CN107164457B - High-throughput screening method of broad-spectrum lysozyme - Google Patents
High-throughput screening method of broad-spectrum lysozyme Download PDFInfo
- Publication number
- CN107164457B CN107164457B CN201710284625.9A CN201710284625A CN107164457B CN 107164457 B CN107164457 B CN 107164457B CN 201710284625 A CN201710284625 A CN 201710284625A CN 107164457 B CN107164457 B CN 107164457B
- Authority
- CN
- China
- Prior art keywords
- fluorescent protein
- lysozyme
- protease
- gram
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/40—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving amylase
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/924—Hydrolases (3) acting on glycosyl compounds (3.2)
- G01N2333/936—Hydrolases (3) acting on glycosyl compounds (3.2) acting on beta-1, 4 bonds between N-acetylmuramic acid and 2-acetyl-amino 2-deoxy-D-glucose, e.g. lysozyme
Abstract
The invention relates to a high-throughput screening method of broad-spectrum lysozyme, belonging to the technical field of molecular biology. The method comprises the following steps: a, carrying out secretory expression on a gene mutation library of target lysozyme in eukaryotic cells to obtain fermentation liquor containing different active target lysozyme; b, respectively adding fermentation liquor containing target lysozymes with different activities into a reaction system for reaction, and screening the lysozymes with high bactericidal activity to gram-negative bacteria; wherein, the reaction system comprises: gram-negative bacteria for intracellular expression of 'donor fluorescent protein-recognition site of protease-acceptor fluorescent protein', protease and protease reaction buffer. The screening method provided by the invention has the advantages that the detection sensitivity is obviously improved through the cascade connection of the FRET fluorescent protein pair and the site-specific protease; meanwhile, the method can realize high-flux detection of lysozyme by using a fluorescence microplate reader and a 96 microporous plate.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a high-throughput screening method of broad-spectrum lysozyme.
Background
Lysozyme (lysozyme, EC3.2.1.17), also known as muramidase (muramidase), can specifically hydrolyze peptidoglycan, a main component in prokaryotic bacterial cell walls, decompose microbial cell walls, and make bacteria lose the protection of cell walls and break and die under the action of intracellular high osmotic pressure, thereby achieving the purpose of sterilization. In 1921, the well-known British bacteriologist Alexander Fleming discovered lysozyme in human nasal fluid, which was later confirmed to be widely present in egg white of birds and birds, in various organ tissues and body fluids of mammals, in plants, and in mollusks and insects.
Lysozyme is one of the strongest antibacterial agents in tissues and body fluids of higher organisms, and is an important defense factor for resisting the invasion of exogenous pathogenic bacteria by organisms. For example, human lysozyme is a small-molecule basic globulin which is secreted by epithelial cells and monocyte-macrophages, can recognize and destroy the cell structure of pathogenic bacteria, and attracts leukocytes to concentrate to the infected site through a signal cascade reaction, thereby finally eliminating the pathogenic bacteria infecting the human body. In addition, lysozyme can also be directly combined with negatively charged viral proteins, and DNA-RNA apoproteins form double salts, which inactivate viruses. In plants, such as fresh juice of fig, lysozyme is rich, and is presumed to be closely related to the antiviral effect of plants. On the other hand, lysozyme is also widely present in microorganisms such as various bacteria and bacteriophages. Phage lysozyme is associated with the breakdown of the bacterial cell wall during phage infection. The main function of the bacterial lysozyme is to participate in cell wall-related metabolic processes such as cell growth and division morphological change. Therefore, the bacteria can not generate true resistance to autolysin (autolysin) widely contained in bacteria such as lysozyme, which is of great significance for solving the increasingly serious problem of bacterial drug resistance and reducing the abuse of antibiotics.
Although lysozyme has a strong action, it does not have a good lytic effect against gram-negative bacteria. This is due to the different cell wall composition of bacteria. The cell wall of gram-positive bacteria is mainly composed of peptidoglycan, which has a large number of thick layers and contains a small amount of teichoic acid, while the outer layer of gram-negative bacteria is mainly composed of Lipopolysaccharide (LPS), and the inner layer contains a small amount of peptidoglycan. The main action site of lysozyme is peptidoglycan in cell walls, which hydrolyzes beta-1, 4 glycosidic bonds, so the action effect of lysozyme on gram-negative bacteria is not ideal.
In daily life, many pathogenic bacteria such as escherichia coli, pseudomonas aeruginosa, pneumonia bacillus, dysentery bacillus, perfringens bacillus and the like which people contact belong to gram-negative bacteria. In order to obtain lysozyme with high bactericidal activity to gram-negative bacteria, the lysozyme can be subjected to directed evolution, a lysozyme gene random mutation library is constructed, and lysozyme with strong bactericidal effect to gram-negative bacteria is screened out.
In the directional transformation process, on one hand, the required mutant library is huge in quantity, and a high-throughput method is adopted to improve the screening efficiency; on the other hand, lysozyme has poor lysis effect on gram-negative bacteria, and a screening means which is sensitive in measurement index and can effectively reflect the lysis effect is required. The existing screening methods such as a flat plate bacteriostatic ring method, an oxford cup method and the like cannot well meet the two requirements. Therefore, it is highly desirable to construct a sensitive, reliable and easy-to-operate high-throughput screening method for screening broad-spectrum lysozyme mutants.
Disclosure of Invention
The technical problem to be solved by the invention is to provide a high-throughput screening method of broad-spectrum lysozyme aiming at the defects of the prior art, the method improves the detection sensitivity by the cascade use of FRET fluorescent protein and site-specific protease, and simultaneously, the high-throughput detection of the lysozyme can be realized by utilizing a fluorescent microplate reader and a 96 microporous plate.
Therefore, the invention provides a high-throughput screening method of broad-spectrum lysozyme, which comprises the following steps:
a, carrying out secretory expression on a gene mutation library of target lysozyme in eukaryotic cells to obtain fermentation liquor containing different active target lysozyme;
b, respectively adding fermentation liquor containing target lysozymes with different activities into a reaction system for reaction, and screening the lysozymes with high bactericidal activity to gram-negative bacteria;
wherein the reaction system comprises: gram-negative bacteria for intracellular expression of 'donor fluorescent protein-recognition site of protease-acceptor fluorescent protein', protease and protease reaction buffer.
In the invention, the bactericidal activity of lysozyme in fermentation liquor on gram-negative bacteria is judged according to the signal intensity increase speed of donor fluorescent protein in the reaction process; specifically, the faster the signal intensity of the donor fluorescent protein increases during the reaction, the higher the bactericidal activity of lysozyme in the fermentation broth against gram-negative bacteria.
In some embodiments of the invention, the protease is a recognition sequence-specific protease; in some embodiments of the invention, the protease is TEV protease, enterokinase, or factor Xa; in some preferred embodiments of the invention, the protease is TEV protease.
In other embodiments of the present invention, the amino acid sequence of the recognition site of the TEV protease is: Glu-Asn-Leu-Tyr-Phe-Gln-Gly.
In some embodiments of the invention, the library of mutations in the target lysozyme gene is constructed by error-prone PCR and/or DNA shuffling.
In the present invention, since the emission spectrum of the donor fluorescent protein overlaps with the absorption spectrum of the acceptor fluorescent protein, when the distance between the donor fluorescent protein and the acceptor fluorescent protein is within 10nm, an energy transfer phenomenon occurs, and the energy of the donor fluorescent protein is transferred to the acceptor fluorescent protein, so that the fluorescence intensity of the donor protein is much lower than that when it exists alone, while the fluorescence intensity of the acceptor protein is greatly enhanced.
In some embodiments of the invention, the donor fluorescent protein is a cyan fluorescent protein and the acceptor fluorescent protein is a yellow fluorescent protein.
In some embodiments of the invention, the eukaryotic cell is pichia pastoris.
In other embodiments of the present invention, the method further comprises the steps of:
and C, re-screening the lysozyme with high bactericidal activity to gram-negative bacteria, and verifying the activity of the lysozyme according to the signal intensity increase speed of the donor fluorescent protein in the reaction process.
The invention has the beneficial effects that: the screening method provided by the invention has the advantages that through the cascade connection of the FRET fluorescent protein pair and the site-specific protease, the detection sensitivity is obviously improved by means of detecting a fluorescent signal, positive mutation can be effectively found, and an excellent mutant gene can be found; meanwhile, the method can realize high-flux detection of lysozyme by using a fluorescence microplate reader and a 96 microporous plate.
Detailed Description
In order that the invention may be readily understood, a detailed description of the invention is provided below.
The screening method is based on Fluorescence Resonance Energy Transfer (FRET), namely when two fluorescent protein molecules are extremely close to each other (within 10 nm), if the emission spectrum of donor fluorescent protein is overlapped with the absorption spectrum of acceptor fluorescent protein, the energy transfer phenomenon can occur, the energy of the donor fluorescent protein is transferred to the acceptor fluorescent protein, so that the fluorescence intensity of the donor protein is much lower than that of the donor protein when the donor fluorescent protein exists alone, and the fluorescence intensity of the acceptor protein is greatly enhanced. Taking cyan fluorescent protein and yellow fluorescent protein as examples, the cyan fluorescent protein and the yellow fluorescent protein are a pair of proteins capable of generating FRET effect, wherein the emission spectrum of the cyan protein is overlapped with the absorption spectrum of the yellow protein.
The cyan fluorescent protein and the yellow fluorescent protein are connected by using the recognition site of the protease as a linker sequence, for example, the recognition site of TEV protease is used as a linker sequence, so that the cyan fluorescent protein and the yellow fluorescent protein form a FRET fluorescent protein pair which is very close to each other, namely 'the cyan fluorescent protein-the recognition site of TEV protease-the yellow fluorescent protein'. The recognition site of TEV protease is composed of seven amino acids of Glu-Asn-Leu-Tyr-Phe-Gln-Gly.
Before reaction, under the action of a linker sequence (a recognition site of TEV protease), the cyan fluorescent protein and the yellow fluorescent protein are very close to each other, the energy of the cyan fluorescent protein is transferred to the yellow fluorescent protein, and at the moment, a detection signal shows weak cyan fluorescent signal and strong yellow fluorescent signal; when fermentation liquor containing lysozyme is added into reaction liquid, if the lysozyme has better bactericidal activity on substrate strains (gram-negative bacteria), the bacteria are cracked and internal FRET fluorescent protein pairs are released. The recognition site of TEV protease of the protein pair is specifically recognized and decomposed by TEV protease in the reaction solution to obtain independent cyan fluorescent protein and yellow fluorescent protein, and FRET phenomenon disappears to enhance cyan fluorescent signal. Therefore, the bactericidal activity of lysozyme against gram-negative bacteria can be determined by quantitatively determining the rate of increase in signal intensity of the cyan fluorescent protein.
The high-throughput screening method of the broad-spectrum lysozyme provided by the invention specifically operates as follows:
(1) constructing eukaryotic cells expressing a target lysozyme gene mutation library:
the specific type of the target lysozyme can be selected according to actual needs. The gene sequence of the coding target lysozyme is searched by a nucleic acid database and is subjected to whole-gene synthesis to obtain the gene sequence of the original target lysozyme. The construction of the target lysozyme gene random mutation library is mainly realized by two means of error-prone PCR and DNA shuffling (also called DNA shuffling).
1) The error-prone PCR comprises the following specific operation steps:
designing a primer containing a restriction enzyme site aiming at an original target lysozyme gene sequence, and carrying out error-prone PCR amplification by adjusting the proportion and the reaction conditions of a PCR reaction system, such as changing the concentration of metal ions in the reaction system, increasing the cycle times of the PCR reaction and the like, so that the gene sequence in an error-prone PCR product generates point mutation, thereby causing amino acid change.
2) The specific operation steps of DNA shuffling are as follows:
other lysozyme gene sequences with homology with the original target lysozyme gene are selected, and the number of the lysozyme gene sequences can be selected according to actual needs. Mixing 20 μ l of each gene sequence, adding 0.2U DNaseI, performing enzyme digestion at 16 deg.C for 15min, immediately adding 6 μ l EDTA, transferring to 75 deg.C water bath, and inactivating enzyme for 10 min. And (3) carrying out agarose gel electrophoresis on the mixed system after enzyme digestion, selecting a proper method, and carrying out gel recovery on fragments with required sizes. If the template gene is about 2000bp, cutting the gel block at the position of 100-plus 200bp, and selecting a gel recovery kit for gel recovery; if the template gene is about 1000bp, cutting gel blocks about 50bp, selecting low-melting-point agarose for electrophoresis during the electrophoresis due to small fragment length, dissolving the cut gel blocks in TE solution with 3 times of volume, extracting by phenol chloroform, then carrying out ethanol precipitation, and recovering small fragment DNA.
Taking the recovered fragment DNA as a template of primer-free PCR, carrying out primer-free PCR, and using the principle of gene recombination to make the fragment DNA mutually serve as primers to carry out PCR, wherein the system ratio is as follows: mu.l PFU enzyme, 5. mu.l buffer, 10. mu.l DNTP, 5. mu.l fragment DNA, 29. mu.l ultrapure water, in total, 50. mu.l. The PCR procedure was: 94 ℃ for 5min, 94 ℃ for 30s, 46 ℃ for 1min, 72 ℃ for 30s, 50 cycles, 72 ℃ for 10 min. Wherein the extension time of 72 ℃ is selected according to actual needs. The primer-free PCR product is subjected to agarose gel electrophoresis, and the original fragment with the size of the target lysozyme gene is recovered.
Designing primers containing the same enzyme cutting sites according to several homologous genes, adding the designed primers, and carrying out primer-containing PCR by using the primer-free PCR product in the previous step as a template. And carrying out PCR reaction according to the normal PCR reaction condition and the proportion of a conventional PCR system. And carrying out agarose gel electrophoresis on the PCR product with the primers, and recovering the fragment with the original target lysozyme gene size by using the agarose gel.
Performing double enzyme digestion on the error-prone PCR or DNA reorganized product, performing double enzyme digestion on the expression vector by using the same enzyme, recovering fragments with required sizes through agarose gel electrophoresis, taking 5 mu l of recovered product for electrophoresis again, determining the proportion of the target gene and the expression vector according to the strip brightness, preparing a connecting system, connecting at 16 ℃ overnight, and constructing the recombinant plasmid.
The recombinant plasmid is transferred into Top10 competent cells, then the competent cell suspension transferred with the recombinant plasmid is completely coated on plates, each plate with the diameter of 90mm is coated with 100-. And (3) flushing the grown bacterial strain from the flat plate by using sterile water to form bacterial suspension, recovering the bacterial suspension, and extracting the recombinant plasmid in the bacterial suspension by using the plasmid extraction kit.
Transferring the recombinant plasmid into a eukaryotic competent cell, such as a pichia pastoris competent cell, uniformly coating the eukaryotic competent cell suspension into which the recombinant plasmid is transferred on a flat plate, and standing and culturing to obtain the eukaryotic cell containing the target lysozyme gene mutation library.
(2) Constructing gram-negative bacteria for intracellular expression of 'donor fluorescent protein-recognition site of protease-acceptor fluorescent protein':
the adopted donor fluorescent protein is cyan fluorescent protein, the acceptor fluorescent protein is photochromic fluorescent protein, and the protease is TEV protease;
the gene sequences of cyan fluorescent protein and yellow fluorescent protein are found out through an NCBI database, a recognition site gene of TEV protease is added as an intermediate linker sequence, a 'cyan fluorescent protein-TEV protease recognition site-yellow fluorescent protein' FRET fluorescent protein pair gene sequence with restriction enzyme sites at two ends is designed, and synthesis is carried out artificially. Performing double enzyme digestion on the gene and the gram-negative bacteria intracellular expression vector by using FRET fluorescent protein, recovering fragments after electrophoresis, and connecting to construct a recombinant plasmid.
Introducing the recombinant plasmid into a gram-negative bacterium competent cell, inducing fermentation expression, and identifying FRET fluorescent protein pair by SDS-PAGE to successfully obtain expression in a strain. And centrifuging to collect thalli, discarding supernatant, adding sterile water to resuspend strains, centrifuging again, and adding sterile water to form a bacterial suspension with a specific concentration.
(3) Screening lysozyme with high bactericidal activity to gram-negative bacteria:
transferring the yeast system successfully secreting and expressing the target lysozyme gene mutation library into a 96 deep-well plate filled with a yeast culture medium one by one, and performing induced fermentation in the deep-well plate to obtain a fermentation liquid containing the target lysozyme.
Absorbing 100 mul fermentation liquor in each hole, correspondingly transferring the fermentation liquor into a transparent enzyme label plate hole by hole, adding 100 mul pure water into each hole, uniformly mixing, and measuring the OD of the fermentation liquor in each hole in an enzyme label instrument600The value is obtained.
Adding TEV protease and TEV protease buffer solution into bacterial suspension of gram-negative bacteria for intracellular expression of 'cyan fluorescent protein-recognition site of TEV protease-yellow fluorescent protein', wherein the addition amount is calculated according to the detection amount (in the detection process, 150 mu l of bacterial suspension, 0.8 mu l of TEV protease buffer solution and 0.5 mu l of TEV protease are added into each hole), uniformly mixing to form substrate mixed solution, and adding 151 mu l of substrate mixed solution into each hole of a fluorescent enzyme label plate.
And then adding 50 mul of fermentation liquor into each hole of the fluorescent enzyme label plate (the fermentation liquor is not added into the last two holes, only the substrate mixed liquor is added as negative control), immediately sucking and beating for 1-2 times, then placing the plate into an enzyme label instrument for detection, wherein the excitation wavelength is 433nm, the emission wavelength is 475nm, the detection is carried out once every 1min, the total detection is 45min, after the reaction is carried out for 4h, the detection is carried out for 10min again, and the detection is carried out once every 1 min.
The treatment analysis of the screening index is as follows:
the stability at the start of the reaction was examined by plotting the time (min) on the abscissa and the intensity value of the cyan fluorescence signal on the ordinate 45min before the reaction. If the reaction is stable, i.e. the reaction trend is gradually increased, the average value of the fluorescence signal intensity in the first 10min can be obtained, and the average value in the second 10min after 4h of reaction can be obtained. The difference between the two averages is divided by the OD of the broth per well600Value, i.e. difference in fluorescence signal intensity/OD600(signal intensity increase rate of cyan fluorescent protein), the data is used for sequencing the activity of the mutant lysozyme, and meanwhile, the data of each well is compared with the data of a negative control well. Wherein the faster the increase of the cyan fluorescence signal is and the higher the value of the control well, the higher the bactericidal activity of lysozyme against gram-negative bacteria in the fermentation broth.
And (3) carrying out amplification culture and secondary screening on the screened positive yeast containing lysozyme with high bactericidal activity on gram-negative bacteria, and verifying the activity of the lysozyme according to the signal intensity increase speed of cyan fluorescent protein in the reaction process. Extracting the finally obtained whole genome of the positive yeast, amplifying a target gene and sequencing to obtain a gene sequence of the lysozyme with high gram-negative bacteria bactericidal activity.
The tussah lysozyme gene is optimized by a codon.
Examples
In order that the present invention may be more readily understood, the following detailed description will proceed with reference being made to examples, which are intended to be illustrative only and are not intended to limit the scope of the invention. The starting materials or components used in the present invention may be commercially or conventionally prepared unless otherwise specified.
Example 1: construction of tussah lysozyme gene mutation library
The tussah is a northern economic insect, and the tussah lysozyme (Aplyz) has the characteristics of wide adaptive temperature range, lower optimal temperature and the like, and has good application value. The tussah lysozyme gene sequence and the mature peptide sequence are found in the NCBI database and are 363bp in total, the company carries out whole-gene synthesis, and the synthesized gene sequence is as follows:
AAGTGGTTTACCAAATGTGGTCTAGTGCACGAGCTGAGGAGACAAGGCTTCGACGAGAGCCTAATGAGAGACTGGGTCTGTTTGGTTGAGAACGAAAGCAGCAGATATACTAATAAAATCGGTAAAGTGAATAAGAATGGTTCTCAAGACTACGGTTTGTTCCAGATCAATGACAAATATTGGTGTAGTAAGACCTCCACCCCCGGAAAGGATTGCAATGTGACTTGTAATCAATTGTTGACTGACGATATTACAGTTGCTGCTACCTGTGCGAAGAAGATTTACAAGAGACATAAGTTTAACGCTTGGTACGGATGGTTAAACCACTGTCAACACTCTCTTCCAGACATTAGCGACTGTTAA；
selecting two restriction enzymes of NotI and XhoI according to the gene sequence of expression vector pPICZ alpha A to be connected and the tussah lysozyme, and designing upstream and downstream primers containing enzyme cutting sites, wherein the primer sequences are as follows:
Aplyz-F：TCTACTCGAGAAAAGAAAGTGGTTTACCA
Aplyz-R：TCGCTGACAATTCGCCGGCGTATAT
firstly, normal PCR is carried out, tussah lysozyme gene is amplified, strains are remained after the tussah lysozyme gene is connected with a T carrier, and then an error-prone PCR and DNA shuffling method is selected to construct a genetic mutation library of the tussah lysozyme.
The specific operation steps of error-prone PCR are as follows:
taking tussah lysozyme as a template, adding designed upstream and downstream primers, adjusting the system proportion and the reaction conditions, and carrying out error-prone PCR, wherein the reaction system proportion is as follows:
the PCR reaction conditions were 50 cycles of 94 ℃ pre-denaturation for 3min, 94 ℃ denaturation for 1min, 56 ℃ annealing for 30s, and 72 ℃ extension for 30 s. Electrophoresis is carried out on a 1% agarose gel for 45min, and the result is detected and recorded by a gel imager.
The specific operation steps of DNA shuffling are as follows:
selecting a gene of a human lysozyme gene 4(LYZL4) and a gene of a human lysozyme gene 6(LYZL6) which have homology with the gene sequence of the tussah lysozyme, and carrying out shuffling on tussah lysozyme genes. Wherein, the gene sequence of the human lysozyme gene 4 is as follows:
GAATTCCTCGAGTACATCTTAGGTAGATGTACTGTCGCAAAGAAACTGCATGACGGAGGTCTGGATTACTTCGAAGGATACTCTCTTGAGAATTGGGTGTGCTTGGCCTATTTTGAGTCTAAGTTCAATCCAATGGCCATATATGAAAATACTAGAGAGGGTTATACCGGATTTGGATTGTTTCAGATGAGAGGTAGTGATTGGTGCGGTGACCATGGTAGAAACAGATGTCATATGTCATGTTCCGCATTATTGAACCCAAACCTTGAAAAAACTATTAAGTGCGCTAAAACTATTGTTAAGGGTAAAGAAGGTATGGGTGCTTGGCCTACCTGGTCTAGATATTGTCAATACAGTGATACATTGGCTAGATGGCTAGACGGATGTAAGCTTTAAGCGGCCGC the gene sequence of human lysozyme gene 6 is as follows:
GAATTCCTCGAGTCTTTGATTTCTAGATGCGATTTGGCTCAAGTTTTGCAGTTGGAGGACTTGGACGGTTTCGAGGGTTACTCTTTGTCTGACTGGTTGTGCTTGGCCTTCGTCGAGTCTAAGTTCAACATCTCTAAGATCAACGAGAACGCCGACGGATCTTTCGACTACGGATTGTTCCAGATCAACTCTCACTACTGGTGCAACGACTACAAATCTTACTCTGAGAACTTGTGCCATGTCGATTGCCAGGACTTGTTGAACCCAAACTTGTTGGCTGGAATCCATTGCGCCAAGAGAATCGTCTCTGGAGCCAGAGGAATGAACAACTGGGTCGAGTGGAGATTGCACTGCTCTGGTAGACCTTTGTTCTATTGGTTGACCGGTTGCAGATTGAGATGAGCGGCCGC
designing primers containing the same enzyme cutting sites according to the tussah lysozyme gene sequence, the humanized lysozyme gene 4 gene sequence and the humanized lysozyme gene 6 gene sequence. Primers were designed as follows:
mixing 20 μ l of each of tussah lysozyme gene, humanized lysozyme gene 4 and humanized lysozyme gene 6, adding 6 μ l of DNaseI buffer solution, adding about 0.2U of DNaseI, performing enzyme digestion for 15min, adding 10 μ l of EDTA, and inactivating enzyme at 75 deg.C for 10 min. And (3) carrying out electrophoresis on the mixed system subjected to enzyme digestion for 45min by using 1.5% low-melting-point agarose gel, and detecting and recording the result by using a gel imager.
Selecting a strip with the length of about 50bp, cutting a gel block under an ultraviolet lamp, adding a TE solution with the volume of 3 times, putting the cut gel block into a water bath with the temperature of 70 ℃ until the gel is melted, adding isovolumetric equilibrium phenol for extraction once, centrifuging at 12000rpm for 10min, taking the supernatant, transferring the supernatant into another PE tube, and removing redundant agar. The mixture was extracted once with equal volumes of phenol (chloroform: isoamyl alcohol) (1:1) and chloroform: isoamyl alcohol (24:1), and the supernatant was collected.
Adding total volume of 1/10 sodium acetate (pH5.2), adding three times volume of precooled anhydrous ethanol, mixing, and freezing at-20 deg.C overnight. Taking out the centrifuge tube, placing into a precooled 4 ℃ centrifuge, centrifuging at 13000rpm for 15min at high speed, sucking and removing the supernatant as much as possible, adding 1ml of 75% frozen ethanol into each centrifuge tube, and centrifuging at 13000rpm for 10 min. 1ml of 75% frozen ethanol was added repeatedly and the salt was removed again. Naturally drying at room temperature, adding 13 mu L of deionized water into each of the two centrifuge tubes to dissolve DNA, taking 3 mu L of DNA solution from each centrifuge tube, running electrophoresis to check the ethanol precipitation, and recovering the effect.
Using the recovered small fragment DNA product as template, not adding primer, utilizing homologous recombination to make small fragments mutually be used as template to make primer-free PCR, its system is as follows:
the PCR reaction conditions are pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 46 ℃ for 1min, extension at 72 ℃ for 30s, 50 cycles in total, and final extension at 72 ℃ for 10 min. And (3) carrying out electrophoresis on the primer-free PCR product for 45min by using 1% agarose gel, detecting and recording the result by using a gel imager, and recovering DNA (deoxyribonucleic acid) with about 400bp by using a gel recovery kit. In order to increase the richness of the fragment, DNaseI can be used again for enzyme digestion and primer PCR can be carried out, and the DNA fragment can be recovered again.
The primer-free PCR product is used as a template, the six primers are added, and the primer-containing PCR is carried out, wherein the system is as follows:
the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 1min, annealing at 55.5 ℃ for 30s, extension at 72 ℃ for 30s, 33 cycles total, and final extension at 72 ℃ for 10 min. And (3) carrying out electrophoresis on the amplification product by using 1% agarose gel for 45min, detecting and recording the result by using a gel imager, and recovering the DNA at about 400bp by using a gel recovery kit.
Selecting NotI and XhoI restriction enzymes, and carrying out double enzyme digestion on error-prone PCR products, DNA reorganization products and expression plasmid pPICZ alpha A. And (3) carrying out electrophoresis on the system after double enzyme digestion, recovering fragments with required sizes, carrying out electrophoresis on the gel recovery product again, judging the concentration ratio according to the strip brightness, and connecting the target gene and the expression plasmid overnight to form the recombinant expression plasmid.
Transferring the recombinant plasmid into Top10 competent cells, then spreading the competent cell suspension transferred with the recombinant plasmid on plates, spreading 100-. And (3) flushing the grown bacterial strain from the flat plate by using sterile water to form bacterial suspension, recovering the bacterial suspension, and extracting the recombinant plasmid in the bacterial suspension by using the plasmid extraction kit.
Example 2: transferring the recombinant expression plasmid into pichia pastoris cell
The pichia pastoris expression system is a good eukaryotic expression system, and good extracellular expression can be realized by combining pPICZ alpha A expression plasmids.
The preparation method of the pichia pastoris competent cell comprises the following specific operation steps:
(1) pichia pastoris GS115 on YPDS plates was picked up and inoculated in 10ml YPD liquid medium, sealed with 6 layers of gauze for ensuring ventilation, and cultured overnight at 30 ℃ and 250 rpm.
(2) Transferred to a 250ml baffled Erlenmeyer flask containing 50ml YPD liquid medium at 1% inoculum size. Shaking and culturing at 30 deg.C and 250rpm for about 20h to OD600Is 1.3-1.5.
(3) Transferring the bacterial liquid into a pre-cooled 50ml centrifuge tube, carrying out ice bath for at least 30min to fully cool the cells, centrifuging at 4 ℃ and 4000rpm for 5min, and collecting the cells.
(4) The supernatant was carefully discarded, and the cells were resuspended in 50ml of ice-chilled sterile deionized water, centrifuged at 4000rpm for 5min at 4 ℃.
(5) The cells were resuspended again in 25ml of ice-cold sterile deionized water.
(6) The supernatant was carefully discarded, and the cell biomass was resuspended in 5ml of ice-chilled 1mol/L sorbitol solution, centrifuged at 4000rpm for 5min at 4 ℃.
(7) The supernatant was carefully discarded, and the cells were resuspended in 1ml of sorbitol and dispensed 80. mu.L/tube for further use.
The specific steps of electrically transforming the recombinant plasmid into pichia pastoris GS115 competent cells are as follows:
(1) mu.L of the linearized recombinant plasmid pPICZ alpha A-ApLyz was added to 80. mu.L of Pichia pastoris GS115 competent cells and precooled on ice for 10 min.
(2) The voltage of the electric converter was adjusted to 1.5 kV.
(3) And adding the mixed solution subjected to ice bath into a 0.2cm precooled electric rotating cup, slightly buckling for a few times to ensure that the mixed solution is precipitated at the bottom of the electric rotating cup, and slightly wiping off water outside the electric rotating cup.
(4) And (3) putting the electric rotor cup into an electric rotor instrument, wherein the electric shock time is about 5.0ms, and immediately adding 1ml of precooled 1mol/L sorbitol solution after the electric shock is finished.
(5) Transferring the electrically shocked bacterial liquid into a sterile centrifuge tube, performing static culture at 30 ℃ for 1h, adding 500 mu L YPD liquid culture medium, gently mixing uniformly, and continuing to perform static recovery for 1 h.
(6) Resuscitating fluid was applied to YPDS screening plates containing a lower concentration of Zeocin resistance (100. mu.g/ml) and 200. mu.L of each plate, and all resuscitating fluid was applied.
(7) Standing and culturing at constant temperature of 30 ℃ for 48 h.
Example 3: construction of Escherichia coli for intracellular expression of recognition site of cyan fluorescent protein-TEV protease-yellow fluorescent protein
Escherichia coli is a typical gram-negative bacterium, is convenient to obtain, easy to operate and culture, the cell wall of the Escherichia coli has a lipopolysaccharide outer membrane, and the lysozyme has a poor cracking effect on the Escherichia coli.
Synthesizing a cyan fluorescent protein-TEV protease recognition site-yellow fluorescent protein gene sequence with XhoI and NocI enzyme cutting sites at two ends according to the fluorescent protein gene and TEV protease recognition site gene sequences found in the NCBI database. The cloning plasmid containing the protein pair gene and the expression plasmid pET28a are respectively subjected to double enzyme digestion by two restriction enzymes, and the required fragment is recovered by electrophoresis. And (3) preparing a connecting system, connecting the fluorescent protein pair gene with an expression plasmid pET28a overnight, and constructing a recombinant expression plasmid.
Taking out BL21(DE3) competent cells, melting the competent cells on ice for 1-2min, adding the overnight connection system into the competent cells, carrying out ice bath for 30min, transferring the competent cells into water bath at 42 ℃ for 90s, immediately transferring the competent cells into ice for 2-3min, adding 900 mu l of LB culture medium into each tube, and recovering the competent cells at 37 ℃ and 200rpm for 1 h. The recovered bacterial suspension was pipetted 100. mu.l and spread on LB plate containing kanamycin.
Utilizing a pET28a universal primer to carry out colony PCR amplification on a colony growing on a flat plate, verifying escherichia coli successfully transferred into a plasmid, and then carrying out fermentation, wherein the fermentation specific steps are as follows:
1) the Escherichia coli successfully transferred into the recombinant expression plasmid is transferred into 50ml LB liquid medium (conical flask, 250ml specification) containing a proper amount of kanamycin, and is subjected to shake cultivation at 37 ℃ until OD is reached600Is between 0.4 and 1, preferably 0.6, for about 3 hours.
2) 0.5ml of the prepared IPTG (100 mM) was added to a set of medium at a working concentration of 1mM (since pET28a contains the T7 lac promoter, if the other plasmid contains the T7 promoter, the working concentration of IPTG was diluted to 0.4 mM); another group of media was not IPTG added as a control and the two groups were continued for 3h shaking culture.
3) Placing the conical flask on ice for 5min, centrifuging at 4 deg.C 5000 Xg for 5min, discarding supernatant, re-suspending the strain with precooled sterile water (1/4 container volume), centrifuging again, and centrifuging at 4 deg.C 5000 Xg for 5 min.
4) Sterile water resuspends the strains.
Example 4: screening Antheraea pernyi lysozyme with high bactericidal activity to Escherichia coli
Selecting Pichia pastoris with lysozyme gene grown on YPD plate into 96 deep-well plate filled with 1ml BMGY culture medium, selecting one strain into one well, culturing for 3 days, centrifuging at 4000rpm for 20min, discarding supernatant, adding 1ml BMMY culture medium into each well, adding 20 mul methanol into each well every 24h for induction fermentation expression, and stopping fermentation after fermentation for 72 h.
Sucking 100 mul of the expressed fermentation liquor per hole, transferring the hole into a transparent normal 96-hole plate correspondingly, adding 100 mul of water into each hole, blowing, uniformly mixing, placing into an enzyme labeling instrument, and measuring OD600The value is obtained.
Adding TEV protease and TEV protease buffer solution into the Escherichia coli bacterial suspension for intracellular expression of fluorescent protein pairs, calculating the addition amount according to the detection amount (during detection, 150 mul of bacterial suspension, 0.8 mul of TEV protease buffer solution and 0.5 mul of TEV protease are added into each hole), mixing to form substrate mixed solution, and adding 151 mul of substrate mixed solution into each hole of a black 96-hole plate.
Adding 50 μ l of fermentation liquid into each hole of a black 96-well plate (no fermentation liquid is added into the last two holes, only substrate mixed liquid is added as negative control), immediately sucking for 1-2 times, placing into an enzyme-labeling instrument for detection, wherein the excitation wavelength is 433nm, the emission wavelength is 475nm, the detection is carried out every 1min, the total detection is 45min, and after reaction for 4h, the detection is carried out for 10min again, and the detection is carried out every 1 min.
After detection, the data are analyzed and processed by the method to obtain the yeast strain containing the lysozyme with high bactericidal activity to the escherichia coli, the strain is subjected to enlarged culture, induced fermentation and re-screening, and the data are analyzed and processed by the method to verify the activity of the yeast strain. Extracting the finally obtained whole genome of the positive yeast, amplifying a target gene and sequencing to obtain a gene sequence of the lysozyme with high gram-negative bacteria bactericidal activity.
It should be noted that the above-mentioned embodiments are only for explaining the present invention, and do not constitute any limitation to the present invention. The present invention has been described with reference to exemplary embodiments, but the words which have been used herein are words of description and illustration, rather than words of limitation. The invention can be modified, as prescribed, within the scope of the claims and without departing from the scope and spirit of the invention. Although the invention has been described herein with reference to particular means, materials and embodiments, the invention is not intended to be limited to the particulars disclosed herein, but rather extends to all other methods and applications having the same functionality.
Claims (9)
1. A high-throughput screening method of broad-spectrum lysozyme comprises the following steps:
a, carrying out secretory expression on a gene mutation library of target lysozyme in eukaryotic cells to obtain fermentation liquor containing different active target lysozyme;
b, respectively adding fermentation liquor containing target lysozymes with different activities into a reaction system for reaction, and screening the lysozymes with high bactericidal activity to gram-negative bacteria;
wherein the reaction system comprises: gram-negative bacteria for intracellular expression of 'donor fluorescent protein-recognition site of protease-acceptor fluorescent protein', protease and protease reaction buffer solution; the distance between the donor fluorescent protein and the acceptor fluorescent protein is within 10 nm;
according to the signal intensity increase speed of donor fluorescent protein in the reaction process, judging the bactericidal activity of lysozyme in the fermentation liquor on gram-negative bacteria;
the protease is a protease with recognition sequence specificity.
2. The method of claim 1, wherein the protease is TEV protease, enterokinase, or factor Xa.
3. The method of claim 2, wherein said protease is TEV protease.
4. The method of claim 2, wherein the amino acid sequence of the TEV protease recognition site is: Glu-Asn-Leu-Tyr-Phe-Gln-Gly.
5. The method according to claim 1, wherein the library of mutations in the lysozyme gene of interest is constructed by error-prone PCR and/or DNA shuffling.
6. The method of claim 1, wherein the energy of the donor fluorescent protein is transferred to the acceptor fluorescent protein when the distance between the donor fluorescent protein and the acceptor fluorescent protein is within 10 nm.
7. The method of claim 6, wherein the donor fluorescent protein is cyan fluorescent protein and the acceptor fluorescent protein is yellow fluorescent protein.
8. The method of claim 1, wherein the eukaryotic cell is pichia pastoris.
9. The method according to claim 1, characterized in that the method further comprises the steps of:
and C, re-screening the lysozyme with high bactericidal activity to gram-negative bacteria, and verifying the activity of the lysozyme according to the signal intensity increase speed of the donor fluorescent protein in the reaction process.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710284625.9A CN107164457B (en) | 2017-04-26 | 2017-04-26 | High-throughput screening method of broad-spectrum lysozyme |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710284625.9A CN107164457B (en) | 2017-04-26 | 2017-04-26 | High-throughput screening method of broad-spectrum lysozyme |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107164457A CN107164457A (en) | 2017-09-15 |
| CN107164457B true CN107164457B (en) | 2021-01-26 |
Family
ID=59813247
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710284625.9A Active CN107164457B (en) | 2017-04-26 | 2017-04-26 | High-throughput screening method of broad-spectrum lysozyme |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107164457B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113846076A (en) * | 2021-08-23 | 2021-12-28 | 青岛农业大学 | Screening method of lysozyme with escherichia coli cracking capability and antibiotic |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1088233A2 (en) * | 1998-06-16 | 2001-04-04 | Biosignal Packard Inc. | A bioluminescence resonance energy transfer (bret) system and its use |
| CN1396265A (en) * | 2001-05-24 | 2003-02-12 | 香港科技大学 | Process based on green fluoresin for detecting cell wither |
| JP2003321314A (en) * | 2002-02-28 | 2003-11-11 | Pharmafoods Kenkyusho:Kk | Antibacterial composition, its manufacturing method and antibacterial agent containing antibacterial composition |
| CN101037710A (en) * | 2006-12-27 | 2007-09-19 | 华中科技大学 | Polynucleotide sequence for detecting matrix metal proteinase activity |
| CN105861468A (en) * | 2016-06-07 | 2016-08-17 | 江南大学 | Method for improving antibacterial property of pig lysozyme by fusing N-terminal with HLH functional domain |
| CN106011110A (en) * | 2016-06-23 | 2016-10-12 | 浙江工商大学 | Lysozyme with covalent modification through acyl-free sophorolipid derivatives and modifying method and application of lysozyme |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007135367A2 (en) * | 2006-05-19 | 2007-11-29 | University Of Sheffield | Screen for inflammatory response molulators |
-
2017
- 2017-04-26 CN CN201710284625.9A patent/CN107164457B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1088233A2 (en) * | 1998-06-16 | 2001-04-04 | Biosignal Packard Inc. | A bioluminescence resonance energy transfer (bret) system and its use |
| CN1396265A (en) * | 2001-05-24 | 2003-02-12 | 香港科技大学 | Process based on green fluoresin for detecting cell wither |
| JP2003321314A (en) * | 2002-02-28 | 2003-11-11 | Pharmafoods Kenkyusho:Kk | Antibacterial composition, its manufacturing method and antibacterial agent containing antibacterial composition |
| CN101037710A (en) * | 2006-12-27 | 2007-09-19 | 华中科技大学 | Polynucleotide sequence for detecting matrix metal proteinase activity |
| CN105861468A (en) * | 2016-06-07 | 2016-08-17 | 江南大学 | Method for improving antibacterial property of pig lysozyme by fusing N-terminal with HLH functional domain |
| CN106011110A (en) * | 2016-06-23 | 2016-10-12 | 浙江工商大学 | Lysozyme with covalent modification through acyl-free sophorolipid derivatives and modifying method and application of lysozyme |
Non-Patent Citations (4)
| Title |
|---|
| Delineation of an evolutionary salvage pathway by compensatory mutations of a defective lysozyme;Jucovic, M等;《PROTEIN SCIENCE》;19981031;第7卷(第10期);第2200-2209页 * |
| FRET-based and other fluorescent proteinase probes;Hu, Hai-Yu等;《BIOTECHNOLOGY JOURNAL》;20140228;第9卷(第2期);第266-281页 * |
| 应用荧光分析法检测酶的研究进展;邢艳珑等;《生物工程学报》;20091225;第25卷(第12期);第1765-1769页 * |
| 柞蚕溶菌酶真核表达系统的构建及重组蛋白纯化分析;续丹丹等;《饲料研究》;20160523(第10期);第31-37页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107164457A (en) | 2017-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2013087043A1 (en) | Flavobacterium strain, endo-alginate lyase encoding gene, and preparation and use of said gene | |
| CN108531663A (en) | The universal detection primers of Ana 1 aviadenovirus DAdV-3 and DAdV-A and its application | |
| CN107099545A (en) | A kind of alginate lyase gene and its application | |
| CN112430615A (en) | Chitosanase gene csnbaa, chitosanase, preparation method and application thereof | |
| CN102617724B (en) | A kind of porcine defensin pBD1 polypeptide and applying in suppression pig pathogenic bacteria | |
| CN107164457B (en) | High-throughput screening method of broad-spectrum lysozyme | |
| CN116333957A (en) | Recombinant bacillus for displaying streptococcus suis prophage lyase, construction method and application thereof | |
| CN112011525A (en) | Depolymerizing enzyme with capability of degrading K64 capsule type Klebsiella pneumoniae extracellular polymer | |
| CN110643622A (en) | Alginate lyase gene and application thereof | |
| CN110616227A (en) | Gene, recombinant expression vector, engineering strain and application of anti-freeze protein from tenebrio molitor | |
| CN112852794B (en) | Clostridium perfringens bacteriophage lyase and application thereof | |
| CN111378638A (en) | Helicobacter pylori phage lyase and preparation method thereof | |
| CN109609485B (en) | Chitin deacetylase and application thereof | |
| CN111440781A (en) | Depolymerizing enzyme with capacity of degrading extracellular polymers of Klebsiella pneumoniae | |
| CN111334488A (en) | Laminarin enzyme OUC-L1, and coding gene and application thereof | |
| CN112813058B (en) | Vibrio parahaemolyticus lyase, coding gene thereof and application thereof | |
| CN101985607B (en) | Pseudoalteromonas sp. and application thereof | |
| CN112457413B (en) | Method for fusion expression of antibacterial peptide by using SUMO | |
| CN111117941B (en) | Brucella strain IalB gene deletion strain as well as construction method and application thereof | |
| CN103319590B (en) | Application of Chlamys farreri peptidoglycan recognition protein (CfPGRP-S1) | |
| CN108823193B (en) | Efficient streptococcus pneumoniae chimeric lyase, and mutant and application thereof | |
| CN102719440B (en) | Haliotis gigantea discus hemocyanin I and II type subunit genes and cloning method | |
| KR100877962B1 (en) | Recombinant plasmid vector, serratia marcescens recombinant bacteria transformed by the recombinant plasmid vector and lipase manufacturing methed using thereof | |
| CN111363690A (en) | Bdellovibrio bacteriovorus mutant strain with strong cracking performance and application thereof | |
| CN111363689B (en) | Bdellovibrio bacteriovorus mutant strain with strong cracking performance and wide cracking spectrum and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |