II
Reason research, 2006, Lanzhou University).
2nd, the quasi-sac film protein that step 1 is obtained is dissolved in into DDM (n-dodecyl-D-maltoside) to carry out afterwards
Blue-Native PAGE(BN-PAGE).Then, the protein complexes on BN-PAGE glue are transferred on cellulose membrane, carried out
Western blot, use the primary antibody of PsaD albumen to detect PSI (existence form of PsaD albumen for be assembled in PSI).
As a result Fig. 6 is seen.In Fig. 6,1 corresponding corn HiII, the homozygosis offspring of 2 corresponding Zm-psa3 mutant, 3 corresponding brother's human relations
Than sub- Arabidopsis thaliana ecotype, the homozygosis offspring of 4 corresponding A t-psa3 mutant.According to BN-PAGE result, PSI stainable bands
(bibliography：Peng L,Fukao Y,Fujiwara M,Takami T,Shikanai T(2009)Efficient
operation of NAD(P)H dehydrogenase requires supercomplex formation with
photosystem I via minor LHCI 755in Arabidopsis.Plant Cell 21:3623-3640) in Zm-
Reduced in the homozygosis offspring of psa3 mutant and the homozygosis offspring of At-psa3 mutant：One is that corresponding NDH-PSI surpasses
Level complex, another be PSI and PSII dimer (migrating body altogether).According to Western blot result, in corn
There is an obvious smaller complex (see " * " mark in figure) with PsaD albumen in HiII, but in Zm-psa3
Lacked in the homozygosis offspring of mutant, the band should be PSI assembling intermediate (bibliography：Wittenberg G,Jarvi
S,Hojka M,Toth SZ,Meyer EH,Aro EM,Schottler MA,Bock R802(2017)Identification
and characterization of a stable intermediate in photosystem I 803assembly in
tobacco.Plant J)。
4th, complete after step 3, carry out second to electrophoresis (SDS-ureaPAGE).As a result Fig. 7 is seen.In Fig. 7, upper left correspondence brother
Rival Asia Arabidopsis thaliana ecotype, the homozygosis offspring of upper right corresponding A t-psa3 mutant, lower-left correspondence corn HiII, bottom right correspondence
The homozygosis offspring of Zm-psa3 mutant.In the homozygosis offspring and the homozygosis offspring of At-psa3 mutant of Zm-psa3 mutant
Middle PSI subunit is lacked.
The not responsible chloroplaset coding PSI subunits of embodiment 5, PSA3 albumen and the gene expression for assembling the factor
The biological of PSI how to be participated in order to explore PSA3 to occur, the PSI subunits of analysis chloroplaset coding and PSI assemblings because
The expression of son.
Test material is respectively：Homozygosis offspring (i.e. two dyes for the Zm-psa3 mutant that corn HiII, embodiment 2 are obtained
Zm-PSA3 genes in colour solid lose encoding function), Columbia ecotype arabidopsis, the homozygosis of At-psa3 mutant
Offspring (i.e. two chromosomes there occurs the T-DNA insertions).
The excised leaf of the arabidopsis test material after sprouting 10 days is taken, pulse labeling experiment is carried out.Pulse labeling is described
The bibliography of experiment：Liu J,Yang H,Lu Q,Wen X,Chen F,Peng L,Zhang L,Lu C(2012)PsbP-
domain protein1,a nuclear-encoded thylakoid lumenal protein,is essential for
photosystem I assembly in Arabidopsis.Plant Cell 24:4992-5006.As a result Fig. 8 is seen.At-
PsaA albumen and the synthesis of PsaB albumen are uninfluenced in the homozygosis offspring of psa3 mutant.After 1 hour/2 hours, At-psa3 dashes forward
The degradation speed ratio of PsaA albumen and PsaB albumen is fast in Columbia ecotype arabidopsis in the homozygosis offspring of variant.
The corn trials material in tri-leaf period is taken, ribosomes atlas analysis (Ribosomeprofiling) is carried out.Description
The bibliography of ribosomes atlas analysis：Zoschke R,Watkins K,Barkan A(2013)A rapid
microarray-based ribosome profiling 809method elucidates chloroplast ribosome
behavior in vivo Plant Cell 25:2265-2275.It the results are shown in Table 2.Corn HiII, Zm-psa3 mutant it is pure
Close offspring, PsaA/B, the no differences of PsaC and Ycf3 mRNA.
Table 2
| Corn HiII | The homozygosis offspring of Zm-psa3 mutant | |
| PsaA | 21618 | 24567 |
| PsaB | 26285 | 27925 |
| PsaC | 27221 | 20335 |
| PsaI | 18108 | 16554 |
| PsaJ | 19523 | 19541 |
| ycf3 | 5138 | 6670 |
| ycf4 | 3403 | 5624 |
In summary, PSA3 albumen works during being after the translation of PSI protein subunits.
Embodiment 6, PSA3 protein bindings are in the matrix side of Thylakoid membrane albumen
1st, the total protein of the blade in tri-leaf period corn HiII is extracted, is divided into thylakoid and matrix two parts (bibliography：Peng
The molecular mechanism research of the assemblings of Lian Wei, LPA1 regulation and control arabidopsis PS II, 2006, Lanzhou University).Respectively carry out SDS-PAGE and
Western blot (detection PSA3 albumen).It was found that PSA3 albumen is mainly enriched in thylakoid part, also there is a small amount of in matrix
Distribution.
2nd, using Na2CO3Or NaBr handles complete thylakoid and (if can wash PSA3 albumen off, illustrates PSA3
Albumen is located at the matrix side of thylakoid；If can't be washed off, positioned at the blister cavities side of thylakoid).Then carry out SDS-PAGE and
Western blot (detection PSA3 albumen).As a result show, Na2CO3Or NaBr can wash most of PSA3 albumen off.
PSA3 albumen is located at the blister cavities side of thylakoid membrane.
3rd, complete thylakoid is handled with Proteinase K (Proteinase K) or thermolysin (Thermolysin).
Then SDS-PAGE and Western blot (detection PSA3 albumen) are carried out.As a result show, PSA3 albumen is degraded, and thylakoid
The OE23 albumen of blister cavities side is still complete.
4th, with Triton X-100 by thylakoid membrane all dissolve, while add Proteinase K (Proteinase K) or
Thermolysin (Thermolysin).As a result show, PSA3 albumen and OE23 albumen can all be degraded.
Result above is shown in Fig. 9 (P represents precipitation, and S represents supernatant).Result above all shows that PSA3 albumen depends on chloroplaset
The matrix side of thylakoid membrane.
The accumulation of embodiment 7, PSA3 albumen in PSI assembles factor mutant
In order to further explore the relation between PSA3 albumen and other PSI biology generation GAP-associated protein GAPs, PSA3 is compared
Expression of the albumen to photosynthetic GAP-associated protein GAP in other related corn PSI mutant.
Zm-psa2 is the thylakoids cavity side assembling factor, and Zm-pyg7 is the assembling factor on thylakoid inner membrance.Mutant
Corn Zm-psa2, mutant Zea mays Zm-pyg7 are recorded in following document：Fristedt R,Williams-Carrier R,
Merchant SS,Barkan A(2014)A thylakoid membraneprotein harboring a DnaJ-type
zinc finger domain is required for photosystem Iaccumulation in plants.J Biol
Chem 289:30657-30667。
Test material is respectively：Homozygosis offspring (i.e. two dyes for the Zm-psa3 mutant that corn HiII, embodiment 2 are obtained
Zm-PSA3 genes in colour solid lose encoding function), mutant Zea mays Zm-psa2 homozygosis offspring, mutant Zea mays
Zm-pyg7 homozygosis offspring.
The total protein of the blade of each tri-leaf period corn experiment material is extracted, SDS-PAGE and Western blot are carried out.
As a result Figure 10 is seen.In Figure 10, the homozygosis offspring of 1 corresponding Zm-psa3 mutant, after 2 corresponding mutant Zea mays Zm-psa2 homozygosis
Generation, 3 corresponding mutant Zea mays Zm-pyg7 homozygosis offspring.The homozygosis offspring of each mutant has lacked the table of PSI core subunits
Reach.In mutant Zea mays Zm-psa2 homozygosis offspring, mutant Zea mays Zm-pyg7 homozygosis offspring, PSA3 protein aggregations are just
Normal, illustrate the accumulation of PSA3 albumen independent of PSI.In mutant Zea mays Zm-pyg7 homozygosis offspring, PSA3 protein levels
Slightly decline explanation PYG7 albumen and PSA3 albumen is possible to be functionally and physiologically interaction.
Embodiment 8, PSA3 albumen are present in quasi-sac film protein complex, and position is slightly below the PSI complexs of maturation
Test material is respectively：Homozygosis offspring (i.e. two dyes for the Zm-psa3 mutant that corn HiII, embodiment 2 are obtained
Zm-PSA3 genes in colour solid lose encoding function), mutant Zea mays Zm-psa2 homozygosis offspring, mutant Zea mays
Zm-pyg7 homozygosis offspring.
1st, the fresh blade of the corn trials material in tri-leaf period is taken, quasi-sac film protein is extracted.
2nd, the quasi-sac film protein that step 1 is obtained is dissolved in after DDM and carries out Blue-Native PAGE (BN-PAGE).
Then, the protein complexes on BN-PAGE glue are transferred on cellulose membrane, carry out Western blot (detection PSA3 albumen
With PsaA albumen).
As a result Figure 11 is seen.In Figure 11,1 corresponding corn HiII, the homozygosis offspring of 2 corresponding Zm-psa3 mutant, 4 correspondences are prominent
Variant corn Zm-psa2 homozygosis offspring, 3 corresponding mutant Zea mays Zm-pyg7 homozygosis offspring.Mutant Zea mays Zm-psa2
Homozygosis offspring, in mutant Zea mays Zm-pyg7 homozygosis offspring, the poly state of PSA3 albumen is all varied from.Mutant
In corn Zm-psa2 homozygosis offspring, PSA3 protein aggregation normal level even more highs, this further offers PSA3 albumen not
It is present in ripe PSI evidence.In mutant Zea mays Zm-pyg7 homozygosis offspring, the abundance of PSA3 protein complexes is reduced, table
It is necessary when bright PYG7 albumen is to the formation of PSA3 protein bindings and complex.The position of complex is slightly low where PSA3 albumen
In PSI complexs, it is migrated in the front end of PSI complexs.These results show that PYG7 albumen and PSA3 albumen are probably presence
In in same big complex.
Embodiment 9, PSA3 and the PYG7 interaction in yeast and protoplast
At-PYG7 albumen is as shown in the sequence 5 of sequence table.In At-PYG7 albumen, the 1st to 59 is signal peptide, 60-
301 be maturation protein.The unnamed gene for encoding At-PYG7 albumen is At-PYG7 genes, the sequence of ORFs such as sequence table
Shown in 6.
First, yeast two-hybrid assay
PCCW-SUC carriers are bait expression vector.PDSL-Nx carriers (also known as " pDSL-Nx vector ") and pDL2-xN
Carrier (also known as " pDL2-xNprey vector ") it is prey expression vector.
DNA molecular (the 178-903 nucleotides of sequence 6) the insertion PCCW-SUC for encoding At-PYG7 maturation proteins is carried
Body, obtains the recombinant plasmid of expressed fusion protein AtPYG7-Cub (including At-PYG7 maturation proteins and Cub, Cub are located at C-terminal)
A。
DNA molecular (the 136-834 nucleotides of sequence 4) the insertion pDSL-Nx for encoding At-PSA3 maturation proteins is carried
Body, obtains the restructuring matter of expressed fusion protein NubG-AtPSA3 (including NubG and At-PSA3 maturation proteins, NubG is positioned at N-terminal)
Grain B.
DNA molecular (the 136-831 nucleotides of sequence 4) the insertion pDL2-xN for encoding At-PSA3 maturation proteins is carried
Body, obtains the restructuring matter of expressed fusion protein AtPSA3-NubG (including At-PSA3 maturation proteins and NubG, NubG are located at C-terminal)
Grain C.
The DNA molecular (the 136-669 nucleotides+TAA of sequence 4) for encoding At-PSA3 △ C is inserted into pDSL-Nx carriers,
Obtaining expressed fusion protein NubG-AtPSA3 △ C, (including NubG and AtPSA3 △ C, NubG are located at N-terminal；At-PSA3 △ C are
The C-terminal of At-PSA3 maturation proteins has lacked 54 amino acid residues) recombinant plasmid D.
Will restructuring inducible vectors (recombinant plasmid A) and restructuring prey vector (recombinant plasmid B, recombinant plasmid C or recombinant plasmid
D it is) common to import NWY32 yeast (Dualsystems Biotech companies), respectively in flat board first (- TLHA) and flat board second (- TL)
It is upper to be cultivated.Flat board first is the SD medium agar flat boards for lacking leucine, tryptophan, histidine and adenine.Flat board second
To lack the SD medium agar flat boards of leucine, tryptophan.
As a result Figure 12 A are seen.Interaction can be detected between AtPYG7-Cub and NubG-AtPSA3, still.AtPYG7-Cub
The interaction between albumen is can't detect between AtPSA3-NubG, shows the C-terminal pair and AtPYG7 albumen of AtPSA3 albumen
Interaction is extremely important.After the amino acid of AtPSA3 PROTEIN Cs end 54 is removed, then AtPSA3 albumen and AtPYG7 eggs are can't detect
Interaction between white, this has similarly confirmed AtPSA3 PROTEIN Cs end in mediation AtPSA3 albumen and the weight in AtPYG7 interactions
Act on.
2nd, fluorescence complementary experiment (bimolecular fluorescence complementation assay, BiFC)
There is the code sequence in the coded sequence of N-YFP albumen, pUC-SPYCE with C-YFP albumen in pUC-SPYNE
Row.The YFP albumen that N-YFP albumen and C-YFP albumen composition are completed, produces YFP fluorescence.
The DNA molecular (the 136-831 nucleotides of sequence 4) for encoding At-PSA3 maturation proteins is inserted into pUC-SPYNE,
Obtain recombinant plasmid E.Recombinant plasmid E expresses the fusion protein of At-PSA3 maturation proteins and N-YFP albumen, and (N-YFP albumen is located at
C-terminal), use PSA3-YFPNRepresent.
The DNA molecular (the 136-831 nucleotides of sequence 4) for encoding At-PSA3 maturation proteins is inserted into pUC-SPYCE,
Obtain recombinant plasmid F.Recombinant plasmid F expresses the fusion protein of At-PSA3 maturation proteins and C-YFP albumen, and (C-YFP albumen is located at
C-terminal), use PSA3-YFPCRepresent.
The DNA molecular (the 178-903 nucleotides of sequence 6) for encoding At-PYG7 maturation proteins is inserted into pUC-SPYNE,
Obtain recombinant plasmid G.Recombinant plasmid G expresses the fusion protein of At-PYG7 maturation proteins and N-YFP albumen, and (N-YFP albumen is located at
C-terminal), use PYG7-YFPNRepresent.
The DNA molecular (the 178-903 nucleotides of sequence 6) for encoding At-PYG7 maturation proteins is inserted into pUC-SPYCE,
Obtain recombinant plasmid H.Recombinant plasmid H expresses the fusion protein of At-PYG7 maturation proteins and C-YFP albumen, and (C-YFP albumen is located at
C-terminal), use PYG7-YFPCRepresent.
Recombinant plasmid E and recombinant plasmid H are imported into Columbia ecotype protoplasts of Arabidopsis thaliana broken by ultrasonic jointly, adopted after 16 hours
With the laser confocal scanning microscope (490meta of LSM 510；Zeiss YFP fluorescence) is captured.By recombinant plasmid F and restructuring matter
Grain G imports Columbia ecotype protoplasts of Arabidopsis thaliana broken by ultrasonic jointly, and laser confocal scanning microscope (LSM is used after 16 hours
510 490meta；Zeiss YFP fluorescence) is captured.
As a result Figure 12 B are seen.YFP fluorescence is in PYG7-PSA3 it is observed that explanation PYG7 albumen and PSA3 albumen are mutual
Make.
SEQUENCE LISTING
<110>Institute of Botany, Chinese Academy of Sciences
<120>Application of the PSA3 albumen in participating in PSI assembling and maintaining PSI stable
<130> GNCYX171023
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 269
<212> PRT
<213>Corn
<400> 1
Met Gly Ala Leu Pro Val Ala His Ser Leu Ala Leu Thr Ala Ala Phe
1 5 10 15
Leu Pro Cys Arg Arg Pro Ala Ala His Gly Arg Cys Arg Arg Arg Arg
20 25 30
Tyr Arg Ala Val Val Ala Tyr Met Glu Pro Asn Pro Asn Ser Pro Ala
35 40 45
Ala Ile Ala Gly Arg Leu Val Gly Ala Leu Pro Ile Val Gly Leu Val
50 55 60
Ala Arg Ile Leu Asn Asp Glu Gly Gly Val Gly Gly Asp Ile Ile Asp
65 70 75 80
Phe Ala Glu Phe Arg Arg Arg Val Ser Lys Lys Cys Thr Val Met Asp
85 90 95
Ser Lys Ala Phe Tyr Asp Phe Asn Gln Arg Arg Gly Lys Pro Gly Asp
100 105 110
Pro Phe Tyr Val Leu Leu Cys Cys Trp Leu Ala Ala Ile Gly Ala Gly
115 120 125
Leu Leu Lys Thr Glu Glu Ile Leu Glu Gly Val Ala Arg Leu Arg Ile
130 135 140
Ser Asn Asp Ile Glu Phe Glu Glu Glu Thr Phe Ile Asp Met Met Arg
145 150 155 160
Ala Ala Lys Glu Lys Arg Ala Lys Leu Lys Ala Pro Ala Pro Gln Ile
165 170 175
Pro Met Glu Thr Arg Ala Glu Lys Ala Leu Glu Ala Ile Tyr Val Cys
180 185 190
Cys Phe Gly Gln Asp Met Val Glu Asp Glu Asp Glu Lys Leu Leu Arg
195 200 205
Ala Ile Leu Asn Ala Val Phe Pro Ser Val Gly Arg Ala Ala Val Glu
210 215 220
Arg Met Val Ala Ser Met Ala Lys Gln Val Ala Ser Gly Glu Arg Lys
225 230 235 240
Arg Asp Gly Arg Thr Val Ser Lys Glu Val Gln Gln Arg Gln Leu Lys
245 250 255
Asp Leu Glu Phe Leu Lys Gln Asn Lys Leu Glu Ser Ser
260 265
<210> 2
<211> 810
<212> DNA
<213>Corn
<400> 2
atgggggcgc tacccgtcgc ccacagtctc gctctcaccg ccgcgttcct cccgtgccgc 60
cgccccgcgg cccacggccg gtgccggcgc cggcggtaca gagcggtggt ggcgtacatg 120
gagccgaacc ccaactcgcc ggcggccatc gcggggcgcc tcgtcggcgc ccttcccatc 180
gtgggcctcg tggcgcgcat cctcaacgac gagggcggcg tcggcggcga catcatcgac 240
ttcgccgagt tccgccgccg cgtcagcaag aagtgcacgg tcatggactc caaggccttc 300
tacgacttca accaacgacg cgggaagcca ggcgatccct tctacgttct actgtgctgc 360
tggctggccg ccatcggcgc cgggctgctc aaaacggagg agatcttgga aggcgtggcg 420
cgcctccgca tctccaacga catcgagttc gaggaggaga cgttcatcga catgatgagg 480
gcggcaaagg agaaaagggc gaagctgaag gctcctgctc cgcagatacc gatggagacg 540
cgggcggaga aggccctcga agccatctac gtgtgctgct tcggtcagga catggtggag 600
gacgaggacg agaagcttct ccgggcgata ctgaacgccg tgttcccctc cgtcgggcgg 660
gccgcggtcg agaggatggt ggcgtccatg gccaagcagg tggcctccgg cgagaggaag 720
cgggacggga ggaccgtgtc caaggaagtg cagcagcggc agctcaagga cctggagttt 780
ctgaagcaga acaagctgga gtcgtcgtga 810
<210> 3
<211> 277
<212> PRT
<213>Arabidopsis
<400> 3
Met Val Val Val Thr His Ile Ser Thr Ser Phe His Gln Ile Ser Pro
1 5 10 15
Ser Phe Phe His Leu Arg Leu Arg Asn Pro Ser Thr Thr Ser Ser Ser
20 25 30
Arg Pro Lys Leu Asp Gly Gly Phe Ala Leu Ser Ile Arg Ala Tyr Ile
35 40 45
Glu Lys Pro Asn Ser Phe Ser Thr Phe Ala Asn Lys Val Ile Gly Ser
50 55 60
Leu Pro Val Ile Gly Leu Leu Ala Arg Ile Ile Ser Asp Glu Gly Gly
65 70 75 80
Val Gly Arg Asp Leu Val Asp Phe Ala Glu Phe Arg Lys Arg Val Gly
85 90 95
Asn Lys Cys Thr Pro Asp Asp Ser Arg Ala Phe Tyr Glu Phe Gln Gln
100 105 110
Arg Arg Gly Lys Ala Gly Glu Pro Leu Tyr Val Leu Leu Cys Cys Trp
115 120 125
Val Ala Ala Val Gly Ala Gly Leu Leu Lys Ser Glu Glu Ile Leu Glu
130 135 140
Gly Val Thr Arg Val Ser Ile Ser Asn Asp Leu Glu Phe Glu Glu Gln
145 150 155 160
Asn Phe Ile Ala Leu Met Thr Glu Ala Arg Gln Arg Arg Ala Lys Leu
165 170 175
Asn Ile Asp Ala Pro Thr Ile Pro Met Glu Leu Arg Val Glu Lys Ala
180 185 190
Leu Glu Gly Ile Tyr Ala Cys Cys Phe Arg Arg Gly Leu Ile Glu Glu
195 200 205
Glu Asp Glu Lys Leu Leu Lys Val Met Leu Ile Ala Val Phe Pro Ser
210 215 220
Val Glu Lys Ser Glu Ile Glu Arg Ile Ile Lys Glu Lys Ala Thr Arg
225 230 235 240
Val Glu Glu Gly Gly Glu Glu Glu Asn Val Met Ala Lys Arg Leu Pro
245 250 255
Lys Glu Ala Ile Gln Met Gln Met Lys Asp Leu Glu Phe Leu Gln Gln
260 265 270
Gln Asn Ile Glu Ser
275
<210> 4
<211> 834
<212> DNA
<213>Arabidopsis
<400> 4
atggtggttg tcactcacat ctccacttcc ttccaccaaa tctctccttc cttcttccat 60
ctccgtcttc gtaatccctc caccacttct tcgtctcgtc ccaaactcga cggtggtttc 120
gctttgtcaa ttcgagctta catagagaaa ccaaactctt tctccacctt cgctaacaaa 180
gtcatcggtt ctcttcccgt tatcggactc ctcgctcgaa ttatcagcga tgaaggcggc 240
gttggtagag atctcgtcga tttcgctgag tttaggaaac gagttgggaa taaatgtact 300
cctgatgatt ctagggcttt ctatgagttc caacagcgac gaggcaaggc aggtgagcct 360
ttgtatgtgc ttctgtgttg ttgggttgct gcagtaggtg caggtcttct caaatctgaa 420
gagattcttg aaggtgttac tagagttagc atttccaatg atctcgagtt tgaagaacag 480
aacttcattg ctttgatgac tgaagctaga cagagaagag caaagttgaa cattgatgcg 540
ccaacaatac cgatggaact aagagttgaa aaggctcttg aaggtattta tgcttgttgc 600
tttcggagag gacttattga agaggaggat gagaagcttc ttaaagtgat gttaatagcg 660
gttttcccat cggttgagaa gtctgagata gagagaatca tcaaagagaa ggcgacaagg 720
gttgaggaag gaggagagga agagaatgtt atggcgaaac ggttgcctaa agaagctatt 780
caaatgcaga tgaaggatct tgaattcctt caacaacaaa acatagagtc ttaa 834
<210> 5
<211> 301
<212> PRT
<213>Arabidopsis
<400> 5
Met Phe Glu Ser Asn Met Val Leu Gln Thr Leu Ser Ser Ser Ser Pro
1 5 10 15
Pro Ile His Arg Leu Tyr Leu His His Ser Gln Ile Leu Pro Ser Ser
20 25 30
Gly Ser Pro Ser Lys Ile Ser Leu Gln Ile His Gly Arg Thr Leu Ala
35 40 45
Ile Arg Ser Phe His Asp Tyr Val Phe Ala Glu Ile Ser Ala Arg Gly
50 55 60
Leu Pro Ala Leu Asn Lys Ala Ser Leu Lys Lys Leu Pro Ile Lys Gly
65 70 75 80
Ser Thr Phe Leu Leu Gly Gln Ser Leu Leu Met Val Ser Ala His Pro
85 90 95
Gln Leu Ala Ala Ala Ala Glu Ile Ile Lys Pro Glu Pro Ile Tyr Glu
100 105 110
Val Gly Glu Leu Phe Glu Leu Ser Ile Gln Leu Ser Tyr Leu Leu Leu
115 120 125
Leu Leu Gly Leu Leu Gly Val Gly Thr Phe Tyr Val Ile Arg Gln Val
130 135 140
Leu Val Arg Arg Glu Leu Asp Leu Ser Ala Lys Glu Leu Gln Glu Gln
145 150 155 160
Val Arg Ser Gly Asp Ala Ser Ala Thr Glu Leu Phe Glu Leu Gly Ala
165 170 175
Val Met Leu Arg Arg Lys Phe Tyr Pro Ala Ala Asn Lys Phe Leu Gln
180 185 190
Gln Ala Ile Gln Lys Trp Asp Gly Asp Asp Gln Asp Leu Ala Gln Val
195 200 205
Tyr Asn Ala Leu Gly Val Ser Tyr Val Arg Glu Asp Lys Leu Asp Lys
210 215 220
Gly Ile Ala Gln Phe Glu Met Ala Val Lys Leu Gln Pro Gly Tyr Val
225 230 235 240
Thr Ala Trp Asn Asn Leu Gly Asp Ala Tyr Glu Lys Lys Lys Glu Leu
245 250 255
Pro Leu Ala Leu Asn Ala Phe Glu Glu Val Leu Leu Phe Asp Pro Asn
260 265 270
Asn Lys Val Ala Arg Pro Arg Arg Asp Ala Leu Lys Asp Arg Val Lys
275 280 285
Leu Tyr Lys Gly Val Val Ala Val Lys Ser Lys Lys Arg
290 295 300
<210> 6
<211> 906
<212> DNA
<213>Arabidopsis
<400> 6
atgttcgaat cgaacatggt tcttcaaaca ctatcttctt cttctcctcc aattcaccgt 60
ctctatcttc accattctca gattctccct tcttctgggt cacccagcaa gatttctctt 120
cagatacatg gaaggacttt ggccattcga tcttttcatg attatgtctt tgcagaaatt 180
tctgctagag gtttaccggc tttgaacaaa gcttccttga agaagctacc aatcaaagga 240
tctacctttc tgctggggca gagcttgttg atggtttctg ctcacccaca gttggcagca 300
gcagcagaaa tcataaagcc tgaaccgatt tacgaagttg gagagttatt tgaacttagt 360
attcagcttt cttacttgct gttactactg gggttgcttg gagttggtac tttctatgtg 420
atccgtcaag tacttgtacg cagagaacta gacctctccg ctaaagaatt gcaggagcaa 480
gtaaggagcg gagatgcaag tgcaacagag ctctttgagc ttggtgcagt gatgttgaga 540
aggaagtttt atcctgcagc caacaagttt ttgcaacaag ctatccagaa atgggacggt 600
gatgatcaag atcttgctca ggtctataac gctcttggag tgagttatgt acgagaggat 660
aaacttgaca aaggaattgc tcagtttgaa atggcggtga agctgcaacc cggttatgta 720
acagcttgga acaaccttgg ggatgcttat gagaagaaga aggagttgcc tttggcattg 780
aatgcgtttg aagaagtttt gttgtttgat ccaaacaata aggtggctcg gcctcggcga 840
gatgcgttga aggatcgcgt gaagctttat aaaggtgttg tggctgttaa gtctaagaaa 900
cggtga 906
Claims (10)
1. the application of calcium balance regulatory factor, is at least one of following (a1) to (a6)：
(a1) assembling of photosystemⅰ complex is participated in；
(a2) formation of photosystemⅰ complex is participated in；
(a3) stability of photosystemⅰ complex is maintained；
(a4) it is used for the product for preparing the assembling for participating in photosystemⅰ complex；
(a5) it is used for the product for preparing the formation for participating in photosystemⅰ complex；
(a6) it is used for the product for preparing the stability for maintaining photosystemⅰ complex.
2. the application of calcium balance regulatory factor, is at least one of following (b1) to (b10)：
(b1) assembling of photosystemⅰ complex in photosynthetic eucaryote is participated in；
(b2) formation of photosystemⅰ complex in photosynthetic eucaryote is participated in；
(b3) stability of photosystemⅰ complex in photosynthetic eucaryote is maintained；
(b4) level of photosystemⅰ complex in photosynthetic eucaryote is maintained；
(b5) level of PsaA albumen in photosynthetic eucaryote is maintained；
(b6) it is used to prepare the product for participating in the assembling of photosystemⅰ complex in photosynthetic eucaryote；
(b7) it is used to prepare the product for participating in the formation of photosystemⅰ complex in photosynthetic eucaryote；
(b8) it is used to prepare the product for maintaining the stability of photosystemⅰ complex in photosynthetic eucaryote；
(b9) it is used to prepare the product for maintaining the level of photosystemⅰ complex in photosynthetic eucaryote；
(b10) it is used to prepare the product for maintaining the level of PsaA albumen in photosynthetic eucaryote.
3. the application of calcium balance regulatory factor, is at least one of following (c1) to (c6)：
(c1) with PYG7 protein bindings；
(c2) PYG7 albumen is detected；
(c3) purify or be enriched with PYG7 albumen；
(c4) product for combining PYG7 albumen is prepared；
(c5) product for detecting PYG7 albumen is prepared；
(c6) product for purifying or being enriched with PYG7 albumen is prepared.
4. the application of calcium balance regulatory factor and PYG7 albumen, is at least one of following (d1) to (d6)：
(d1) the common assembling for participating in photosystemⅰ complex；
(d2) the common formation for participating in photosystemⅰ complex；
(d3) stability of common maintenance photosystemⅰ complex；
(d4) it is used for the product for preparing the assembling for participating in photosystemⅰ complex；
(d5) it is used for the product for preparing the formation for participating in photosystemⅰ complex；
(d6) it is used for the product for preparing the stability for maintaining photosystemⅰ complex.
5. the application of calcium balance regulatory factor and PYG7 albumen, is at least one of following (e1) to (e10)：
(e1) assembling of photosystemⅰ complex in photosynthetic eucaryote is participated in jointly；
(e2) formation of photosystemⅰ complex in photosynthetic eucaryote is participated in jointly；
(e3) stability of photosystemⅰ complex in photosynthetic eucaryote is maintained jointly；
(e4) level of photosystemⅰ complex in photosynthetic eucaryote is maintained jointly；
(e5) level of PsaA albumen in photosynthetic eucaryote is maintained jointly；
(e6) it is used to prepare the product for participating in the assembling of photosystemⅰ complex in photosynthetic eucaryote；
(e7) it is used to prepare the product for participating in the formation of photosystemⅰ complex in photosynthetic eucaryote；
(e8) it is used to prepare the product for maintaining the stability of photosystemⅰ complex in photosynthetic eucaryote；
(e9) it is used to prepare the product for maintaining the level of photosystemⅰ complex in photosynthetic eucaryote；
(e10) it is used to prepare the product for maintaining the level of PsaA albumen in photosynthetic eucaryote.
6. a kind of prepare the impaired photosynthetic Eukaryotic method of photosystemⅰ complex, comprise the following steps：Knock out photosynthetic eucaryon
The gene of the coded Ca balance adjustment factor in biological genome, obtains the impaired photosynthetic eucaryote of photosystemⅰ complex.
7. a kind of prepare the impaired photosynthetic Eukaryotic method of photosystemⅰ complex, comprise the following steps：It is mutated photosynthetic eucaryon
The gene of the coded Ca balance adjustment factor in biological genome, obtains the impaired photosynthetic eucaryote of photosystemⅰ complex.
8. a kind of prepare the impaired photosynthetic Eukaryotic method of photosystemⅰ complex, comprise the following steps：Suppress photosynthetic eucaryon
The activity of calcium balance regulatory factor in biology, obtains the impaired photosynthetic eucaryote of photosystemⅰ complex.
9. a kind of polypeptide fragment, is made up of 54 amino acid residues of calcium balance regulatory factor C-terminal.
10. the application of polypeptide fragment described in claim 9, is following (f1) or (f2)：
(f1) combination of calcium balance regulatory factor and PYG7 albumen is participated in；
(f2) it is used for the product for preparing the combination for participating in calcium balance regulatory factor and PYG7 albumen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710337873.5A CN107188939B (en) | 2017-05-15 | 2017-05-15 | Use of PSA3 protein in participating PSI assembly and maintaining PSI stability |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710337873.5A CN107188939B (en) | 2017-05-15 | 2017-05-15 | Use of PSA3 protein in participating PSI assembly and maintaining PSI stability |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107188939A true CN107188939A (en) | 2017-09-22 |
| CN107188939B CN107188939B (en) | 2020-03-27 |
Family
ID=59872450
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710337873.5A Expired - Fee Related CN107188939B (en) | 2017-05-15 | 2017-05-15 | Use of PSA3 protein in participating PSI assembly and maintaining PSI stability |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107188939B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114836440A (en) * | 2022-06-06 | 2022-08-02 | 西南大学 | Rice leaf color regulation gene AF1 and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1499185A4 (en) * | 2002-04-04 | 2005-08-24 | Valent Biosciences Corp | Enhanced herbicide composition |
| CN102224165A (en) * | 2008-09-23 | 2011-10-19 | 巴斯夫植物科学有限公司 | Transgenic plants with increased yield |
-
2017
- 2017-05-15 CN CN201710337873.5A patent/CN107188939B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1499185A4 (en) * | 2002-04-04 | 2005-08-24 | Valent Biosciences Corp | Enhanced herbicide composition |
| CN102224165A (en) * | 2008-09-23 | 2011-10-19 | 巴斯夫植物科学有限公司 | Transgenic plants with increased yield |
Non-Patent Citations (2)
| Title |
|---|
| MARK HEINNICKELA等: "Tetratricopeptide repeat protein protects photosystem I from oxidative disruption during assembly", 《PNAS》 * |
| 秦晓春等: "光合作用及光合膜蛋白PSI-LHCI超分子复合物高分辨率晶体结构解析", 《科技导报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114836440A (en) * | 2022-06-06 | 2022-08-02 | 西南大学 | Rice leaf color regulation gene AF1 and application thereof |
| CN114836440B (en) * | 2022-06-06 | 2023-04-07 | 西南大学 | Rice leaf color regulation gene AF1 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107188939B (en) | 2020-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lan et al. | OsSPL10, a SBP-box gene, plays a dual role in salt tolerance and trichome formation in rice (Oryza sativa L.) | |
| Sosso et al. | PPR2263, a DYW-subgroup pentatricopeptide repeat protein, is required for mitochondrial nad5 and cob transcript editing, mitochondrion biogenesis, and maize growth | |
| Wang et al. | A subsidiary cell-localized glucose transporter promotes stomatal conductance and photosynthesis | |
| Zheng et al. | Conserved and novel roles of miR164‐CUC 2 regulatory module in specifying leaf and floral organ morphology in strawberry | |
| Chen et al. | A knockdown mutation of YELLOW-GREEN LEAF2 blocks chlorophyll biosynthesis in rice | |
| US9663794B2 (en) | Heat-resistance rice gene OsZFP, screening marker and separation method thereof | |
| US10119148B2 (en) | RNAs from pathogens inhibit plant immunity | |
| WO2010035618A1 (en) | Method for production of plant imparted with stress tolerance and use thereof | |
| US11198880B2 (en) | Methods for producing microcompartments | |
| Liu et al. | A natural variation in pleiotropic developmental defects uncovers a crucial role for chloroplast tRNA modification in translation and plant development | |
| CN108864266A (en) | One kind Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and application | |
| CN101265293A (en) | Flowering time correlated albumen from arabidopsis, and coding gene and application thereof | |
| CN101798342B (en) | Rice glume development related protein TRI1 and encoding gene and application thereof | |
| CN101565461B (en) | Zinc finger protein related to plant type and spike grain number of rice, encoding gene and application thereof | |
| CN108795950B (en) | Strawberry anthocyanin related gene FvMYB17 and application thereof | |
| Yu et al. | OsSIG2A is required for chloroplast development in rice (Oryza sativa L.) at low temperature by regulating plastid genes expression | |
| FR2878532A1 (en) | METHOD OF ADDRESSING NUCLEIC ACIDS TO PLASTS | |
| CN107188939A (en) | Application of the PSA3 albumen in participating in PSI assembling and maintaining PSI stable | |
| CN110590924A (en) | Application of rice gene OsSLC1 encoded PPR protein | |
| CN102477092A (en) | Protein used for controlling anthocyanidin content, coding gene thereof, and application thereof | |
| US9534229B2 (en) | Plant homolog to autophagy protein P62 | |
| CN116253781A (en) | Rice OsDNE1 protein and application of encoding gene thereof in regulating plant growth and development | |
| CN114456242A (en) | PRP protein and coding gene and application thereof | |
| CN107176983B (en) | Application of protein PpLEA3-3 in regulation and control of plant stress resistance | |
| CN109609515B (en) | Gene for regulating growth and development of chloroplast and influencing leaf color under low-temperature stressCDE4And applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200327 |