CN107354157A - Specificity suppresses siRNA and its recombinant vector and the application of LAMB1 gene expressions - Google Patents
Specificity suppresses siRNA and its recombinant vector and the application of LAMB1 gene expressions Download PDFInfo
- Publication number
- CN107354157A CN107354157A CN201710598070.5A CN201710598070A CN107354157A CN 107354157 A CN107354157 A CN 107354157A CN 201710598070 A CN201710598070 A CN 201710598070A CN 107354157 A CN107354157 A CN 107354157A
- Authority
- CN
- China
- Prior art keywords
- sirna
- lamb1
- taxol
- cell
- recombinant vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
Abstract
Suppress the siRNA of LAMB1 gene expressions the invention discloses a species specificity and its recombinant vector is applied with it in oophoroma taxol resistance is reversed, belong to molecular biology and biomedicine technical field.The siRNA, including positive-sense strand and antisense strand, positive-sense strand:5’‑UGUUUGAAAGCCGAAUCUGCG‑3’;Antisense strand:5’‑CAGAUUCGGCUUUCAAACAAA‑3’.SiRNA provided by the invention can specific, efficiently suppress the mRNA and protein expression of LAMB1 genes in tumour cell, reduce tumor cell proliferation, increase Apoptosis, reduce tumor cell migration and invasive ability, and can effectively reverse resistance of the ovarian cancer cell to taxol.Present invention also offers the application of the siRNA and its recombinant vector in preparing treatment oophoroma, hepatocellular carcinoma, colorectal cancer, glioblastoma, prostate cancer or stomach cancer and reversing the medicine of ovarian cancer drug-resistant.
Description
Technical field
The present invention relates to molecular biology and biomedicine technical field, and in particular to a species specificity suppresses LAMB1 bases
Because of the siRNA and its recombinant vector of expression and application.
Background technology
RNA interference (RNA interference, RNAi) is the sequence specific post transcriptional base being widely present in animals and plants
Because of Silencing Mechanisms.American scientist Andrew Fire in 1998 have found first in beautiful new rhabditis axei C.Elegans bodies will
The suppression of at least 10 times GEM 132s of gene silencing effect caused by the mixture of positive-sense strand and antisense strand (i.e. dsRNA)
Effect, and same gene suppression can be induced in filial generation.The study mechanism of RNAi phenomenons is shown, it is micro
SiRNA can make a large amount of target RNA silences by PTGS, and it is this efficiently, special degraded cognate rna is so as to causing
The key molecules of sequence specific gene silence are the small double chain oligonucleotide of a length of 21-23 bases, also referred to as siRNA
(siRNA).Effectively start RNAi, Er Qieqi are unable to further study show that being shorter than 21bp or being longer than 25bp double-stranded RNA
There is a base mispairing in as long as, just obvious decline even disappears the effect of gene silencing, has fully demonstrated the spy of siRNA effects
The opposite sex.
Show that the siRNA of powerful gene silencing efficiency gets most of the attention as the great discovery of biotechnology in recent years,
It is that gene functional research is strong exactly because there is specificity and high efficiency to block the gene of homologous gene to suppress function for it
Instrument.SiRNA has the incomparable advantage and feature of many conventional methods.Although some suppression specific gene tables existing at present
The method reached, such as antisense RNA, gene knockout (knockout), but siRNA shows and is substantially better than the excellent of these technologies
Gesture:Compared with antisense RNA, it has higher specificity and continuation;Compared with the gene knockout of complicated and time consumption, siRNA is
More simple and effective means.It is widely used in the research of malignant tumour mechanism as the method for gene silencing currently with siRNA,
The key point of research is mainly concentrated in improving gene silencing efficiency, including the selection of target gene site, the optimization of import system
With the influence to host cell function etc., and thus promoted the efficient targeted therapy strategy of the tomour specific based on the technology
Research and development process.
Oophoroma is one of most common gynecologic malignant tumor, and its case fatality rate occupies the first place of all kinds of gynecological tumors.Oophoroma
The maximum obstacle for the treatment of is the generation of tumor cell drug resistance, multidrug resistance particularly occurs.As platinum class/PTX is medication combined
The implementation of chemotherapy, the first chemotherapy side effect rate of oophoroma is up to 80%.But Most patients recurred in 2~3 years.After recurrence
Oophoroma, even if resistance is also produced, so that survival rate after oncotherapy using the entirely different chemotherapeutics of mechanism of action again
Cannot significantly it improve.The five year survival rate of advanced ovarian cancer is hovered 20~30% all the time.After high relapse rate and recurrence
High resistant rate is one of most important reason of oophoroma high mortality, and the solution for finding chemotherapy in ovarian cancer resistance is swollen at present
The important topic of knurl research.
Molecular targeted agents and chemotherapy combined application are the current raising most promising treatments of malignant tumor patient survival rate
Method.Extracellular matrix (extracellular matrix, ECM), it is to be synthesized and be secreted into by cell extracellular and be distributed in thin
Macromolecular between cellular surface or cell, mainly some polysaccharide, albumen or proteoglycans.These materials form complicated rack
Structure, support and connect institutional framework, adjust the physiological activity of tissue and cell.The signaling molecules such as ECM energy binding growth factors,
Start various signal transduction paths so as to adjust the functions such as cellular morphology, travel motion, propagation, differentiation.The generation of malignant tumour,
Development, invasion and attack and transfer are frequently accompanied by the change of ECM expression.Laminin β 1 (laminin β 1, LAMB1), chromosome mapping
It is one of extracellular basilar memebrane heterotrimer glycoprotein extended familys member, in many basic bioprocess in 7q31.1
Play an important role, including cell adherence and migration, embryonic development, angiogenesis, tissue differentiation, wound healing with etc..Closely
There are some document reports to be examined in hepatocellular carcinoma, colorectal cancer, glioblastoma, prostate cancer and stomach cancer successively over year
Measuring LAMB1 has high expression.In stomach cancer and colorectal cancer there is the frameshift mutation of gene in LAMB1, glioblastoma
Expression containing the chain laminins of α 4 in capillary basilar memebrane can be raised significantly, the laminin-9 (β 1 of 4 β of α 2) containing the chains of β 2
It can be substituted by the LAMB1 (γ 1 of 4 β of α 1) containing the chains of β 1, expressions of the LAMB1 in glioblastoma tissue is compared
Show significantly to raise compared with normal cerebral tissue and I/II grade of glioma.
Although up to the present specific mechanism of action of the LAMB1 in tumour is unclear, LAMB1 take part in tumour
Cause a disease and development process is progressively realized.The research of our early stages shows LAMB1 in oophoroma taxol resistance cell line
There is abnormal elevated phenomenon in A2780/Taxol, but whether the gene is relevant with ovarian tumors and ovarian cancer drug-resistant need
Further research.Therefore, LAMB1 gene expressions in ovarian cancer drug-resistant cell strain are disturbed using RNAi technology, will is pair
The important supplement of ovarian tumors mechanism, it is important exploration and application to oophoroma and its resistance treatment.
The content of the invention
It is an object of the invention to provide the siRNA that a species specificity suppresses LAMB1 gene expressions, for ovarian tumors
Mechanism Study.It is another object of the present invention to provide the siRNA to prepare treatment oophoroma and reverse taxol resistance
Application in medicine.
To achieve the above object, the present invention adopts the following technical scheme that:
3 pairs of present invention design, synthesis specificity suppress the siRNA of LAMB1 gene expressions, and it is resistance to be transfected into oophoroma taxol
In medicine cell line A2780/Taxol, as a result find that the interference effect of S1 suppression LAMB1 gene expressions is most obvious.
The invention provides the siRNA (S1) that a species specificity suppresses LAMB1 gene expressions, including positive-sense strand and antisense
Chain,
The positive-sense strand:5’-UGUUUGAAAGCCGAAUCUGCG-3’(SEQ ID NO.1);
The antisense strand:5’-CAGAUUCGGCUUUCAAACAAA-3’(SEQ ID NO.2).
Preferably, 3 bases at the positive-sense strand and the 5 ' of antisense strand and 3 ' ends carry out the modification of 2 '-methoxyl group.This hair
Bright research has shown that, siRNA (S1) stability increase after the modification of 2 '-methoxyl group, can improve it and resist the water of ribozyme in vivo
The ability of solution, immunostimulation reaction is reduced, extend the action time of siRNA interference down regulation of gene expression, make its effect that there is height
Effect property, specificity.
The invention provides a kind of rnai reagent box for including the DNA sequence dna for encoding the siRNA.The kit
In comprising having cloned the DNA plasmid carrier of the siRNA, during application, the plasmid vector is in eukaryotic described in transcriptional expression
SiRNA, and then the expression of silence LAMB1 genes.
The invention provides a kind of recombinant vector containing the DNA sequence dna for encoding the siRNA.Preferably, use
Initial carrier is slow virus carrier pLKO.1puro.
Present invention also offers the construction method of recombinant vector, including:
(1) LAMB1-S1 fragments are synthesized, Age I and EcoR two restriction enzyme sites of I is selected, according to S1 sequence, designs it
ShRNA sequences, sequence are as follows:
Positive-sense strand:
5’-CCGGTTTGTTTGAAAGCCGAATCTGCGTTCAAGAGACGCAGATTCGGCTTTCAAACAAATTTTTTG
GTACC-3’(SEQ ID NO.7);
Antisense strand:
5’-AATTGGTACCAAAAAATTTGTTTGAAAGCCGAATCTGCGTCTCTTGAACGCAGATTCGGCTTTCAA
ACAAA-3’(SEQ ID NO.8);
(2) annealing obtains LAMB1-S1 DNA fragmentation;
(3) with slow virus carrier pLKO.1puro structure pLKO.1-LAMB1-sh1 recombinant vectors.
SiRNA provided by the invention is capable of the expression of efficiently specific suppression ovarian cancer cell LAMB1 genes, reduces cell
Propagation, increase Apoptosis, reduce cell migration and invasive ability, therefore, the siRNA and recombinant vector are as LAMB1 bases
It can apply to because of expression inhibiting agent among the research of tumor disease pathogenesis.
The invention provides the application of the siRNA and recombinant vector in LAMB1 gene expression inhibitors are prepared.
The invention provides the siRNA and recombinant vector to prepare treatment oophoroma, hepatocellular carcinoma, colorectal cancer, evil
Application in nerve glioma, prostate cancer or gastric cancer medicament.
Present invention research shows that after taxol resistance strain A2780/Taxol transfects the siRNA, the cell line is to Japanese yew
The sensitiveness of alcohol significantly improves, and it is 15.28 to reverse index, illustrates siRNA provided by the invention to taxol resistance strain A2780/
Taxol resistance has the reversing effect of highly significant, therefore, treatments of the siRNA to reverse oophoroma taxol resistance
With potential using value.
The invention provides described siRNA and recombinant vector in the medicine for reversing oophoroma taxol resistance is prepared
Using.
The beneficial effect that the present invention possesses:
SiRNA provided by the invention can specific, efficiently suppress the mRNA and albumen of LAMB1 genes in tumour cell
Expression, tumor cell proliferation is reduced, increase Apoptosis, reduce tumor cell migration and invasive ability, and can effectively reverse ovum
Nest cancer cell is applied to Tumorigenesis research and prepares oncotherapy and reverse oophoroma to the resistance of taxol
It is significant in the medicine of resistance treatment.
Brief description of the drawings
Fig. 1 is that qRT-PCR detects A2780 cells and A2780/Taxol cells LAMB1mRNA expression, and wherein A is A2780
Cell, AR are A2780/Taxol cells.
Fig. 2 is that Western Blotting detect A2780 cells and A2780/Taxol cell LAMB1 protein expressions, wherein
A is A2780 cells, and AR is A2780/Taxol cells.
Fig. 3 is that qRT-PCR detects S1, and A2780/Taxol cells LAMB1mRNA is expressed after S2, S3 transfection 48h.
Fig. 4 is that Western Blotting detect S1, and S2, S3 transfect A2780/Taxol cell LAMB1 albumen tables after 72h
Reach.
Fig. 5 is pLKO.1-LAMB1-sh1 recombinant plasmids and insertion restriction enzyme site schematic diagram.
Fig. 6 is small hair fastener shRNA schematic diagrames.U6 promoters instruct the small hair fastener shRNA in downstream transcription;Including 23 S1 just
Adopted chain base, 23 S1 antisense strand bases.
Fig. 7 is A2780/Taxol cell LAMB1 eggs after Western Blotting detection transfections pLKO.1-LAMB1-sh1
White expression.
A2780/Taxol cell quantities and form become after Fig. 8 is phase contrast microscope observation transfection pLKO.1-LAMB1-sh1
Change.
Fig. 9 is the propagation of A2780/Taxol cells after bromine mark method detection transfection pLKO.1-LAMB1-sh1.
Figure 10 is the apoptosis that Caspase3 Activity determinations transfect A2780/Taxol cells after pLKO.1-LAMB1-sh1.
Figure 11 is A2780/Taxol cell migration abilities after cell scratch experiment detection transfection pLKO.1-LAMB1-sh1.
Figure 12 be Transwell detection transfection pLKO.1-LAMB1-sh1 after A2780/Taxol cell migrations ability (A) and
Invasive ability (B).
Figure 13 is reverse of the A2780/Taxol cells to taxol resistance after transfection pLKO.1-LAMB1-sh1.
Embodiment
With reference to embodiment, the invention will be further described.The purpose of method used in following embodiment is more preferable
Ground understands the present invention, but is not limited to the present invention.Unless otherwise specified, the experimental method being related in embodiment is conventional side
Method, experiment material used are the purchase of conventional reagent company.
Using the statistical analysis softwares of SPSS 18.0, each sample data is with mean ± standard deviationRepresent, between two groups
Difference examined (Independent-Sample T Test) with T, it is multigroup between inspection one-way analysis of variance (One-
Way ANOVA), IC50Using probit regression analyses, P < 0.05 have significant difference.
Ovarian Cancer Cells A2780 and oophoroma taxol resistance cell line A2780/Taxol are by Zhejiang Province's female reproduction
Health research key lab cell bank preserves;
The anti-human GAPDH primary antibodies (Cat.60004-1-Ig) of rabbit-anti people LAMB1 primary antibodies (Cat.23498-1-AP), mouse, horseradish
Peroxidase labelling goat anti-mouse IgG (H+L) secondary antibody (Cat.SA00001-1), horseradish peroxidase-labeled goat resist
Rabbit igg (H+L) secondary antibody (Cat.SA00001-2) is purchased from Proteintech companies;
Western Blotting Luminol Reagent detection kits (Cat.sc-2048) are purchased from Santa Cruz
Company;
CDNA Reverse Transcriptase kits PrimeScriptTMRT Master Mix (Cat.RR036A), fluorescence quantitative PCR detection
Kit SYBR Premix Ex Taq (perfect Real time, Cat.DRR041A) are purchased from TaKaRa companies;
Lipofectamine3000 transfection reagents box (Cat.L3000008) is purchased from Invitrogen companies;
Carrier for expression of eukaryon selects RNAi carrier pLKO.1puro, comes from global scientist's plasmid and shares non-profit organization
Addgene;
Restriction enzyme A ge I (Cat.R0552S), EcoR I (Cat.R0101S), Kpn I (Cat.R0142S) purchases
From NEB companies;T4 ligases (Cat.2011A), DNA fragmentation purification kit (Cat.9761), DNA gel QIAquick Gel Extraction Kit
(Cat.9762), DNA small scale purification kit (Cat.9760) is purchased from TaKaRa companies;
SiRNA is synthesized by TaKaRa companies;PCR primer and clone are synthesized with DNA by Shanghai Sheng Gong bio-engineering corporations;
Pre-dyed albumen Marker (Cat.26616) is purchased from Fermentas companies;
Bromine mark method cell proliferation detecting kit Cell Proliferation ELISA, BrdU (colorimetric,
Cat.11647229001 Roche companies) are purchased from;
CaspACE Assay System (colorimetric, Cat.G7351) are purchased from Promega companies;
Cell migration, invasive model Transwell Permeable Supports (Cat.3428) are public purchased from Corning
Department;
Lab-Tek II Chamber Slide System-Lab-Tek chamber slides systems are purchased from Nunc companies
(Cat.154526);
BD MatrigelTMBasement Membrane Matirx matrix membranes (Cat.356234) are purchased from BD companies;
SiRNA negative control AllStars Negative Control SiRNA (Cat.1027281) are public purchased from QIAGEN
Department;
PAGE gel configuration kit (Cat.CW0022M) is ShiJi Co., Ltd purchased from health;
0.45um pvdf membranes (Cat.IPVH00010) are purchased from Millipore companies;
Taxol (Cat.P106868) is purchased from Aladdin companies.
LAMB1 expression is poor in the Ovarian Cancer Cells A2780 of embodiment 1. and its taxol resistance cell line A2780/Taxol
Different research
First, real-time fluorescence quantitative RT-PCR (qRT-PCR) detection LAMB1 gene mRNA expressions
The culture medium abandoned in 6 orifice plates is inhaled after culture 48h, Trizol extracted total RNAs, Thermo are used after being washed twice with PBS
Nano Drop2000 spectrophotometric determination RNA concentration, and press SYBR Premix Ex Taq (perfect Real time)
Kit specification operates.First step RNA is denatured.Reaction system:RNA0.5ug, RNase DEPC water is gone to complement to 6.8ul;Instead
Answer condition:It is placed on ice after 70 DEG C of incubation 10min.Second step reverse transcription.Reaction system:According to PrimeScript RT
Master Mix kit specifications carry out reverse transcription;Reaction condition:After 42 DEG C of incubations 60min, 85 DEG C of inactivation 5min, -20 DEG C
Preserve.
1ul reverse transcription products are taken to carry out quantitative fluorescent PCR reaction.PCR primer sequence:
5’-ATCGCAGATTCGGCTTTCAA-3’;
5 '-TCTTCCCGTCTTCCTTTCCG-3 ', product length:236bp;
Reaction condition:95 DEG C of 10s, 95 DEG C of 5s, 6 DEG C of 30s, totally 40 circulations.
The expression quantity of LAMB1mRNA in each group sample is calculated using 2- △ CT methods.
As a result:As shown in figure 1, A2780/Taxol cells are compared with its parental cell A2780, LAMB1mRNA expression increases
High 68.35% (P < 0.05), shows that LAMB1mRNA expression is significantly increased in taxol resistance cell line.
2nd, Western Blotting detect LAMB1 protein expressions
The culture medium abandoned in 6 orifice plates is inhaled after culture 72h, PBS is washed 3 times, adds RIPA protein lysates (100ul/ holes),
Piping and druming for several times, is incubated 5min, is allowed to fully crack, 4 DEG C on ice, and 12000 leave the heart 5 minutes, collects supernatant, dispenses -20 DEG C of storages
Deposit;10ul loadings, 8%SDS-PAGE electrophoresis, 200V, 10min are taken after each 95 DEG C of denaturation 5min of sample;100V, 100min;Turn
To pvdf membrane:110V, 120min;60min is closed with the TBS confining liquids containing 5% skimmed milk power;Primary antibody is incubated:LAMB1 primary antibodies
(1:2000), GAPDH primary antibodies (1:5000) 2h is incubated at room temperature;TBS washes film 10min × 3 time;Secondary antibody is incubated:Horseradish peroxidating
Thing enzyme marks goat anti-mouse IgG (H+L) secondary antibody (1:10000), horseradish peroxidase-labeled goat anti-rabbit igg (H+L) two
Anti- (1:10000) it is incubated 1h;TBST washes film 10min × 3 time, and TBS washes film 10min × 1 time;After ECL developments, Image is used
Quant LAS4000mini (GE Healthcare) are to scanning of image processing.
As a result:As shown in Fig. 2 A2780/Taxol cells are compared with its parental cell A2780, LAMB1 protein expressions
Significantly increase (P < 0.05).
Embodiment 2.LAMB1siRNA design synthesis
LAMB1 gene mRNA sequences (NM_002291.2) are discovered and seized in Genebank, with siDirect Ver2.0 softwares
(http://sidirect2.rnai.jp/) 3 couples of siRNA sequence (such as SEQ ID NO.1-SEQ ID of Photographing On-line acquisition
NO.6 shown in).In design process selection simultaneously meet document report three kinds of algorithms (Ui-Tei × Reynolds ×
Amarzguioui sequence), and siRNA action specificity highest 23nt long fragments are selected, the design can avoid body in future
Interferon-like immune response occurs during interior experiment, selects 100nt after initiation codon, avoids 5 ' and 3 ' end UTR areas, G/C content control
System is in 30-70%.The siRNA of 3 pairs of 23nt length is selected to show as positive-sense strand as experiment screening interference fragment, architectural feature altogether
Respectively have that two bases are plug-in, and design feature is as follows with the end of antisense strand 3 '
Then use BLASTN(https://blast.ncbi.nlm.nih.gov/Blast.cgi)It is online to carry out homology
Search, the sequence for having homology is excluded, avoids influence of the non-specific fragment to siRNA specific effect effects as far as possible.
Finally positive-sense strand and the 5 ' of antisense strand and 3 ' continuous 3 purine (pyrimidine) bases in end are carried out in chemical synthesis
2 '-OMe (2 '-methoxyl group) are modified, and the chemical stability of increase siRNA molecule in the cell, extend siRNA interference gene expressions
The time of downward and effect.Final sequence and modification such as table 1 and formula (I) are as follows:
Table 1
3. 3 couples of LAMB1siRNA of embodiment are done in oophoroma taxol resistance strain A2780/Taxol to LAMB1 genes
Disturb the detection and screening of effect
First, experiment packet:
1.A2780/Taxol normal groups (do not transfect siRNA), hereinafter referred to as AR;
2.A2780/Taxol negative control groups (transfection negative control siRNA), hereinafter referred to as AR-N;
3.A2780/Taxol experimental groups (transfection S1), hereinafter referred to as AR-S1;
4.A2780/Taxol experimental groups (transfection S2), hereinafter referred to as AR-S2;
5.A2780/Taxol experimental groups (transfection S3), hereinafter referred to as AR-S3.
2nd, packet transfection
To ensure transfection efficiency, cytotoxicity is reduced, we are carried out using Lipofectamine3000 transfection reagents
SiRNA is transfected.The day before transfection, trypsin digestion cell simultaneously count, and plating cells make it in transfection day density in six orifice plates
0.5×106/ ml, cell fusion to 70-90%.Diluted per hole with 125 μ l serum-free OPTI-MEM culture mediums
The reagents of 5ulLipofectamine 3000 simultaneously fully mix;SiRNA premixed liquids are prepared, are cultivated with 125 μ l serum-frees OPTI-MEM
Base dilutes siRNA to final concentration of 50nM, and fully mixes;Added in the reagents of Lipofectamine 3000 diluted
SiRNA premixed liquids (1:1), it is incubated at room temperature 5min;Finally siRNA- liposome complexes are added in cell, 37 DEG C, 5%
CO2In continue to cultivate.LAMB1mRNA expression is detected after 48h, LAMB1 protein expressions are detected after 72h.
3rd, real-time fluorescence quantitative RT-PCR (qRT-PCR) detection LAMB1 gene mRNA expressions
Detecting step is the same, and the expression quantity of LAMB1mRNA in each group sample is calculated using 2- △ CT methods.
As a result:As shown in figure 3, after A2780/Taxol cells transfect S1, S2, S3 respectively, LAMB1mRNA expression has
It is decreased obviously, for wherein S1 interference effects compared with negative control group, LAMB1mRNA has lowered 85.09%, with S2 (65.02%)
Compared with S3 (21.786%), there were significant differences (P < 0.05).As a result show, S1 has best interference effect to LAMB1.
4th, Western Blotting detect LAMB1 protein expressions
Detecting step is the same, after ECL developments, with Image Quant LAS4000mini (GE Healthcare) to image
Scan process.
As a result:As shown in figure 4, compared with negative control, after S1 transfections, LAMB1 protein expressions in A2780/Taxol cells
(P ﹤ 0.05) is remarkably decreased, and there were significant differences compared with S2 and S3 (P ﹤ 0.05).As a result show, in taxol resistance strain
In A2780/Taxol, S1 has best interference effect to LAMB1 protein expression.Therefore pass through screening, after S1 is selected as
The siRNA of continuous research.
The eukaryotic vector pLKO.1-LAMB1-sh1 of embodiment 4. structure and the interference effect detection to LAMB1 gene expressions
First, experiment packet:
1.A2780/Taxol normal groups (do not transfect any carrier), hereinafter referred to as AR;
2.A2780/Taxol negative control groups (transfection pLKO.1puro empty carriers), hereinafter referred to as AR-N;
3.A2780/Taxol experimental groups 1 (transfection pLKO.1-LAMB1-sh1), hereinafter referred to as AR-sh1;
2nd, LAMB1-S1 fragments are synthesized
Age I and EcoR two restriction enzyme sites of I are selected, according to S1 sequence, its shRNA sequence is designed and is building up to true
In nuclear expression carrier pLKO.1puro.Sequence is as follows:
Positive-sense strand:
5’-CCGGTTTGTTTGAAAGCCGAATCTGCGTTCAAGAGACGCAGATTCGGCTTTCAAACAAATTTTTTG
GTACC-3’(SEQ ID NO.7);
Antisense strand:
5’-AATTGGTACCAAAAAATTTGTTTGAAAGCCGAATCTGCGTCTCTTGAACGCAGATTCGGCTTTCAA
ACAAA-3’(SEQ ID NO.8);
3rd, eukaryotic vector pLKO.1-LAMB1-sh1 structure
PLKO.1-LAMB1-sh1 recombinant expression carriers (Fig. 5 and 6) are built with carrier for expression of eukaryon pLKO.1puro, specifically
Method is referring to U.S.'s Cold Spring Harbor Publications《Molecular Cloning:A Laboratory guide》.
By LAMB1-S1 positive-sense strands and the annealed program of antisense strand (95 DEG C of denaturation 2min;Slow cooling is annealed to 25 DEG C), 4
DEG C preserve.Age I and EcoR I complete degestion carriers pLKO.1puro, 37 DEG C overnight;Digestion products DNA gel reclaim reagent
Box reclaims DNA.Annealed product is attached reaction, reaction system (10ul) with carrier digestion recovery fragment:T4 ligase 1ul,
T4 ligase buffer solution 1ul, annealed product and carrier digestion recovery fragment mixture (mol ratio 3:1);Deionized water mend to
10ul, 16 DEG C of connections are overnight;5ul connection products are taken to be placed in 100ul JM109 competence bacteriums, ice bath 30min, 42 DEG C of heat are stopped
Gram 90s, ice bath 5min, add LB culture mediums 1000ul, 37 DEG C of shaking table culture 30min, 5000rpm centrifugation 5min, abandon supernatant, will be thin
Bacterium is spread evenly across on LB flat boards (ampicillin containing 50ug/ml), 37 DEG C of inversion overnight incubations;Some independent clones are selected to connect
For kind in the LB culture mediums containing corresponding resistant, bacterium is expanded in 37 DEG C of concussions overnight;Bacterium is collected, is extracted with plasmid DNA purification kit
DNA is obtained, KpnI digestions identification, obtains pLKO.1-LAMB1-sh1 recombinant plasmids.
4th, interference effect is observed after pLKO.1-LAMB1-sh1 recombinant plasmid transfected cells
PLKO.1-LAMB1-sh1 is transfected into the A2780/Taxol cells of exponential phase.Transfect reference
Lipofectamine3000 operational manuals, dilute 5ul with 125 μ l serum-free OPTI-MEM culture mediums per hole
Lipofectamine3000 reagents simultaneously fully mix;5ug recombinant plasmids are added in 125 μ l serum-free OPTI-MEM culture mediums
DNA, P3000 reagent 10ul are added, are fully mixed, Prepare restructuring plasmid premixed liquid;In the Lipofectamine diluted
Recombinant plasmid premixed liquid (1 is added in 3000 reagents:1), it is incubated at room temperature 5mim;Finally by recombinant plasmid-liposome complex
250ul is added in cell, 37 DEG C, 5% CO2In continue to cultivate.LAMB1 protein expressions are detected after 72h.
As shown in fig. 7, after transfection pLKO.1-LAMB1-sh1 recombinant plasmids, compared with negative control (transfection empty plasmid),
LAMB1 protein expressions are remarkably decreased (P ﹤ 0.05) in A2780/Taxol cells, the results showed that, transfect pLKO.1-LAMB1-sh1
Recombinant plasmid can effectively disturb LAMB1 protein expression.
Embodiment 5. transfect after pLKO.1-LAMB1-sh1 specific inhibitions LAMB1 expression to tumor cell proliferation, apoptosis,
Migration and the influence of invasion and attack
First, experiment packet:
1.A2780/Taxol normal groups (do not transfect any carrier), hereinafter referred to as AR;
2.A2780/Taxol negative control groups (transfection pLKO.1puro empty carriers), hereinafter referred to as AR-N;
3.A2780/Taxol experimental groups (transfection pLKO.1-LAMB1-sh1), hereinafter referred to as AR-sh1.
2nd, packet transfection
Transfection procedure is the same, continues to cultivate cell after transfection, for detecting propagation, apoptosis, migration and the invasion and attack of cell.
3rd, cell proliferation test
Cell continues to cultivate 72h after transfecting pLKO.1-LAMB1-sh1 in 96 orifice plates, and 10ulBrdU marks are added per hole
For liquid to the final concentration of 10uM of BrdU, 37 DEG C are incubated 2h;BrdU marking fluids are absorbed, 200ulFixDenat, 20 DEG C of incubations are added per hole
30min;FixDenat is absorbed, 100ulanti-BrdU-POD, 20 DEG C of incubation 90min are added per hole;Per hole 200ul
WashingSolution is washed 3 times;Add 100ul/ holes substrate solution, 20 DEG C of incubation 20min, Detection wavelength 370nm (references
Wavelength 492nm) survey absorbance (A), the ability A of cell propagationExperimental group/AControl groupRepresent.
As a result as shown in Figure 8 and Figure 9, in A2780/Taxol cells, after transfecting pLKO.1-LAMB1-sh1, difference is aobvious
Micro- Microscopic observation is visible, and experimental group cell quantity significantly reduces, and suspension cell quantity increase, cell fragment increases;Bromine mark method is surveyed
Examination Cell proliferation results are shown:Compared with negative control, experimental group ability of cell proliferation have dropped 33.21%, have conspicuousness poor
Different (P < 0.05).After the expression for illustrating specific inhibition LAMB1, tumor cell proliferation can be suppressed.
4th, Caspase3 Activity determinations Apoptosis
Cell is collected after transfection 72h, lysate adjustment cell density is 1 × 108/ ml, 15min, 15000g are cracked on ice
× 20min, collect supernatant.Prepared simultaneously according to CaspACE Assay System (colorimetric) specifications positive and cloudy
Property control sample, is determined and to adjust each group protein concentration identical.Caspace Assay are added in 96 orifice plates per hole
Buffer32ul, DMSO2ul, 100nM DTT 10ul, deionized water adjustment volume is 98ul, adds 2ul DEVD-pNA bottoms
Thing, 37 DEG C of incubations 4h, Detection wavelength 405nM survey absorbance, and every group of sample Caspase3 activity is calculated with Δ A methods.
As a result as shown in Figure 10, after A2780/Taxol cell transfectings pLKO.1-LAMB1-sh1, Caspase3 activity increases
2.92 times, compared with negative control, there are significant difference (P < 0.05), after the expression for illustrating specific inhibition LAMB1, energy
Promote apoptosis of tumor cells.
5th, cell scratch test detection cell migration ability
Horizontal line is uniformly drawn with ruler behind in six orifice plates, the standardized roads of about 0.5cm, via is crossed, per hole at least 6 horizontal strokes
Line.After cell transfecting pLKO.1-LAMB1-sh1, when continuing to cultivate 24h cell fusions into individual layer state, used in selection area
200ul pipette tips vertical cut in six orifice plates, PBS wash 3 cells removed under drawing, add serum free medium and continue to train
Support.0h, 24h, 48h time point take pictures, and randomly select 6 horizontal lines, calculate iuntercellular apart from average.
As a result as shown in figure 11, after pLKO.1-LAMB1-sh1 transfectional cells 24h and 48h, A2780/Taxol iuntercellulars away from
From noticeably greater than negative control group, healing ability is remarkably decreased after cell cut, after the expression for illustrating specific inhibition LAMB1,
The migration of tumour cell can be suppressed.
6th, Transwell testing inspections cell migration ability
After cell transfecting 48h, with collected by trypsinisation, it is resuspended with serum free medium, adjustment cell density is 5 × 105/
Ml, upper chamber add 2ml cell suspensions, and lower room adds 10%FBS complete medium 2ml, continue to cultivate 24h, take out cell, PBS washes 3
It is secondary, the cell of upper chamber upper surface is carefully removed with cotton swab, inversion is dried, and 95% ethanol fixes 25min, haematoxylin dyeing, shows
Micro- Microscopic observation, count, take pictures.Each cell counts 10 visuals field, averages and counts and analyze changing for cell migration ability
Become.
Cell migration assay result as illustrated in fig. 12, transfect pLKO.1-LAMB1-sh1 after, A2780/Taxol experimental groups
The cell quantity that cell is penetrated with negative control group is 48 ± 12 and 277 ± 42 respectively, and both have notable significant difference (P <
0.05);The result shows, after specific inhibition LAMB1 expression, can substantially suppress the migration of tumour cell.
7th, Transwell testing inspections cell invasion ability
The matrigel of -20 DEG C of preservations is first liquefied in 4 DEG C of rewarmings, takes matrigel with OPTI-MEM with 1:6 mix on ice it is dilute
Release, be coated with the upper chamber face of cell bottom film, 37 DEG C of solidification 30min, the liquid of the small indoor precipitation of absorption.Matrigel coating after remaining
Step is same as above, and each cell counts 10 visuals field, is averaged and is counted and analyze the change of cell invasion ability.
As shown in Figure 12 B, A2780/Taxol experimental groups penetrate the thin of cell to cell invasion experimental result with negative control group
Born of the same parents' quantity is 39 ± 10 and 175 ± 39 respectively, and both have significant difference (P < 0.05);The result shows, specific inhibition
After LAMB1 expression, tumor cell invasion can be significantly inhibited.
To the reverse effect of ovarian cancer drug-resistant after embodiment 6.pLKO.1-LAMB1-sh1 specific inhibitions LAMB1 expression
First, experiment packet:
1.A2780 normal groups (do not transfect any carrier), hereinafter referred to as A;
2.A2780/Taxol normal groups (do not transfect any carrier), hereinafter referred to as AR;
3.A2780/Taxol negative control groups (transfection pLKO.1puro empty carriers), hereinafter referred to as AR-N;
4.A2780/Taxol experimental groups (transfection pLKO.1-LAMB1-sh1), hereinafter referred to as AR-sh1.
2nd, packet transfection
Transfection procedure is the same, continues to cultivate cell 24h after transfection.
3rd, detection of the cell to paclitaxel-sensitive after transfection pLKO.1-LAMB1-sh1
Each group is taken the logarithm growth period cell, and cell is resuspended after pancreatin digestion, cell count and the density for adjusting cell suspension
For 1 × 105/ ml, it is inoculated into 96 orifice plates and continues to cultivate 24h.Next day, taxol is added in each group, concentration gradient is set respectively
200ug/ml, 100ug/ml, 50ug/ml, 25ug/ml, 12.5ug/ml, 6.25ug/ml, 3.125ug/ml, 0ug/ml, effect
After 24h, absorbance (A) is surveyed in wavelength 370nm (reference wavelength 492nm) with bromine mark method, calculates suppression of the taxol to every group of cell
Rate processed, inhibiting rate=AExperimental group/ANegative control group.Each concentration sets 3 multiple holes, averages.
Drug concentration when inhibiting rate is 50% is half-inhibition concentration (IC50);
Persister A2780/Taxol IC50With its parental cell strain A2780 IC50Ratio be resistance multiple
(Resistant Folder,RF);
Persister A2780/Taxol IC50The IC after pLKO.1-LAMB1-sh1 (reversal agent) is transfected with it50Ratio
For drug resistance inversion index (Reversal Index, RI).
As a result as shown in table 2, table 3, Figure 13, ICs of the A2780/Taxol to taxol50(37.17 ± 5.47ug/ml) is notable
IC higher than parent A2780 to taxol50(1.27 ± 0.28ug/ml), resistance multiple are up to 29.27, prompt A2780/Taxol
Parental cell A2780, height resistance are substantially less than to the sensitiveness of taxol.And as A2780/Taxol transfections pLKO.1-
After LAMB1-sh1, the sensitiveness of taxol is significantly improved (2.36 ± 0.77ug/ml), transfects pLKO.1-LAMB1-sh1
To the reversing effects of A2780/Taxol taxol resistances clearly, it is 15.28 to reverse index.
Drug susceptibilities of the table 2.A2780 and A2780/Taxol to taxol
Table 3. transfects reverses of the A2780/Taxol to taxol drug sensitiveness after pLKO.1-LAMB1-sh1
SEQUENCE LISTING
<110>Zhejiang University
<120>Specificity suppresses siRNA and its recombinant vector and the application of LAMB1 gene expressions
<130>
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> RNA
<213>Artificial sequence
<400> 1
uguuugaaag ccgaaucugc g 21
<210> 2
<211> 21
<212> RNA
<213>Artificial sequence
<400> 2
cagauucggc uuucaaacaa a 21
<210> 3
<211> 21
<212> RNA
<213>Artificial sequence
<400> 3
uaugagauga guaaaaugga a 21
<210> 4
<211> 21
<212> RNA
<213>Artificial sequence
<400> 4
ccauuuuacu caucucauaa u 21
<210> 5
<211> 21
<212> RNA
<213>Artificial sequence
<400> 5
uaugucaucg acuuuuuuca u 21
<210> 6
<211> 21
<212> RNA
<213>Artificial sequence
<400> 6
gaaaaaaguc gaugacauaa u 21
<210> 7
<211> 71
<212> DNA
<213>Artificial sequence
<400> 7
ccggtttgtt tgaaagccga atctgcgttc aagagacgca gattcggctt tcaaacaaat 60
tttttggtac c 71
<210> 8
<211> 71
<212> DNA
<213>Artificial sequence
<400> 8
aattggtacc aaaaaatttg tttgaaagcc gaatctgcgt ctcttgaacg cagattcggc 60
tttcaaacaa a 71
Claims (10)
1. specificity suppresses the siRNA of LAMB1 gene expressions, including positive-sense strand and antisense strand, it is characterised in that the positive-sense strand
Nucleotide sequence as shown in SEQ ID NO.1, the nucleotide sequence of antisense strand is as shown in SEQ ID NO.2.
2. siRNA as claimed in claim 1, it is characterised in that 3 bases at the positive-sense strand and the 5 ' of antisense strand and 3 ' ends
Carry out the modification of 2 '-methoxyl group.
3. applications of the siRNA as claimed in claim 1 or 2 in LAMB1 gene expression inhibitors are prepared.
4. siRNA as claimed in claim 1 or 2 is preparing treatment oophoroma, hepatocellular carcinoma, colorectal cancer, malignant nerve glue
Application in matter knurl, prostate cancer or gastric cancer medicament.
5. applications of the siRNA as claimed in claim 1 or 2 in the medicine for reversing oophoroma taxol resistance is prepared.
A kind of 6. rnai reagent box for including the DNA sequence dna for encoding siRNA as claimed in claim 1.
A kind of 7. recombinant vector containing the DNA sequence dna for encoding siRNA as claimed in claim 1.
8. application of the recombinant vector as claimed in claim 7 in LAMB1 gene expression inhibitors are prepared.
9. recombinant vector as claimed in claim 7 is preparing treatment oophoroma, hepatocellular carcinoma, colorectal cancer, malignant nerve glue
Application in matter knurl, prostate cancer or gastric cancer medicament.
10. application of the recombinant vector as claimed in claim 7 in the medicine for reversing oophoroma taxol resistance is prepared.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710598070.5A CN107354157B (en) | 2017-07-20 | 2017-07-20 | siRNA for specifically inhibiting LAMB1 gene expression, recombinant vector and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710598070.5A CN107354157B (en) | 2017-07-20 | 2017-07-20 | siRNA for specifically inhibiting LAMB1 gene expression, recombinant vector and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107354157A true CN107354157A (en) | 2017-11-17 |
CN107354157B CN107354157B (en) | 2020-05-19 |
Family
ID=60285800
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710598070.5A Expired - Fee Related CN107354157B (en) | 2017-07-20 | 2017-07-20 | siRNA for specifically inhibiting LAMB1 gene expression, recombinant vector and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107354157B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110123828A (en) * | 2018-02-09 | 2019-08-16 | 复旦大学附属金山医院 | Application of the inhibitor of PRALR in the drug that resistance to taxol oophoroma is treated in preparation |
WO2020014618A1 (en) * | 2018-07-13 | 2020-01-16 | Lonza Ltd | Methods for improving production of biological products by reducing the level of endogenous protein |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009075566A1 (en) * | 2007-12-12 | 2009-06-18 | Erasmus University Medical Center Rotterdam | Biomarkers for cardiovascular disease |
CN101993927A (en) * | 2009-08-10 | 2011-03-30 | 芮屈生物技术(上海)有限公司 | LAMB1 gene in-situ hybridization detection kit and detection method and use thereof |
-
2017
- 2017-07-20 CN CN201710598070.5A patent/CN107354157B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009075566A1 (en) * | 2007-12-12 | 2009-06-18 | Erasmus University Medical Center Rotterdam | Biomarkers for cardiovascular disease |
CN101993927A (en) * | 2009-08-10 | 2011-03-30 | 芮屈生物技术(上海)有限公司 | LAMB1 gene in-situ hybridization detection kit and detection method and use thereof |
Non-Patent Citations (1)
Title |
---|
王毅: "泪腺腺样囊性癌基因表达谱和细胞外基质相关基因的检测及功能研究", 《中国博士学位论文全文数据库(电子期刊)》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110123828A (en) * | 2018-02-09 | 2019-08-16 | 复旦大学附属金山医院 | Application of the inhibitor of PRALR in the drug that resistance to taxol oophoroma is treated in preparation |
CN110123828B (en) * | 2018-02-09 | 2021-11-30 | 复旦大学附属金山医院 | Application of PRALR inhibitor in preparation of medicine for treating paclitaxel-resistant ovarian cancer |
WO2020014618A1 (en) * | 2018-07-13 | 2020-01-16 | Lonza Ltd | Methods for improving production of biological products by reducing the level of endogenous protein |
CN112424339A (en) * | 2018-07-13 | 2021-02-26 | 隆萨有限公司 | Methods for improving production of biological products by reducing endogenous protein levels |
Also Published As
Publication number | Publication date |
---|---|
CN107354157B (en) | 2020-05-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
An et al. | EGFL6 promotes breast cancer by simultaneously enhancing cancer cell metastasis and stimulating tumor angiogenesis | |
Hao et al. | Characterization of distinct populations of carcinoma-associated fibroblasts from non–small cell lung carcinoma reveals a role for ST8SIA2 in cancer cell invasion | |
Shi et al. | High expression of FGFR4 enhances tumor growth and metastasis in nasopharyngeal carcinoma | |
Yuan et al. | SNHG10 promotes cell proliferation and migration in gastric cancer by targeting miR-495-3p/CTNNB1 axis | |
CN104383559A (en) | Expression vector and anti-tumor reagent of long-chain non-coded RNALOC401317, and applications of expression vector and anti-tumor reagent | |
Li et al. | Reduced CENPU expression inhibits lung adenocarcinoma cell proliferation and migration through PI3K/AKT signaling | |
Zhong et al. | Ubiquitin-specific protease 15 contributes to gastric cancer progression by regulating the Wnt/β-catenin signaling pathway | |
Wang et al. | Circ-PRKDC facilitates the progression of colorectal cancer through miR-198/DDR1 regulatory axis | |
Dang et al. | G-protein-signaling modulator 2 expression and role in a CD133+ pancreatic cancer stem cell subset | |
Shi et al. | Increased HSF1 promotes infiltration and metastasis in cervical cancer via enhancing MTDH-VEGF-C expression | |
Park et al. | Follicular stimulating hormone enhances Notch 1 expression in SK-OV-3 ovarian cancer cells | |
CN107354157A (en) | Specificity suppresses siRNA and its recombinant vector and the application of LAMB1 gene expressions | |
CN107287200B (en) | The siRNA and its recombinant vector of specificity inhibition Eya2 gene expression and application | |
Wang et al. | Low Levels of SPARC are associated with tumor progression and poor prognosis in human endometrial carcinoma | |
CN109971851A (en) | Purposes of the MiR-125b-2-3p as the molecular marker of antidiastole different subtypes renal cell carcinomas and its in metastases | |
CN107236736A (en) | Specificity suppresses siRNA and its recombinant vector and the application of the gene expressions of MSI 1 | |
Wang et al. | Reversal of Chemotherapy Resistance to Cisplatin in NSCLC by miRNA-195-5p via Targeting the FGF2 Gene | |
CN107541514A (en) | Specificity suppresses siRNA and its recombinant vector and the application of COL12A1 gene expressions | |
CN107541515A (en) | Specificity suppresses siRNA and its recombinant vector and the application of PRV1 gene expressions | |
CN107254470B (en) | The siRNA and its recombinant vector of specificity inhibition PADI2 gene expression and application | |
Li et al. | Expression and function of HAX-1 in human cutaneous squamous cell carcinoma | |
CN107164378A (en) | Specificity suppresses siRNA and its recombinant vector and the application of SPIB gene expressions | |
CN106282385B (en) | Identification and purposes of the long-chain non-coding RNA XLOC_000090 in lung cancer | |
CN105624159B (en) | A kind of siRNA and its application for people's EDIL3 gene | |
CN105985961A (en) | SiRNA for inhibiting EGFR gene expression and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200519 Termination date: 20210720 |