CN107177594A - Specificity suppresses siRNA and its recombinant vector and the application of CA7 gene expressions - Google Patents
Specificity suppresses siRNA and its recombinant vector and the application of CA7 gene expressions Download PDFInfo
- Publication number
- CN107177594A CN107177594A CN201710422844.9A CN201710422844A CN107177594A CN 107177594 A CN107177594 A CN 107177594A CN 201710422844 A CN201710422844 A CN 201710422844A CN 107177594 A CN107177594 A CN 107177594A
- Authority
- CN
- China
- Prior art keywords
- sirna
- cell
- taxol
- recombinant vector
- plko
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Abstract
The invention discloses siRNA and its recombinant vector and the application that a species specificity suppresses CA7 gene expressions, belong to molecular biology and biomedicine technical field.The siRNA, including positive-sense strand and antisense strand, positive-sense strand：5’‑UGAUUGGCGAUCUCCCUGGGC‑3’；Antisense strand：5’‑CCAGGGAGAUCGCCAAUCACC‑3’.The siRNA that the present invention is provided can specificity, efficiently suppress the mRNA and protein expression of CA7 genes, reduce cell propagation, increase Apoptosis, reduction cell migration and invasive ability, and can effectively reverse ovarian cancer cell to the resistance of taxol.Present invention also offers the application of the CA7 siRNA and its recombinant vector in the medicine for preparing treatment oophoroma, glioma, colorectal cancer or reverse ovarian cancer drug-resistant.
Description
Technical field
The present invention relates to molecular biology and biomedicine technical field, a specially species specificity suppresses CA7 gene tables
The siRNA and its recombinant vector that reach and application.
Background technology
RNA disturbs (RNA interference, RNAi), is called gene silencing, is the sequence being widely present in animals and plants
Gene silencing mechanism after specific transcriptional.Tuschl in 2001 work together with him and find the mammalian cell transfection people of in vitro culture
The 21-23nt of work synthesis Double-stranded siRNA molecules can simulate RNAi effects, further study show that being shorter than 21bp or being longer than
25bp double-stranded RNA (dsRNA) is unable to effectively start RNAi, as long as and its intermediate sequence has the mispairing of a base, base
Because of the effect just substantially decline even disappearance of silence, the specificity of its effect has been fully demonstrated.
Just because of RNAi effects are with very high specificity and high efficiency, for gene functional study provide it is strong
Research tool, the method by the use of small molecules interference RNA (siRNA) as gene silencing is widely used in grinding for malignant tumour mechanism
Study carefully, the research and development process of the efficient therapeutic strategy of tomour specific based on the technology has been promoted energetically.
Oophoroma is the second largest common cancer of women, is the lethal main cause of female malignant, early stage very
Rare Symptoms, more than 60% women has been III phases or IV phases when clarifying a diagnosis, and has occurred transfer extensively, prognosis is very
Difference.The treatment means of standard subtract art of going out for ovarian tumor cell and add follow-up chemotherapy, but Most patients still can be resistance to because of chemotherapy
Medicine, tumor recurrence are finally dead, and five year survival rate is extremely low (30% or so).How to improve the therapeutic effect of oophoroma, find ovum
The solution of nest cancer chemotherapy resistance, is the most severe challenge that gynecological tumor scholar faces.
Molecular targeted agents and chemotherapy combined application are the current raising most promising treatments of malignant tumor patient survival rate
Method.CA7 (carbonic anhydrase 7) gene is one of carbonic anhydrase family member, chromosome mapping in 16q22.1,
One kind of metalloenzyme, can carbon dioxide it is reversible be converted into sodium acid carbonate and proton, take part in multiple physiology and pathology
Molecular mechanism, such as：Gluconeogenesis, Fatty synthesis, urea generation and the generation of tumour.Our results of study in advance show that CA7 exists
It is high expression in oophoroma.But whether the gene is relevant with ovarian tumors to need further research.
Therefore, carry out specific expression to CA7 genes using RNAi technology to disturb, the research to ovarian tumors mechanism
It is an important supplement, is important exploration and application to oophoroma targeted therapy and its resistance treatment.
The content of the invention
It is an object of the invention to provide the siRNA that a species specificity suppresses CA7 gene expressions, for ovarian tumors machine
System research.The oophoroma for the treatment of oophoroma and taxol resistance is being prepared it is another object of the present invention to provide the siRNA
Application in medicine.
To achieve the above object, the present invention is adopted the following technical scheme that：
Present invention design, 3 pairs of specificity of synthesis suppress the siRNA of CA7 gene expressions, and Ovarian Cancer Cells are transfected into respectively
In A2780 and its taxol resistance strain A2780/taxol, as a result find that the interference effect of S1 suppression CA7 gene expressions is most obvious.
The invention provides the siRNA (S1) that a species specificity suppresses CA7 gene expressions, including positive-sense strand and antisense strand,
The positive-sense strand：5’-UGAUUGGCGAUCUCCCUGGGC-3’(SEQ ID NO.1)；
The antisense strand：5’-CCAGGGAGAUCGCCAAUCACC-3’(SEQ ID NO.2).
Preferably, 3 bases at the positive-sense strand and the 5 ' of antisense strand and 3 ' ends carry out the modification of 2 '-methoxyl group.This hair
Bright research has shown that siRNA (S1) stability increase after the modification of 2 '-methoxyl group improves its hydrolysis for resisting ribozyme in vivo
Ability, reduction immunostimulation reaction, extension siRNA disturbs the action time of down regulation of gene expression, has its effect efficient
Property, specificity.
The invention provides a kind of rnai reagent box for including the DNA sequence dna for encoding the siRNA.The kit
In comprising having cloned the DNA plasmid carrier of the siRNA, using when, the plasmid vector is in eukaryotic needed for transcriptional expression
SiRNA, so as to reach the expression of silence CA7 genes.
The invention provides a kind of recombinant vector containing the DNA sequence dna for encoding the siRNA.Preferably, use
Initial carrier is slow virus carrier pLKO.1puro.
Present invention also offers the construction method of recombinant vector, including：
(1) CA7-S1 fragments are synthesized, Age I and EcoR two restriction enzyme sites of I is selected, according to S1 sequence, designs it
ShRNA sequences, sequence is as follows：
Positive-sense strand：
5’-CCGGGGTGATTGGCGATCTCCCTGGGCTTCAAGAGAGCCCAGGGAGATCGCCAATCACCTTTTTTG
GTACC-3’(SEQ ID NO.7)；
Antisense strand：
5’-AATTGGTACCAAAAAAGGTGATTGGCGATCTCCCTGGGCTCTCTTGAAGCCCAGGGAGATCGCCAA
TCACC-3’(SEQ ID NO.8)；
(2) annealing obtains CA7-S1 DNA fragmentation；
(3) pLKO.1-CA7-S1 recombinant vectors are built with slow virus carrier pLKO.1puro.
The siRNA that the present invention is provided being capable of the efficiently specific expression for suppressing ovarian cancer cell CA7 genes, reduction cell increasing
Grow, increase Apoptosis, reduction cell migration and invasive ability, therefore, the siRNA and recombinant vector are used as CA7 gene tables
Among the research that tumor disease pathogenesis is can apply to up to inhibitor.
The invention provides the application of the siRNA and recombinant vector in CA7 gene expression inhibitors are prepared.
Treatment oophoroma, glioma or colorectal cancer are being prepared the invention provides the siRNA and recombinant vector
Application in medicine.
Present invention research shows that taxol resistance strain A2780/taxol is transfected after the siRNA, and the cell line is to Japanese yew
The sensitiveness of alcohol is significantly improved, and it is 15.17 to reverse index, illustrates the siRNA of the invention provided to taxol resistance strain A2780/
Clearly, therefore, the siRNA is latent to reversing the treatment of oophoroma taxol resistance to have for the reversing effect of taxol resistances
In application value.
The invention provides described siRNA and recombinant vector in the medicine for reversing oophoroma taxol resistance is prepared
Using.
The beneficial effect that the present invention possesses：
The siRNA that the present invention is provided can specific, efficiently suppress the mRNA and protein expression of CA7 genes, reduce thin
Born of the same parents breed, and increase Apoptosis, reduction cell migration and invasive ability, and can effectively reverse ovarian cancer cell to the resistance to of taxol
Medicine.It is applied to Tumorigenesis research and prepares oncotherapy and reverse in the medicine that ovarian cancer drug-resistant is treated, tool
It is significant.
Brief description of the drawings
Fig. 1 is that qRT-PCR detects that A2780 cells CA7mRNA is expressed after S1, S2, S3 transfections 48h.
Fig. 2 is that qRT-PCR detects that A2780/Taxol cells CA7mRNA is expressed after S1, S2, S3 transfections 48h.
Fig. 3 is that Western Blotting detect A2780 cell CA7 protein expressions after S1, S2, S3 transfections 72h.
Fig. 4 is that Western Blotting detect A2780/Taxol cell CA7 protein expressions after S1, S2, S3 transfections 72h.
Fig. 5 is pLKO.1-CA7-S1 recombinant plasmids and insertion restriction enzyme site schematic diagram.
Fig. 6 is small hair fastener shRNA schematic diagrames.U6 promoters instruct the small hair fastener shRNA in downstream transcription；Including 23 S1 just
Adopted chain base, 23 S1 antisense strand bases.
Fig. 7 is A2780 cell CA7 protein expressions after Western Blotting detection pLKO.1-CA7-S1 transfections.
Fig. 8 is A2780/Taxol cell CA7 albumen tables after Western Blotting detection pLKO.1-CA7-S1 transfections
Reach.
Fig. 9 is A2780 and A2780/Taxol cell quantities and shape after phase contrast microscope observation transfection pLKO.1-CA7-S1
State changes.
Figure 10 is A2780 and A2780/Taxol cells propagation after bromine mark method detection transfection pLKO.1-CA7-S1.
Figure 11 is A2780 and A2780/Taxol Apoptosis after Caspase3 Activity determinations transfection pLKO.1-CA7-S1.
Figure 12 is A2780 cell migration abilities after cell scratch experiment detection transfection pLKO.1-CA7-S1.
Figure 13 is A2780/Taxol cell migration abilities after cell scratch experiment detection transfection pLKO.1-CA7-S1.
Figure 14 is A2780 and A2780/Taxol cell migration abilities after Transwell detection transfections pLKO.1-CA7-S1.
Figure 15 is A2780 and A2780/Taxol cell invasion abilities after Transwell detection transfections pLKO.1-CA7-S1.
Embodiment
With reference to embodiment, the invention will be further described.The method purpose used in following embodiment is more preferable
Ground understands the present invention, but is not limited to the present invention.Unless otherwise specified, the experimental method being related in embodiment is conventional side
Method, experiment material used is the purchase of conventional reagent company.
Using the statistical analysis softwares of SPSS 16.0, each sample data is with mean ± standard deviationRepresent, between two groups
Difference examined with T (Independent-Sample T Test), it is multigroup between inspection one-way analysis of variance (One-
Way ANOVA), P ＜ 0.05 have significant difference.
Ovarian Cancer Cells A2780 and oophoroma taxol resistance cell line A2780/Taxol are by Zhejiang Province's female reproduction
Health research key lab cell bank is preserved；
The anti-human GAPDH primary antibodies (Cat.60004-1-Ig) of rabbit-anti people CA7 primary antibodies (Cat.13670-1-AP), mouse, horseradish mistake
Oxide enzyme mark goat anti-mouse IgG (H+L) secondary antibody (Cat.SA00001-1), horseradish peroxidase-labeled goat antirabbit
IgG (H+L) secondary antibody (Cat.SA00001-2) is purchased from Proteintech companies；
Western Blotting Luminol Reagent detection kits (Cat.sc-2048) are purchased from Santa Cruz
Company；
CDNA Reverse Transcriptase kits PrimeScriptTMRT Master Mix (Cat.RR036A), quantitative fluorescent PCR inspection
Test agent box SYBR Premix Ex Taq (perfect Real time, Cat.DRR041A) are purchased from TaKaRa companies；
Lipofectamine3000 transfection reagents box (Cat.L3000008) is purchased from Invitrogen companies；
The conventional RNAi carrier pLKO.1puro of carrier for expression of eukaryon selection, comes from global scientist's plasmid and shares non-profit group
Knit Addgene；
Restriction enzyme A ge I (Cat.R0552S), EcoR I (Cat.R0101S), Kpn I (Cat.R0142S) purchases
From NEB companies；T4 ligases (Cat.2011A), DNA fragmentation purification kit (Cat.9761), DNA gel QIAquick Gel Extraction Kit
(Cat.9762), DNA small scale purification kit (Cat.9760) is purchased from TaKaRa companies；
SiRNA is synthesized by TaKaRa companies；PCR primer and clone are synthesized with DNA by Shanghai Sheng Gong bio-engineering corporations；
Pre-dyed albumen Marker (Cat.26616) is purchased from Fermentas companies；
Bromine mark method cell proliferation detecting kit Cell Proliferation ELISA, BrdU (colorimetric,
Cat.11647229001 Roche companies) are purchased from；
CaspACE Assay System (colorimetric, Cat.G7351) are purchased from Promega companies；
Cell migration, invasive model Transwell Permeable Supports (Cat.3428) are public purchased from Corning
Department；
Lab-Tek II Chamber Slide System-Lab-Tek chamber slides system is purchased from Nunc companies
(Cat.154526)；
BD MatrigelTMBasement Membrane Matirx matrix membranes (Cat.356234) are purchased from BD companies；
SiRNA negative control AllStars Negative Control SiRNA (Cat.1027281) are public purchased from QIAGEN
Department；
PAGE gel configuration kit (Cat.CW0022M) is ShiJi Co., Ltd purchased from health；
0.45um pvdf membranes (Cat.IPVH00010) are purchased from Millipore companies；
Taxol (Cat.P106868) is purchased from Aladdin companies.
Embodiment 1.CA7 siRNA design synthesis
CA7 gene mRNA sequences (NM_005182.2) are discovered and seized in Genebank, with siDirect Ver2.0 softwares
(http://sidirect2.rnai.jp/) 3 couples of siRNA sequence (such as SEQ ID NO.1-SEQ ID of Photographing On-line acquisition
NO.6 shown in).In design process selection simultaneously meet document report three kinds of algorithms (Ui-Tei × Reynolds ×
Amarzguioui sequence), and siRNA action specificity highest 23nt long fragments are selected, the design can avoid body in future
100nt after interferon-like immune response, selection initiation codon occurs during interior experiment, 5 ' and 3 ' end UTR areas, G/C content control are avoided
System is in 30-70%.Select the siRNA of 3 pairs of 23nt length as experiment screening interference fragment altogether, architectural feature shows as positive-sense strand
Respectively have that two bases are plug-in with the end of antisense strand 3 ', design feature is as follows
Then use BLASTN(https://blast.ncbi.nlm.nih.gov/Blast.cgi)It is online to carry out homology
Search, excludes the sequence for having homology, influence of the non-specific fragment to siRNA specific effect effects is avoided as far as possible.
Finally positive-sense strand and the 5 ' of antisense strand and 3 ' continuous 3 purine (pyrimidine) bases in end are carried out in chemical synthesis
2 '-OMe (2 '-methoxyl group) are modified, the chemical stability of increase siRNA molecule in the cell, extension siRNA interference gene expressions
The time of downward and effect.Final sequence and modification such as table 1 and formula (I) are as follows：
Table 1
2. 3 couples of CA7siRNA of embodiment are in Ovarian Cancer Cells A2780 and its taxol resistance strain A2780/taxol
Detection and screening to CA7 gene interference effects
First, experiment packet：
1.A2780 normal groups (do not transfect siRNA).Hereinafter referred to as A；
2.A2780 negative control groups (transfection negative control siRNA), hereinafter referred to as A-N；
3.A2780 experimental groups (transfection S1), hereinafter referred to as A-S1；
4.A2780 experimental groups (transfection S2), hereinafter referred to as A-S2；
5.A2780 experimental groups (transfection S3), hereinafter referred to as A-S3；
6.A2780/Taxol normal groups (do not transfect siRNA), hereinafter referred to as AR；
7.A2780/Taxol negative control groups (transfection negative control siRNA), hereinafter referred to as AR-N；
8.A2780/Taxol experimental groups (transfection S1), hereinafter referred to as AR-S1；
9.A2780/Taxol experimental groups (transfection S2), hereinafter referred to as AR-S2；
10.A2780/Taxol experimental groups (transfection S3), hereinafter referred to as AR-S3.
2nd, packet transfection
To ensure transfection efficiency, cytotoxicity is reduced, we are carried out using Lipofectamine3000 transfection reagents
SiRNA is transfected.The day before transfection, trypsin digestion cell is simultaneously counted, and plating cells make it in transfection day density in six orifice plates
0.5×106/ ml, cell fusion to 70-90%.Per hole 5ul is diluted with 125 μ l serum-free OPTI-MEM culture mediums
The reagents of Lipofectamine 3000 are simultaneously fully mixed；SiRNA premixed liquids are prepared, with 125 μ l serum-free OPTI-MEM culture mediums
Dilution siRNA is mixed to final concentration of 50nM, and fully；Added in the reagents of Lipofectamine 3000 diluted
SiRNA premixed liquids (1:1), it is incubated at room temperature 5min；Finally siRNA- liposome complexes are added in cell, 37 DEG C, 5%
CO2It is middle to continue to cultivate.CA7 protein expressions are detected after CA7mRNA expression, 72h are detected after 48h.
3rd, real-time fluorescence quantitative RT-PCR (qRT-PCR) detection CA7 gene mRNA expressions
The culture medium abandoned in 6 orifice plates is inhaled after culture 48h, Trizol extracted total RNAs, Thermo are used after being washed twice with PBS
Nano Drop2000 spectrophotometric determination RNA concentration, and by SYBR Premix Ex Taq (perfect Real time)
Kit specification is operated.First step RNA is denatured.Reaction system：RNA0.5ug, goes RNase DEPC water to complement to 6.8ul；Instead
Answer condition：It is placed on ice after 70 DEG C of incubation 10min.Second step reverse transcription.Reaction system：According to PrimeScript RT
Master Mix kit specifications carry out reverse transcription；Reaction condition：After 42 DEG C of incubations 60min, 85 DEG C of inactivation 5min, -20 DEG C
Preserve.
1ul reverse transcription products are taken to carry out quantitative fluorescent PCR reaction.PCR primer sequence：
5’-GGAGCCCATCTGCATCTCTG-3’；
5 '-CAAACTGGCTGAAGGAGGGT-3 ', product length：275bp；
Reaction condition：95 DEG C of 10s, 95 DEG C of 5s, 6 DEG C of 30s, totally 40 circulations.
The expression quantity of CA7mRNA in each group sample is calculated using 2- △ CT methods.
As a result：As shown in figure 1, A2780 cells are transfected after S1, S2, S3 respectively, CA7mRNA expression is decreased obviously,
Wherein A-S1 interference effects preferably, are compared, CA7mRNA has lowered 88% (P ＜ 0.05) with negative control group.Equally such as Fig. 2 institutes
Show, in A2780/Taxol cells, AR-S1 interference effects preferably, are compared, CA7 mRNA are lowered with negative control group
84.9% (P ＜ 0.05).As a result show, in A2780 and taxol resistance strain A2780/Taxol, S1 is expressed CA7 mRNA
There is best interference effect.
4th, Western Blotting detect CA7 protein expressions
The culture medium abandoned in 6 orifice plates is inhaled after culture 72h, PBS is washed 3 times, adds RIPA protein lysates (100ul/ holes),
Piping and druming for several times, is incubated 5min on ice, is allowed to fully cracking, 4 DEG C, 12000 leave the heart 5 minutes, collects supernatant, dispenses -20 DEG C of storages
Deposit；10ul loadings, 8%SDS-PAGE electrophoresis, 200V, 10min are taken after each 95 DEG C of denaturation 5min of sample；100V, 100min；Turn
To pvdf membrane：110V, 120min；60min is closed with the TBS confining liquids containing 5% skimmed milk power；Primary antibody is incubated：CA7 primary antibodies (1：
2000), GAPDH primary antibodies (1：5000) 2h is incubated at room temperature；TBS washes film 10min × 3 time；Secondary antibody is incubated：Horseradish peroxidase
Mark goat anti-mouse IgG (H+L) secondary antibody (1：10000), horseradish peroxidase-labeled goat anti-rabbit igg (H+L) secondary antibody (1：
10000) it is incubated 1h；TBST washes film 10min × 3 time, and TBS washes film 10min × 1 time；After ECL developments, Image Quant are used
LAS4000mini (GE Healthcare) is to scanning of image processing.
As a result：As shown in Figure 3, Figure 4, compared with negative control, after S1 transfections, A2780 cells and A2780/Taxol cells
Middle CA7 protein expressions are remarkably decreased (P ﹤ 0.05), and there were significant differences (P ﹤ 0.05) compared with S2 and S3.As a result show,
In A2780 and taxol resistance strain A2780/Taxol, S1 has best interference effect to CA7 protein expression.Therefore through sieving
Choosing, S1 is selected as the siRNA of follow-up study.
The eukaryotic vector pLKO.1-CA7-S1 of embodiment 3. structure and the interference effect detection to CA7 gene expressions
First, experiment packet：
1.A2780 normal groups (do not transfect any carrier), hereinafter referred to as A；
2.A2780 negative control groups (transfection pLKO.1puro empty carriers), hereinafter referred to as A-N；
3.A2780 experimental groups 1 (transfection pLKO.1-CA7-S1), hereinafter referred to as A-S1；
4.A2780/Taxol normal groups (do not transfect any carrier), hereinafter referred to as AR；
5.A2780/Taxol negative control groups (transfection pLKO.1puro empty carriers), hereinafter referred to as AR-N；
6.A2780/Taxol experimental groups 1 (transfection pLKO.1-CA7-S1), hereinafter referred to as AR-S1；
2nd, CA7-S1 fragments are synthesized
Age I and EcoR two restriction enzyme sites of I are selected, according to S1 sequence, its shRNA sequence is designed and is building up to true
In nuclear expression carrier pLKO.1puro.Sequence is as follows：
Positive-sense strand：
5’-CCGGGGTGATTGGCGATCTCCCTGGGCTTCAAGAGAGCCCAGGGAGATCGCCAATCACCTTTTTTG
GTACC-3’(SEQ ID NO.7)；
Antisense strand：
5’-AATTGGTACCAAAAAAGGTGATTGGCGATCTCCCTGGGCTCTCTTGAAGCCCAGGGAGATCGCCAA
TCACC-3’(SEQ ID NO.8)；
3rd, eukaryotic vector pLKO.1-CA7-S1 structure
PLKO.1-CA7-S1 recombinant expression carriers (Fig. 5 and 6), specific side are built with carrier for expression of eukaryon pLKO.1puro
Method is referring to U.S.'s Cold Spring Harbor Publications《Molecular Cloning:A Laboratory guide》.
By CA7-S1 positive-sense strands and the annealed program of antisense strand (95 DEG C of denaturation 2min；Slow cooling is annealed to 25 DEG C), 4 DEG C
Preserve.Age I and EcoR I complete degestion carriers pLKO.1puro, 37 DEG C overnight；Digestion products DNA gel QIAquick Gel Extraction Kit
Reclaim DNA.Annealed product reclaims fragment with carrier digestion and is attached reaction, reaction system (10ul)：T4 ligases 1ul, T4
Ligase buffer solution 1ul, annealed product reclaims fragment mixture (mol ratio 3 with carrier digestion:1)；Deionized water is mended to 10ul,
16 DEG C of connections are stayed overnight；5ul connection products are taken to be placed in 100ul JM109 competence bacteriums, ice bath 30min, 42 DEG C of heat shocks
90s, ice bath 5min, plus LB culture mediums 1000ul, 37 DEG C of shaking table culture 30min, 5000rpm centrifugation 5min, abandon supernatant, by bacterium
It is spread evenly across on LB flat boards (ampicillin containing 50ug/ml), 37 DEG C of inversion overnight incubations；Select some independent clones inoculations
In the LB culture mediums containing corresponding resistant, bacterium is expanded in 37 DEG C of concussions overnight；Bacterium is collected, is obtained with the extracting of plasmid DNA purification kit
DNA is obtained, Kpn I digestions identification obtains pLKO.1-CA7-S1 recombinant plasmids.
4th, interference effect is observed after pLKO.1-CA7-S1 recombinant plasmid transfected cells
PLKO.1-CA7-S1 is transfected into A2780 the and A2780/Taxol cells of exponential phase.Transfect reference
Lipofectamine3000 operational manuals, 5ul is diluted per hole with 125 μ l serum-free OPTI-MEM culture mediums
The reagents of Lipofectamine 3000 are simultaneously fully mixed；5ug recombinant plasmids are added in 125 μ l serum-free OPTI-MEM culture mediums
DNA, adds P3000 reagent 10ul, fully mixes, Prepare restructuring plasmid premixed liquid；In the Lipofectamine diluted
Recombinant plasmid premixed liquid (1 is added in 3000 reagents:1), it is incubated at room temperature 5mim；Finally by recombinant plasmid-liposome complex
250ul is added in cell, 37 DEG C, 5% CO2It is middle to continue to cultivate.CA7 protein expressions are detected after 72h.
As shown in Figure 7 and Figure 8, after transfection pLKO.1-CA7-S1 recombinant plasmids, with negative control (transfection empty plasmid) phase
Than CA7 protein expressions are remarkably decreased (P ﹤ 0.05) in A2780 cells and A2780/Taxol cells, as a result show, in A2780
In taxol resistance strain A2780/Taxol, transfection pLKO.1-CA7-S1 recombinant plasmids can effectively disturb CA7 protein expression.
After embodiment 4.pLKO.1-CA7-S1 specific inhibitions CA7 expression to tumor cell proliferation, apoptosis, migrate and invade
The influence attacked
First, experiment packet：
1.A2780 normal groups (do not transfect any carrier), hereinafter referred to as A；
2.A2780 negative control groups (transfection pLKO.1puro empty carriers), hereinafter referred to as A-N；
3.A2780 experimental groups (transfection pLKO.1-CA7-S1), hereinafter referred to as A-S1；
4.A2780/Taxol normal groups (do not transfect any carrier), hereinafter referred to as AR；
5.A2780/Taxol negative control groups (transfection pLKO.1puro empty carriers), hereinafter referred to as AR-N；
6.A2780/Taxol experimental groups (transfection pLKO.1-CA7-S1), hereinafter referred to as AR-S1.
2nd, packet transfection
Transfection procedure is the same, continues to cultivate cell after transfection, propagation, apoptosis, migration and invasion and attack for detecting cell.
3rd, cell proliferation test
Cell is transfected in 96 orifice plates to be continued to cultivate 72h after pLKO.1-CA7-S1, and 10ulBrdU marking fluids are added extremely per hole
BrdU final concentration of 10uM, 37 DEG C of incubation 2h；BrdU marking fluids are absorbed, 200ul FixDenat, 20 DEG C of incubations are added per hole
30min；FixDenat is absorbed, 100ul anti-BrdU-POD, 20 DEG C of incubation 90min are added per hole；Per hole 200ul
Washing Solution are washed 3 times；Add 100ul/ holes substrate solution, 20 DEG C of incubation 20min, Detection wavelength 370nm (references
Wavelength 492nm) survey absorbance (A), the ability A of cell propagationExperimental group/AControl groupRepresent.
As a result as shown in Figure 9 and Figure 10, in A2780 and A2780/Taxol cells, after transfection pLKO.1-CA7-S1, phase
The micro- Microscopic observation of difference is visible, and experimental group cell quantity is significantly reduced, suspension cell quantity increase, it is seen that more cell fragment；
Bromine mark method test cell proliferation results are displayed that：Compared with negative control, A2780 and A2780/Taxol experimental groups cell propagation
Ability have dropped 65.80% and 60.98% respectively, there is significant difference (P ＜ 0.05).Illustrate specific inhibition CA7 expression
Afterwards, tumor cell proliferation can be suppressed.
4th, Caspase3 Activity determinations Apoptosis
Cell is collected after transfection 72h, lysate adjustment cell density is 1 × 108/ ml, cracks 15min, 15000g on ice
× 20min, collects supernatant.Prepared simultaneously according to CaspACE Assay System (colorimetric) specifications positive and cloudy
Property control sample, is determined and to adjust each group protein concentration identical.Caspace Assay are added in 96 orifice plates per hole
Buffer32ul, DMSO2ul, 100nM DTT 10ul, deionized water adjustment volume is 98ul, adds 2ul DEVD-pNA bottoms
Thing, 37 DEG C of incubations 4h, Detection wavelength 405nM survey absorbance, and every group of sample Caspase3 activity is calculated with Δ A methods.
As a result as shown in figure 11, after A2780 and A2780/Taxol cell transfectings pLKO.1-CA7-S1, Caspase3 activity
3.14 times and 3.58 times are added respectively, are compared with negative control, have significant difference (P ＜ 0.05) to illustrate specific inhibition
After CA7 expression, apoptosis of tumor cells can be promoted.
5th, cell scratch test detection cell migration ability
Horizontal line is uniformly drawn with ruler behind in six orifice plates, the standardized roads of about 0.5cm cross via, per at least 6, hole horizontal stroke
Line.After cell transfecting pLKO.1-CA7-S1, when continuing to cultivate 24h cell fusions into individual layer state, in selection area 200ul
Pipette tips in six orifice plates vertical cut, PBS, which washes 3 times and removed, draws lower cells, adds serum free medium and continues culture.0h,
24h, 48h time point take pictures, and randomly select 6 horizontal lines, calculate iuntercellular apart from average.
As a result as shown in Figure 12 and Figure 13, after pLKO.1-CA7-S1 transfectional cells 24h and 48h, A2780 and A2780/
Healing ability is remarkably decreased after Taxol iuntercellulars distance noticeably greater than negative control group, cell cut, illustrates specific inhibition
After CA7 expression, the migration of tumour cell can be suppressed.
6th, Transwell testing inspections cell migration ability
After cell transfecting 48h, with collected by trypsinisation, it is resuspended with serum free medium, adjustment cell density is 5 × 105/
Ml, upper chamber adds 2ml cell suspensions, and lower room adds 10%FBS complete medium 2ml, continues to cultivate 24h, takes out cell, PBS washes 3
It is secondary, the cell of upper chamber upper surface is carefully removed with cotton swab, inversion is dried, 95% ethanol fixes 25min, haematoxylin dyeing shows
Micro- Microscopic observation, count, take pictures.Each cell counts 10 visuals field, averages and counts and analyze changing for cell migration ability
Become.
Cell migration assay result as shown in figure 14, is transfected after pLKO.1-CA7-S1, A2780 experimental groups and negative control
The cell quantity that group penetrates cell is 76 ± 8 and 257 ± 19 respectively, and both have significant difference (P ＜ 0.05)；A2780/
The cell quantity that Taxol experimental groups penetrate cell with negative control group is 57 ± 11 and 288 ± 24 respectively, and both have statistics poor
Different (P ＜ 0.05)；The result shows, after specific inhibition CA7 expression, can suppress the migration of tumour cell.
7th, Transwell testing inspections cell invasion ability
By the matrigel of -20 DEG C of preservations first in 4 DEG C of rewarming liquefaction, take matrigel with OPTI-MEM with 1:6 mix on ice it is dilute
Release, be coated with the upper chamber face of cell bottom film, 37 DEG C of solidification 30min absorb the liquid of small indoor precipitation.Matrigel coating after remaining
Ibid, each cell counts 10 visuals field to step, averages and counts and analyze the change of cell invasion ability.
As shown in figure 15, A2780 experimental groups penetrate the cell quantity of cell with negative control group to cell invasion experimental result
It is 46 ± 9 and 153 ± 15 respectively, both have significant difference (P ＜ 0.05)；A2780/Taxol experimental groups and negative control group
The cell quantity for penetrating cell is 41 ± 7 and 187 ± 23 respectively, and both have significant difference (P ＜ 0.05)；The result shows,
After specific inhibition CA7 expression, tumor cell invasion can be suppressed.
To the reverse effect of ovarian cancer drug-resistant after embodiment 5.pLKO.1-CA7-S1 specific inhibitions CA7 expression
First, experiment packet：
1.A2780 normal groups (do not transfect any carrier)；
2.A2780/Taxol normal groups (do not transfect any carrier)；
3.A2780/Taxol negative control groups (transfection pLKO.1puro empty carriers)；
4.A2780/Taxol experimental group (transfection pLKO.1-CA7-S1).
2nd, packet transfection
Transfection procedure is the same, continues to cultivate cell 24h after transfection.
3rd, detection of the cell to paclitaxel-sensitive after transfection pLKO.1-CA7-S1
Each group is taken the logarithm growth period cell, and cell is resuspended after pancreatin digestion, cell count and the density for adjusting cell suspension
For 1 × 105/ ml, is inoculated into 96 orifice plates and continues to cultivate 24h.Taxol is added in next day, each group, concentration gradient is set respectively
200ug/ml, 100ug/ml, 50ug/ml, 25ug/ml, 12.5ug/ml, 6.25ug/ml, 3.125ug/ml, 0ug/ml, effect
After 24h, absorbance (A) is surveyed in wavelength 370nm (reference wavelength 492nm) with bromine mark method, suppression of the taxol to every group of cell is calculated
Rate processed, inhibiting rate=AExperimental group/ANegative control group.Each concentration sets 3 multiple holes, averages.
Drug concentration when inhibiting rate is 50% is half-inhibition concentration (IC50)；
Persister A2780/Taxol IC50With its parental cell strain A2780 IC50Ratio be resistance multiple
(Resistant Folder,RF)；
Persister A2780/Taxol IC50The IC after pLKO.1-CA7-S1 (reversal agent) is transfected with it50Ratio to be resistance to
Medicine reverses index (Reversal Index, RI).
As a result as shown in table 2 and table 3, ICs of the A2780/Taxol to taxol50(44.23 ± 4.31ug/ml) is significantly higher than
ICs of the parent A2780 to taxol50(1.403 ± 0.31ug/ml), resistance multiple is up to 31.53, points out A2780/Taxol pairs
The sensitiveness of taxol is substantially less than parental cell A2780, height resistance.And when A2780/Taxol transfects pLKO.1-CA7-S1
Afterwards, the sensitiveness to taxol is significantly improved (2.78 ± 0.59ug/ml), and pLKO.1-CA7-S1 is to A2780/Taxol Japanese yews
Clearly, it is 15.17 to reverse index to the reversing effect of alcohol resistance.
Drug susceptibilities of the table 2.A2780 and A2780/Taxol to taxol
Reverses of the A2780/Taxol to taxol drug sensitiveness after the transfection of table 3. pLKO.1-CA7-S1
SEQUENCE LISTING
<110>Zhejiang University
<120>Specificity suppresses siRNA and its recombinant vector and the application of CA7 gene expressions
<130>
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> RNA
<213>Artificial sequence
<400> 1
ugauuggcga ucucccuggg c 21
<210> 2
<211> 21
<212> RNA
<213>Artificial sequence
<400> 2
ccagggagau cgccaaucac c 21
<210> 3
<211> 21
<212> RNA
<213>Artificial sequence
<400> 3
ucauaggaaa gcuccagugg u 21
<210> 4
<211> 21
<212> RNA
<213>Artificial sequence
<400> 4
cacuggagcu uuccuaugag g 21
<210> 5
<211> 21
<212> RNA
<213>Artificial sequence
<400> 5
uugaagucua ccuggacaga g 21
<210> 6
<211> 21
<212> RNA
<213>Artificial sequence
<400> 6
cuguccaggu agacuucaau g 21
<210> 7
<211> 71
<212> DNA
<213>Artificial sequence
<400> 7
ccggggtgat tggcgatctc cctgggcttc aagagagccc agggagatcg ccaatcacct 60
tttttggtac c 71
<210> 8
<211> 71
<212> DNA
<213>Artificial sequence
<400> 8
aattggtacc aaaaaaggtg attggcgatc tccctgggct ctcttgaagc ccagggagat 60
cgccaatcac c 71
Claims (10)
1. specificity suppresses the siRNA of CA7 gene expressions, including positive-sense strand and antisense strand, it is characterised in that the positive-sense strand
Nucleotide sequence is as shown in SEQ ID NO.1, and the nucleotide sequence of antisense strand is as shown in SEQ ID NO.2.
2. siRNA as claimed in claim 1, it is characterised in that 3 bases at the positive-sense strand and the 5 ' of antisense strand and 3 ' ends
Carry out the modification of 2 '-methoxyl group.
3. applications of the siRNA as claimed in claim 1 or 2 in CA7 gene expression inhibitors are prepared.
4. siRNA as claimed in claim 1 or 2 is in treatment oophoroma, glioma or colorectal cancer medicine is prepared
Using.
5. applications of the siRNA as claimed in claim 1 or 2 in the medicine for reversing oophoroma taxol resistance is prepared.
6. a kind of rnai reagent box for including the DNA sequence dna for encoding siRNA as claimed in claim 1 or 2.
7. a kind of recombinant vector containing the DNA sequence dna for encoding siRNA as claimed in claim 1 or 2.
8. application of the recombinant vector as claimed in claim 7 in CA7 gene expression inhibitors are prepared.
9. recombinant vector as claimed in claim 7 is in treatment oophoroma, glioma or colorectal cancer medicine is prepared
Using.
10. application of the recombinant vector as claimed in claim 7 in the medicine for reversing oophoroma taxol resistance is prepared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710422844.9A CN107177594B (en) | 2017-06-07 | 2017-06-07 | siRNA for specifically inhibiting CA7 gene expression and recombinant vector and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710422844.9A CN107177594B (en) | 2017-06-07 | 2017-06-07 | siRNA for specifically inhibiting CA7 gene expression and recombinant vector and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107177594A true CN107177594A (en) | 2017-09-19 |
| CN107177594B CN107177594B (en) | 2020-03-03 |
Family
ID=59835329
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710422844.9A Expired - Fee Related CN107177594B (en) | 2017-06-07 | 2017-06-07 | siRNA for specifically inhibiting CA7 gene expression and recombinant vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107177594B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008046911A2 (en) * | 2006-10-20 | 2008-04-24 | Exiqon A/S | Novel human micrornas associated with cancer |
| US7579457B2 (en) * | 2002-11-14 | 2009-08-25 | Dharmacon, Inc. | siRNA targeting carbonic anhydrase II |
| CN103146703A (en) * | 2013-03-01 | 2013-06-12 | 中国人民解放军第二军医大学 | siRNA for inhibiting growth of epithelial ovarian cancer as well as recombinant vector and application thereof |
-
2017
- 2017-06-07 CN CN201710422844.9A patent/CN107177594B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7579457B2 (en) * | 2002-11-14 | 2009-08-25 | Dharmacon, Inc. | siRNA targeting carbonic anhydrase II |
| WO2008046911A2 (en) * | 2006-10-20 | 2008-04-24 | Exiqon A/S | Novel human micrornas associated with cancer |
| CN103146703A (en) * | 2013-03-01 | 2013-06-12 | 中国人民解放军第二军医大学 | siRNA for inhibiting growth of epithelial ovarian cancer as well as recombinant vector and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| CLAUDIU T. SUPURAN等: "Carbonic Anhydrase Inhibitors: Sulfonamides as Antitumor Agents?", 《BIOORGANIC & MEDICINAL CHEMISTRY》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107177594B (en) | 2020-03-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | FTO promotes cell proliferation and migration in esophageal squamous cell carcinoma through up-regulation of MMP13 | |
| Wu et al. | Oncogene FOXK1 enhances invasion of colorectal carcinoma by inducing epithelial-mesenchymal transition | |
| Zheng et al. | LncRNA NNT-AS1 promote glioma cell proliferation and metastases through miR-494-3p/PRMT1 axis | |
| Yang et al. | STEAP2 is down-regulated in breast cancer tissue and suppresses PI3K/AKT signaling and breast cancer cell invasion in vitro and in vivo | |
| Liu et al. | MicroRNA-27b inhibits Spry2 expression and promotes cell invasion in glioma U251 cells | |
| CN108467891A (en) | Applications of the SNHG5 in breast cancer diagnosis and assessment and outcome prediction | |
| Zhong et al. | Ubiquitin-specific protease 15 contributes to gastric cancer progression by regulating the Wnt/β-catenin signaling pathway | |
| Wang et al. | Circ-PRKDC facilitates the progression of colorectal cancer through miR-198/DDR1 regulatory axis | |
| Dang et al. | G-protein-signaling modulator 2 expression and role in a CD133+ pancreatic cancer stem cell subset | |
| Shi et al. | Increased HSF1 promotes infiltration and metastasis in cervical cancer via enhancing MTDH-VEGF-C expression | |
| Park et al. | Follicular stimulating hormone enhances Notch 1 expression in SK-OV-3 ovarian cancer cells | |
| Yang et al. | CAFs-derived small extracellular vesicles circN4BP2L2 promotes proliferation and metastasis of colorectal cancer via miR-664b-3p/HMGB3 pathway | |
| Wei et al. | Bmi-1 is essential for the oncogenic potential in CD133+ human laryngeal cancer cells | |
| Su et al. | Inhibition of PTTG1 expression by microRNA suppresses proliferation and induces apoptosis of malignant glioma cells | |
| CN107287200B (en) | The siRNA and its recombinant vector of specificity inhibition Eya2 gene expression and application | |
| Wang et al. | Low Levels of SPARC are associated with tumor progression and poor prognosis in human endometrial carcinoma | |
| Dang et al. | LncRNA AFAP1-AS1 modulates the proliferation and invasion of gastric cancer cells by regulating AFAP1 via miR-205-5p | |
| CN107236736B (en) | The siRNA and its recombinant vector of specificity inhibition MSI-1 gene expression and application | |
| CN107354157A (en) | Specificity suppresses siRNA and its recombinant vector and the application of LAMB1 gene expressions | |
| CN105079822B (en) | Application of the GEM 132 of FAM3C in the drug for inhibiting the transfer of epithelial ovarian cancer cell invasion is prepared | |
| CN107254470B (en) | The siRNA and its recombinant vector of specificity inhibition PADI2 gene expression and application | |
| CN107164378A (en) | Specificity suppresses siRNA and its recombinant vector and the application of SPIB gene expressions | |
| CN107541514A (en) | Specificity suppresses siRNA and its recombinant vector and the application of COL12A1 gene expressions | |
| CN107541515A (en) | Specificity suppresses siRNA and its recombinant vector and the application of PRV1 gene expressions | |
| CN106282385B (en) | Identification and purposes of the long-chain non-coding RNA XLOC_000090 in lung cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200303 |