CN107164457A

CN107164457A - A kind of high-throughput screening method of New-type wide-spectrum lysozyme

Info

Publication number: CN107164457A
Application number: CN201710284625.9A
Authority: CN
Inventors: 温赛; 刘怀然; 茅同心
Original assignee: Beijing Technology and Business University
Current assignee: Beijing Technology and Business University
Priority date: 2017-04-26
Filing date: 2017-04-26
Publication date: 2017-09-15
Anticipated expiration: 2037-04-26
Also published as: CN107164457B

Abstract

The present invention relates to a kind of high-throughput screening method of New-type wide-spectrum lysozyme of technical field of molecular biology.This method comprises the following steps：A, secreting, expressing is carried out by the gene mutation library of target lysozyme in eukaryotic, obtains the zymotic fluid of the lysozyme of target containing different activities；B, the zymotic fluid of the lysozyme of target containing different activities is added separately to be reacted in reaction system, filters out the lysozyme high to Gram-negative bacteria bactericidal activity；Wherein, reaction system includes：Gram-negative bacteria, protease and the mmp reaction buffer solution of intracellular expression " the recognition site acceptor fluorescent protein of donor fluorescent protein enzyme ".Screening technique of the present invention significantly improves the sensitivity of detection by the cascade of FRET fluorescins pair and site-specific protease；This method can realize the high flux detection of lysozyme using fluorescence microplate reader and 96 microwell plates simultaneously.

Description

A kind of high-throughput screening method of New-type wide-spectrum lysozyme

Technical field

The invention belongs to technical field of molecular biology, and in particular to a kind of high flux screening side of New-type wide-spectrum lysozyme Method.

Background technology

Lysozyme (lysozyme, EC3.2.1.17) is also known as muramidase (muramidase), can specific for hydrolysis protokaryon Main component peptide glycan in bacteria cell wall, decomposes the cell membrane of microorganism, bacterium is lost the protection of cell membrane and in born of the same parents Death is ruptured in the presence of interior hyperosmosis, so as to reach sterilization purpose.Nineteen twenty-one, famous Britain bacteriologist Alexander Fleming is found that lysozyme in the nose liquid of people, and rear confirmation lysozyme is widely present in the egg white of birds and birds, lactation In each organ-tissue and body fluid of animal, in plant and mollusk and insect bodies.

Lysozyme, as one of antiseptic most powerful in higher organisms tissue and body fluid, is living organism confrontation external source The important defense factor of pathogen invasion and attack.If human lysozyme is a kind of Small-molecule basic globulin, it by epithelial cell and monokaryon- Macrophages secrete, can recognize that and destroy the eucaryotic cell structure of pathogen, and attract leucocyte to focus on by signal cascade reaction Infection site, it is final to eliminate the pathogen for infecting human body.In addition, lysozyme can also directly be tied with negatively charged virus protein Close, and DNA-RNA apoproteins formation double salt, make virally inactivated.In plant, containing abundant in such as fresh juice of fig Lysozyme, thus it is speculated that its antivirus action substantial connection with plant.On the other hand, lysozyme is also widely present in microorganism In, such as various bacteriums and bacteriophage.Phage lysozyme is relevant with the decomposition of bacteria cell wall during Phage Infection.Bacterium The major function of lysozyme is to participate in the metabolic processes related to cell membrane such as cell division morphologic change.Therefore, bacterium Repellence truly will not be produced, this is right to the autolysin (autolysin) that contains extensively in this bacterium of lysozyme In solving increasingly serious bacterial resistance sex chromosome mosaicism, abuse of antibiotics is reduced significant.

Although the powerful of lysozyme, its lytic effect to Gram-negative bacteria is simultaneously bad.This is due to bacterium Cell membrane is constituted caused by difference.The cell membrane of gram-positive bacteria is mainly made up of peptide glycan, the peptide glycan number of plies it is more and Thicker, containing a small amount of LTA, and Gram-negative bacteria outer layer is mainly made up of lipopolysaccharides (LPS), and internal layer just contains a small amount of peptide Glycan.And the main function site of lysozyme is the peptide glycan in cell membrane, β-Isosorbide-5-Nitrae glycosidic bond is hydrolyzed, therefore it is for gram The action effect of negative bacterium is less desirable.

Among daily life, many pathogenic bacteria that people are touched, such as Escherichia coli, pseudomonas aeruginosa, pneumonia Bacillus, shigella dysenteriae and Bacillus perfringens etc., belong to Gram-negative bacteria.In order to obtain that there is height to Gram-negative bacteria The lysozyme of bactericidal activity, can be oriented evolution to lysozyme, build lysozyme gene libraries of random mutants, then therefrom sieve Select the lysozyme stronger to Gram-negative bacteria bactericidal effect.

Orient in conversion process, on the one hand, required mutant library substantial amounts, high throughput method need to be used to improve Screening efficiency；On the other hand, lysozyme is poor to Gram-negative bacteria lytic effect, need to using measurement index it is more sensitive, can be effective Reflect the screening means of lytic effect.And existing screening technique such as flat board inhibition zone method, Odontothrips loti etc., it is impossible to it is same well When meet more than 2 points requirement.Therefore, a kind of sensitive reliable, easy-operating high-throughput screening method of structure is needed badly, for new The screening of wide spectrum bacteriolyze enzyme mutant.

The content of the invention

The technical problems to be solved by the invention are to provide a kind of New-type wide-spectrum lysozyme in view of the shortcomings of the prior art High-throughput screening method, this method is used by the cascade of FRET fluorescins pair and site-specific protease, improves inspection The sensitivity of survey, while the high flux that can realize lysozyme using fluorescence microplate reader and 96 microwell plates is detected.

Therefore, the invention provides a kind of high-throughput screening method of New-type wide-spectrum lysozyme, it comprises the following steps：

A, secreting, expressing is carried out by the gene mutation library of target lysozyme in eukaryotic, obtains mesh containing different activities Mark the zymotic fluid of lysozyme；

B, the zymotic fluid of the lysozyme of target containing different activities is added separately to be reacted in reaction system, is filtered out pair The high lysozyme of Gram-negative bacteria bactericidal activity；

Wherein, the reaction system includes：Intracellular expression " recognition site-acceptor fluorescence of donor fluorescent protein-protein enzyme Gram-negative bacteria, protease and the mmp reaction buffer solution of albumen ".

In the present invention, according to the signal intensity growth rate of donor fluorescent albumen in course of reaction, judge in zymotic fluid Lysozyme to Gram-negative bacteria bactericidal activity；Specifically, the signal intensity growth of donor fluorescent albumen is got in course of reaction It hurry up, the lysozyme in zymotic fluid is higher to Gram-negative bacteria bactericidal activity.

In certain embodiments of the present invention, described protease is with the specific protease of recognition sequence； In some specific embodiments of the present invention, described protease is TEV protease, enterokinase or factor Xa；In the present invention Some preferred embodiments in, described protease is TEV protease.

In other embodiments of the present invention, the amino acid sequence of the recognition site of the TEV protease is：Glu- Asn-Leu-Tyr-Phe-Gln-Gly。

In certain embodiments of the present invention, the construction method of the target lysozyme gene mutated library is fallibility PCR and/or DNA reorganization.

In the present invention, because the emission spectrum of donor fluorescent albumen and the absorption spectrum of acceptor fluorescent protein are overlapping, because This is when the distance between donor fluorescent albumen and acceptor fluorescent protein are when within 10nm, it may occur that energy transfer phenomenon, donor It is much lower when making donor protein fluorescence intensity than its individualism on the energy transfer of fluorescin to acceptor fluorescent protein, And receptor protein fluorescence intensity is greatly enhanced.

In some specific embodiments of the present invention, described donor fluorescent albumen is cyan fluorescent protein, it is described by Body fluorescin is yellow fluorescence protein.

In certain specific embodiments of the invention, the eukaryotic is Pichia pastoris.

In other embodiments of the present invention, methods described is further comprising the steps of：

C, carries out secondary screening to the lysozyme high to Gram-negative bacteria bactericidal activity filtered out, is supplied according in course of reaction The signal intensity growth rate of body fluorescin, verifies the activity of lysozyme.

Beneficial effects of the present invention are：Screening technique of the present invention passes through FRET fluorescins pair and locus specificity egg The cascade of white enzyme, by detection fluorescence signal, significantly improves the sensitivity of detection, can effectively find Positive mutants, find Excellent mutator；This method can realize the high flux detection of lysozyme using fluorescence microplate reader and 96 microwell plates simultaneously.

Embodiment

To be readily appreciated that the present invention, the present invention is described more detail below.

Screening technique of the present invention be based on FRET technology (FRET), i.e., two fluorescent protein molecules away from During from extremely nearly (within 10nm), if the emission spectrum of donor fluorescent albumen is overlapping with the absorption spectrum of acceptor fluorescent protein, Can occur on energy transfer phenomenon, energy transfer to the acceptor fluorescent protein of donor fluorescent albumen, make donor protein fluorescence intensity It is much lower during than its individualism, and receptor protein fluorescence intensity is greatly enhanced.With cyan fluorescent protein and yellow fluorescence egg Exemplified by white, cyan fluorescent protein and yellow fluorescence protein, which are a pair, can occur the albumen of FRET effects, wherein cyan albumen Emission spectrum is overlapping with the absorption spectrum of xanthoprotein.

With the recognition site of protease as linker sequences, for example, using the recognition site conduct of TEV protease Linker sequences connect cyan fluorescent protein and yellow fluorescence protein, make cyan fluorescent protein and yellow fluorescence protein formation away from From extremely near FRET fluorescins pair, i.e. " recognition site-yellow fluorescence protein of cyan fluorescent protein-TEV protease ".TEV The recognition site of protease is made up of Glu-Asn-Leu-Tyr-Phe-Gln-Gly seven amino acids.

Before reaction, due to the effect of linker sequences (recognition site of TEV protease), cyan fluorescent protein and yellow are glimmering Photoprotein distance is extremely near, on energy transfer to the yellow fluorescence protein of cyan fluorescent protein, now detects that cyan is presented in signal glimmering Optical signal is weak, yellow fluorescence signal is strong；Added when by the zymotic fluid of lysozyme in reaction solution, if lysozyme is to substrate strain (Gram-negative bacteria) has preferable bactericidal activity, then the FRET fluorescins pair for cracking and discharging inside occur for bacterium.The egg It is white to TEV protease recognition site is by the TEV protease specific recognition in reaction solution and decomposes, obtain independent cyan Fluorescin and yellow fluorescence protein, FRET phenomenons disappear so that hanced cyan fluorescent signal enhancing.It therefore, it can survey by quantitative The growth rate of cyan fluorescent protein signal intensity is determined, to judge bactericidal activity of the lysozyme to Gram-negative bacteria.

The concrete operations of the high-throughput screening method of New-type wide-spectrum lysozyme involved in the present invention are as follows：

(1) eukaryotic of construction expression target lysozyme gene mutated library：

The specific species of target lysozyme can be selected according to actual needs.The gene order of encoding target lysozyme passes through core Sour database lookup simultaneously carries out full genome synthesis, obtains original object lysozyme gene sequence.Build target lysozyme gene with Machine mutated library is mainly realized by two kinds of means of fallibility PCR and DNA reorganization (also referred to as DNA shuffles).

1) fallibility PCR concrete operation steps are as follows：

Contain the primer of restriction enzyme site for original object lysozyme gene sequences Design, by adjusting PCR reaction systems With when reaction condition, such as change the concentration of metal ion in reaction system, increase PCR reaction cycle number of times, carry out easily Wrong PCR amplifications, make the gene order in fallibility PCR primer occur point mutation, so as to cause amino acid change.

2) DNA reorganization concrete operation step is as follows：

Other lysozyme gene sequences that there is homology with original object lysozyme gene are chosen, number can be according to reality Border needs selected.Every kind of gene order respectively takes 20 μ l to mix, addition 0.2U DNaseI, at 16 DEG C after digestion 15min immediately 6 μ l EDTA are added, 75 DEG C of water-baths, enzyme inactivation 10min are transferred to.Mixed system after digestion is entered into row agarose gel electrophoresis, Suitable method is chosen, the fragment of required size is subjected to glue reclaim.If templet gene is 2000bp or so, 100- is cut Blob of viscose at 200bp, glue reclaim is carried out from glue reclaim kit；If templet gene is 1000bp or so, 50bp or so is cut Locate blob of viscose, low melting-point agarose is chosen because fragment length is small, during electrophoresis and carries out electrophoresis, the blob of viscose cut is dissolved in 3 times of volumes In TE solution, using phenol chloroform, then ethanol precipitation is carried out, reclaim small fragment DNA.

Using the piece segment DNA after recovery as primer free PCR template, primer free PCR is carried out, the original of genetic recombination is utilized Reason, making piece segment DNA, primer enters performing PCR each other, and system proportioning is as follows：1 μ l PFU enzymes, 5 μ lbuffer, 10 μ l DNTP, 5 μ l pieces Segment DNA, 29 μ l ultra-pure waters, totally 50 μ l.PCR programs are：94 DEG C of 5min, 94 DEG C of 30s, 46 DEG C of 1min, 72 DEG C of 30s, 50 circulations, 72℃10min.Wherein 72 DEG C extension of time are selected according to actual needs.Row agarose gel electrophoresis are entered to primer free PCR primer, The fragment of glue reclaim original object lysozyme gene size.

The primer containing identical restriction enzyme site is designed according to several homologous genes, designed primer is added, utilizes upper one Primer free PCR primer is walked as template, progress has primer PCR.Routinely PCR system is matched, and is entered according to normal PCR reaction conditions Performing PCR reacts.There to be primer PCR product to enter row agarose gel electrophoresis again, glue reclaim original object lysozyme gene size Fragment.

Product after fallibility PCR or DNA are reorganized carries out double digestion, and expression vector also is carried out into double enzymes using same enzyme Cut, by agarose gel electrophoresis, size fragment, takes 5 μ l recovery products to carry out electrophoresis again, according to band brightness needed for reclaiming Target gene and expression vector ratio are determined, linked system is prepared, 16 DEG C of connections are stayed overnight, construction recombination plasmid.

Recombinant plasmid is transferred in Top10 competent cells, it is then that the competent cell suspension for being transferred to recombinant plasmid is complete Portion is applied on flat board, and the competent cell suspension that 100-200 μ l are transferred to recombinant plasmid, 37 are coated with each diameter 90mm flat board DEG C culture 16h or so.The bacterial strain grown is swept away from flat board with sterilized water, bacteria suspension is formed, bacteria suspension is reclaimed, using carrying Plasmid kit extracts the recombinant plasmid in bacteria suspension.

Recombinant plasmid is transferred in eucaryote competent cell, for example Pichia pastoris competent cell, restructuring will be transferred to The eucaryote competent cell suspension of plasmid, which is all divided equally, to be applied on flat board, quiescent culture, obtains lysozyme gene containing target The eukaryotic of mutated library.

(2) gram-negative of intracellular expression " recognition site-acceptor fluorescent protein of donor fluorescent protein-protein enzyme " is built Property bacterium：

The donor fluorescent albumen used is cyan fluorescent protein, and acceptor fluorescent protein is photochromic fluorescin, protease For TEV protease；

The gene order of cyan fluorescent protein and yellow fluorescence protein is found out by ncbi database, TEV albumen is added The recognition site gene of enzyme designs " the hanced cyan fluorescent egg that two ends carry restriction enzyme site as middle linker sequences Recognition site-yellow fluorescence protein of in vain-TEV protease " FRET fluorescins are to gene order, by manually being synthesized. FRET fluorescins are carried out to gene and Gram-negative bacteria intracellular expression carrier to reclaim fragment progress after double digestion, electrophoresis Connection, construction recombination plasmid.

Recombinant plasmid is imported in Gram-negative bacterium competence cell, induction fermentation expression is identified by SDS-PAGE FRET fluorescins are expressed in strain success.Thalline is collected by centrifugation, supernatant is abandoned, adds sterilized water and strain is resuspended, then Sterilized water is added after centrifugation, the bacteria suspension with certain concentration is formed it into.

(3) lysozyme high to Gram-negative bacteria bactericidal activity is screened：

Successful secretion is expressed to the yeast system of target lysozyme gene mutated library, is hole-specifically transferred to equipped with yeast culture medium 96 deep-well plates in, carry out induction fermentation in deep-well plates, obtain the zymotic fluid of the lysozyme containing target.

100 μ l zymotic fluids are drawn per hole, and it is hole-specifically accordingly transferred in transparent ELISA Plate, are added per hole 100 μ l pure water, measure the OD of every hole zymotic fluid in ELIASA after mixing₆₀₀Value.

To the Gram-negative of intracellular expression " recognition site-yellow fluorescence protein of cyan fluorescent protein-TEV protease " In the bacteria suspension of bacterium, add TEV protease and TEV protease buffer solution, addition calculated according to needed for detection limit (during detection, 150 μ l bacteria suspensions, 0.8 μ l TEV proteases buffer solutions and 0.5 μ l TEV proteases are added per hole), substrate is formed after mixing and is mixed Liquid is closed, 151 μ l Substrate cocktails are added per hole into fluorescence ELISA Plate.

Then adding 50 μ l zymotic fluids per hole into fluorescence ELISA Plate, (last holes is added without zymotic fluid, only adds substrate Mixed liquor is used as negative control), inhale immediately after beating 1-2 times, be put into ELIASA and detected, excitation wavelength is 433nm, launch Wavelength is 475nm, every 1min detections once, is detected altogether after 45min, reaction 4h, then detects 10min, and one is detected every 1min It is secondary.

The Treatment Analysis of screening index is as follows：

45min is that abscissa, hanced cyan fluorescent signal strength values do figure as ordinate using the time (min) before reaction, and detection is anti- Stability when should start.If stable reaction, i.e. reaction tendency gently rises, then can be in the hope of preceding 10min fluorescence signal intensities Average value, while the average value answered after 4h in 10min of negating.The difference of two average value is again divided by per the OD of hole zymotic fluid₆₀₀Value, That is fluorescence signal intensity difference/OD₆₀₀(the signal intensity growth rate of cyan fluorescent protein), with this data to mutant lysozyme The height of enzyme activity is ranked up, while the data of the data in each hole and negative control hole are compared.Wherein hanced cyan fluorescent is believed Number increase faster and higher than control wells numerical value, represent that the lysozyme in zymotic fluid is higher to Gram-negative bacteria bactericidal activity.

To the positive yeast containing the lysozyme high to Gram-negative bacteria bactericidal activity filtered out be amplified culture and Secondary screening, according to the signal intensity growth rate of cyan fluorescent protein in course of reaction, verifies the activity of lysozyme.Extract final obtain The full-length genome of the positive yeast arrived, amplifying target genes are simultaneously sequenced, and are obtained with high Gram-negative bacteria bactericidal activity New lysozyme gene order.

Heretofore described " tussah lysozyme gene " is the tussah lysozyme gene after codon optimization.

Embodiment

To make the present invention easier to understand, the present invention is further described below in conjunction with embodiment, these realities Apply example only serve it is illustrative, it is not limited to application of the invention.If raw material or component nothing used in the present invention Specified otherwise can be made by commercial sources or conventional method.

Embodiment 1：Build tussah lysozyme gene mutated library

Tussah is a kind of northern economic insects, tussah lysozyme (Aplyz) has that adaptive temperature scope is wide, optimum temperature compared with Low characteristic, with good application value.Tussah lysozyme gene sequence, ripe peptide sequence are found in ncbi database Common 363bp, carries out full genome by company and synthesizes, the gene order after synthesis is as follows：

AAGTGGTTTACCAAATGTGGTCTAGTGCACGAGCTGAGGAGACAAGGCTTCGACGAGAGCCTAATGAGAGACTGGGT CTGTTTGGTTGAGAACGAAAGCAGCAGATATACTAATAAAATCGGTAAAGTGAATAAGAATGGTTCTCAAGACTACG GTTTGTTCCAGATCAATGACAAATATTGGTGTAGTAAGACCTCCACCCCCGGAAAGGATTGCAATGTGACTTGTAAT CAATTGTTGACTGACGATATTACAGTTGCTGCTACCTGTGCGAAGAAGATTTACAAGAGACATAAGTTTAACGCTTG GTACGGATGGTTAAACCACTGTCAACACTCTCTTCCAGACATTAGCGACTGTTAA；

According to the expression vector pPICZ α A and above-mentioned tussah lysozyme gene sequence to be connected, NotI and XhoI two is selected Restriction enzyme is planted, the upstream and downstream primer containing restriction enzyme site is designed, primer sequence is as follows：

Aplyz-F：TCTACTCGAGAAAAGAAAGTGGTTTACCA

Aplyz-R：TCGCTGACAATTCGCCGGCGTATAT

Normal PCR is carried out first, expands tussah lysozyme gene, strain is retained after being connected with carrier T, fallibility is selected afterwards Two methods of PCR and DNA reorganization build the gene mutation library of tussah lysozyme.

Fallibility PCR concrete operation step is as follows：

Using tussah lysozyme gene as template, designed upstream and downstream primer, adjustment system proportioning and reaction bar are added Part, carries out fallibility PCR, and reaction system proportioning is as follows：

PCR reaction conditions are 94 DEG C of pre-degeneration 3min, 94 DEG C of denaturation 1min, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 50 Individual circulation.1% agarose gel electrophoresis 45min, gel imager detects and records result.

The concrete operation step of DNA reorganization is as follows：

Choose gene and the people for the people source lysozyme gene 4 (LYZL4) that there is homology with tussah lysozyme gene sequence The gene of source lysozyme gene 6 (LYZL6), reorganizes to tussah lysozyme gene.Wherein, the base of people source lysozyme gene 4 Because sequence is as follows：

GAATTCCTCGAGTACATCTTAGGTAGATGTACTGTCGCAAAGAAACTGCATGACGGAGGTCTGGATTAC TTCGAAGGATACTCTCTTGAGAATTGGGTGTGCTTGGCCTATTTTGAGTCTAAGTTCAATCCAATGGCCATATATGA AAATACTAGAGAGGGTTATACCGGATTTGGATTGTTTCAGATGAGAGGTAGTGATTGGTGCGGTGACCATGGTAGAA ACAGATGTCATATGTCATGTTCCGCATTATTGAACCCAAACCTTGAAAAAACTATTAAGTGCGCTAAAACTATTGTT AAGGGTAAAGAAGGTATGGGTGCTTGGCCTACCTGGTCTAGATATTGTCAATACAGTGATACATTGGCTAGATGGCT AGACGGATGTAAGCTTTAAGCGGCCGC

The gene order of people source lysozyme gene 6 is as follows：

GAATTCCTCGAGTCTTTGATTTCTAGATGCGATTTGGCTCAAGTTTTGCAGTTGGAGGACTTGGACGGT TTCGAGGGTTACTCTTTGTCTGACTGGTTGTGCTTGGCCTTCGTCGAGTCTAAGTTCAACATCTCTAAGATCAACGA GAACGCCGACGGATCTTTCGACTACGGATTGTTCCAGATCAACTCTCACTACTGGTGCAACGACTACAAATCTTACT CTGAGAACTTGTGCCATGTCGATTGCCAGGACTTGTTGAACCCAAACTTGTTGGCTGGAATCCATTGCGCCAAGAGA ATCGTCTCTGGAGCCAGAGGAATGAACAACTGGGTCGAGTGGAGATTGCACTGCTCTGGTAGACCTTTGTTCTATTG GTTGACCGGTTGCAGATTGAGATGAGCGGCCGC

According to tussah lysozyme gene sequence, the gene order of people source lysozyme gene 4 and the gene sequence of people source lysozyme gene 6 Primer of the row design containing identical restriction enzyme site.Design primer as follows：

Tussah lysozyme gene, people source lysozyme gene 4, people source lysozyme gene 6 respectively take 20 μ l to be mixed, and add 6 μ L DNaseI buffer solutions, add 0.2U or so DNaseI, digestion 15min, add 10 μ lEDTA, and 75 DEG C of enzymes inactivate 10min. Mixed system after digestion uses 1.5% low melting-point agarose gel electrophoresis 45min, and gel imager detects and records result.

50bp or so place's band is chosen, blob of viscose is cut under uviol lamp, 3 times of volume TE solution is added, is put into 70 DEG C of water To gel melt in bath, isometric balance phenol extracting is added once, 12000rpm centrifugations 10min takes supernatant to be transferred to another PE pipes In, remove unnecessary agar.With isometric phenol:(chloroform:Isoamyl alcohol) (1:And chloroform 1):Isoamyl alcohol (24:1) one is respectively extracted It is secondary, take supernatant.

Add cumulative volume 1/10 sodium acetate (pH5.2), add the absolute ethyl alcohol of three times volume precooling, after mixing- Freeze overnight in 20 DEG C of refrigerators.Centrifuge tube is taken out, 4 DEG C of centrifuges of precooling are put into, 13000rpm high speed centrifugation 15min will After supernatant is absorbed totally as far as possible, into two centrifuge tubes, each ice-cold ethanol for adding 1ml 75%, 13000rpm, centrifuge 10min. Addition 1ml 75% ice-cold ethanol is repeated, again desalination.Natural air drying at room temperature, into two centrifuge tubes, each 13 μ L that add are gone Ionized water dissolving DNA, after respectively taken from centrifuge tube 3 μ L DNA solutions run electrophoretic examinations ethanol precipitation after recovering effect.

Small fragment DNA product using recovery is not added with primer as template, using homologous recombination, makes to make mutually between small fragment For template, primer free PCR is carried out, system is as follows：

PCR reaction conditions are 94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 46 DEG C of annealing 1min, 72 DEG C of extension 30s, totally 50 Individual circulation, last 72 DEG C of extensions 10min.1% agarose gel electrophoresis 45min, gel imager are used to primer free PCR primer Detect and record result, and 400bp or so place DNA is reclaimed using glue reclaim kit., can be again in order to increase the rich of fragment It is secondary to have no primer PCR using DNaseI progress digestions, reclaim again.

It is template using primer free PCR primer, adds six kinds of above-mentioned primers, progress has primer PCR, and system is as follows：

PCR reaction conditions are：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 1min, 55.5 DEG C of annealing 30s, 72 DEG C of extension 30s, Totally 33 circulations, last 72 DEG C of extensions 10min.Amplified production uses 1% agarose gel electrophoresis 45min, gel imager inspection Survey and record result, and 400bp or so place DNA is reclaimed using glue reclaim kit.

From NotI and XhoI restriction enzymes, product and expression plasmid are reorganized to fallibility PCR primer and DNA PPICZ α A carry out double digestion.Electrophoresis is carried out to system after double digestion, size fragment, again enters glue reclaim product needed for reclaiming Row electrophoresis, concentration ratio is judged according to band brightness, and target gene and expression plasmid connection are stayed overnight, recombination expression matter is constituted Grain.

Recombinant plasmid is transferred in Top10 competent cells, after will be transferred to recombinant plasmid competent cell suspension it is whole It is applied on flat board, the competent cell suspension that 100-200 μ l are transferred to recombinant plasmid, 37 DEG C is coated with each diameter 90mm flat board Cultivate 16h or so.The bacterial strain grown is swept away from flat board with sterilized water, bacteria suspension is formed, bacteria suspension is reclaimed, utilizes upgrading Grain kit extracts the recombinant plasmid in bacteria suspension.

Embodiment 2：Recombinant expression plasmid is transferred to Pichia pastoris

Pichia yeast expression system is a kind of good eukaryotic expression system, can be realized with reference to pPICZ α A expression plasmids Good extracellular expression.

It is as follows that Pichia pastoris competent cell prepares concrete operation step：

(1) the Pichia pastoris GS115 monoclonal on picking YPDS flat boards is inoculated in 10ml YPD fluid nutrient mediums, to protect Throughput is demonstrate,proved, is sealed with 6 layers of gauze, 30 DEG C, 250rpm overnight incubations.

(2) transferred by 1% inoculum concentration in the 250ml band baffle plate conical flasks of the fluid nutrient mediums of YPD containing 50ml.30 DEG C, 250rpm concussion and cultivates about 20h to OD₆₀₀For 1.3-1.5.

(3) in the 50ml centrifuge tube that bacterium solution is moved into precooling, ice bath at least 30min makes cell sufficiently cool, 4 DEG C, 4 000rpm, centrifugation 5min collects cell.

(4) supernatant is carefully abandoned, thalline, 4 DEG C, 4 000rpm, centrifugation is resuspended with the aseptic deionized water of 50ml ice precoolings 5min。

(5) thalline is resuspended again with the aseptic deionized water of 25ml ice precoolings.

(6) supernatant is carefully abandoned, cell thalline, 4 DEG C, 4 is resuspended with the 1mol/L of 5ml ice precoolings sorbitol solution 000rpm, centrifuges 5min.

(7) supernatant is carefully abandoned, thalline is resuspended with 1ml sorbierites, is dispensed by the often μ L of pipe 80 standby.

Recombinant plasmid electricity is transformed into comprising the following steps that for Pichia pastoris GS115 competent cell：

(1) the recombinant plasmid pPICZ alpha A-ApLyz for linearizing 10 μ L adds 80 μ L Pichia pastoris GS115 competent cells In, precooling 10min on ice.

(2) electricity of electroporation is turned into voltage Tiao Jiedao 1.5kV.

(3) mixed liquor after ice bath is added in the electric revolving cup of 0.2cm precoolings, gently detain it is several under, mixed liquor is sunk to electricity Revolving cup bottom, gently wipes the water outside electric revolving cup away.

(4) electric revolving cup is put into electroporation, shock by electricity time about 5.0ms, electric shock adds 1ml precoolings immediately after terminating 1mol/L sorbitol solution.

(5) bacterium solution after electric shock is moved into sterile centrifugation tube, the training of 500 μ LYPD liquid is added after 30 DEG C of quiescent culture 1h Foster base is gently mixed, and continues to stand recovery 1h.

(6) resuscitation fluid is coated in the YPDS screening flat boards of Zeocin containing low concentration (100 μ g/ml) resistance, Mei Geping Plate is coated with 200 μ L, and whole resuscitation fluids are painted with.

(7) 30 DEG C of constant temperature quiescent culture 48h.

Embodiment 3：Build intracellular expression " recognition site-yellow fluorescence protein of cyan fluorescent protein-TEV protease " Escherichia coli

Escherichia coli are a kind of typical Gram-negative bacterias, are conveniently obtained, and easy culture easy to operate, cell membrane has fat many Sugared outer membrane, lysozyme is poor to its lytic effect.

According to the recognition site gene order of the fluorescence protein gene and TEV protease found in ncbi database, close " the recognition site of cyan fluorescent protein-TEV protease-yellow fluorescence egg containing XhoI, NocI restriction enzyme site respectively into two ends Gene order in vain ".Using two kinds of restriction enzymes respectively to containing cloned plasmids and expression plasmid of the albumen to gene PET28a carries out double digestion, fragment needed for electrophoresis is reclaimed.Linked system is prepared, by fluorescin to gene and expression plasmid PET28a stays overnight connection, builds recombinant expression plasmid.

Take out BL21 (DE3) competent cell and melt 1-2min on ice, linked system overnight is all added into competence In cell, 42 DEG C of water-bath 90s are transferred to after ice bath 30min, are transferred to immediately in ice after 2-3min, often pipe adds 900 μ l LB cultures Base, 37 DEG C of 200rpm recoveries 1h.The bacteria suspension recovered is drawn into 100 μ l to be applied on the LB flat boards containing kanamycins.

Using pET28a universal primers, colony PCR amplification is carried out to growing bacterium colony on flat board, is proved to be successful and is transferred to plasmid Escherichia coli, are then fermented, and fermentation is comprised the following steps that：

1) Escherichia coli for being successfully transferred to recombinant expression plasmid are transferred to the LB liquid training that 50ml contains appropriate kanamycins Support base (conical flask, 250ml specifications), 37 DEG C of shaking table cultures to OD₆₀₀For between 0.4-1, preferably 0.6, about 3h.

2) concentration of enchashment is added in one group of culture medium for 100mM IPTG 0.5ml, and it is 1mM to make its working concentration (because pET28a contains T7lac promoters, if other plasmids contain T7 promoters, IPTG working concentrations are diluted to 0.4mM)；Another group of culture medium is not added with IPTG, compares, by two groups of continuation shaking table culture 3h.

3) by conical flask after 5min is placed on ice, 4 DEG C of 5000 × g centrifuge 5min, abandon supernatant, 1/4 container body of thalline Strain is resuspended in the pre-cooled sterilized water of product, centrifuges again, and 4 DEG C of 5000 × g centrifuge 5min.

4) strain is resuspended in sterilized water.

Embodiment 4：The screening new tussah lysozyme high to Escherichia coli bactericidal activity

The Pichia pastoris with lysozyme gene grown on YPD flat boards is chosen into 96 equipped with 1ml BMGY culture mediums In deep-well plates, a strain is chosen in a hole, after cultivating 3 days, 4000rpm centrifugation 20min, abandons supernatant, adds 1ml's per hole BMMY culture mediums, add 20 μ l methanol, and hair is stopped after 24h adds the expression of 20 μ l methanol induction fermentations, fermentation 72h per hole Ferment.

The zymotic fluid expressed is drawn into 100 μ l per hole, hole hole is corresponding to be transferred to after transparent normal 96 orifice plate, per hole 100 μ l water are added, piping and druming mixes, is put into ELIASA and measures OD₆₀₀Value.

Into the Escherichia coli bacteria suspension of intracellular expression fluorescin pair, TEV protease and TEV protease buffering are added Liquid, addition is calculated according to needed for detection limit (during detection, 150 μ l bacteria suspensions, 0.8 μ l TEV protease buffer solutions is added per hole With 0.5 μ l TEV proteases), Substrate cocktail is formed after mixing, the mixing of 151 μ l substrates is added per hole into the orifice plate of black 96 Liquid.

Into the orifice plate of black 96, (last holes is added without zymotic fluid to 50 μ l zymotic fluids of every hole addition, only adds substrate mixing Liquid is used as negative control), inhale beat 1-2 times immediately, be put into ELIASA and detected, excitation wavelength is 433nm, launch wavelength is 475nm, every 1min detections once, is detected in 45min altogether, after reaction 4h, then detects 10min, every 1min detections once.

After detection, data are analyzed and processed through described method above, obtain containing the bacteriolyze high to Escherichia coli bactericidal activity The barms of enzyme, strain is expanded and cultivated, and induction fermentation carries out secondary screening, and data are analyzed and processed through described method above, tested Demonstrate,prove its activity.The full-length genome of the positive yeast finally given is extracted, amplifying target genes are simultaneously sequenced, obtained with Gao Ge The gene order of the new lysozyme of Lan Shi negative bacterium bactericidal activities.

It should be noted that embodiment described above is only used for explaining the present invention, do not constitute to any of the present invention Limitation.By referring to exemplary embodiments, invention has been described, it should be appreciated that wherein word used is descriptive With explanatory vocabulary, rather than limited vocabulary.The present invention can be made within the scope of the claims by regulation Modification, and the present invention is revised in without departing substantially from scope and spirit of the present invention.Although the present invention described in it is related to And specific method, material and embodiment, it is not intended that the present invention is limited to wherein disclosed particular case, on the contrary, this hair It is bright to can be extended to other all methods and applications with identical function.

SEQUENCE LISTING

<110>Beijing Technology and Business University

<120>A kind of high-throughput screening method of New-type wide-spectrum lysozyme

<130> 2017

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 29

<212> DNA

<213> Aplyz-F

<400> 1

tctactcgag aaaagaaagt ggtttacca 29

<210> 2

<211> 25

<212> DNA

<213> Aplyz-R

<400> 2

tcgctgacaa ttcgccggcg tatat 25

<210> 3

<211> 29

<212> DNA

<213>Tussah lysozyme sense primer

<400> 3

tctactcgag aaaagaaagt ggtttacca 29

<210> 4

<211> 25

<212> DNA

<213>Tussah lysozyme anti-sense primer

<400> 4

tatatgcggc cgcttaacag tcgct 25

<210> 5

<211> 31

<212> DNA

<213>The sense primer of people source lysozyme 4

<400> 5

tctactcgag tacatcttag gtagatgtac t 31

<210> 6

<211> 23

<212> DNA

<213>The anti-sense primer of people source lysozyme 4

<400> 6

tatatgcggc cgcttaaagc tta 23

<210> 7

<211> 27

<212> DNA

<213>The sense primer of people source lysozyme gene 6

<400> 7

tctactcgag tctttgattt ctagatg 27

<210> 8

<211> 23

<212> DNA

<213>The anti-sense primer of people source lysozyme gene 6

<400> 8

tatatgcggc cgctcatctc aat 23

<210> 9

<211> 363

<212> DNA

<213>Tussah lysozyme gene

<400> 9

aagtggttta ccaaatgtgg tctagtgcac gagctgagga gacaaggctt cgacgagagc 60

ctaatgagag actgggtctg tttggttgag aacgaaagca gcagatatac taataaaatc 120

ggtaaagtga ataagaatgg ttctcaagac tacggtttgt tccagatcaa tgacaaatat 180

tggtgtagta agacctccac ccccggaaag gattgcaatg tgacttgtaa tcaattgttg 240

actgacgata ttacagttgc tgctacctgt gcgaagaaga tttacaagag acataagttt 300

aacgcttggt acggatggtt aaaccactgt caacactctc ttccagacat tagcgactgt 360

taa 363

<210> 10

<211> 404

<212> DNA

<213>People source lysozyme gene 4

<400> 10

gaattcctcg agtacatctt aggtagatgt actgtcgcaa agaaactgca tgacggaggt 60

ctggattact tcgaaggata ctctcttgag aattgggtgt gcttggccta ttttgagtct 120

aagttcaatc caatggccat atatgaaaat actagagagg gttataccgg atttggattg 180

tttcagatga gaggtagtga ttggtgcggt gaccatggta gaaacagatg tcatatgtca 240

tgttccgcat tattgaaccc aaaccttgaa aaaactatta agtgcgctaa aactattgtt 300

aagggtaaag aaggtatggg tgcttggcct acctggtcta gatattgtca atacagtgat 360

acattggcta gatggctaga cggatgtaag ctttaagcgg ccgc 404

<210> 11

<211> 410

<212> DNA

<213>People source lysozyme gene 6

<400> 11

gaattcctcg agtctttgat ttctagatgc gatttggctc aagttttgca gttggaggac 60

ttggacggtt tcgagggtta ctctttgtct gactggttgt gcttggcctt cgtcgagtct 120

aagttcaaca tctctaagat caacgagaac gccgacggat ctttcgacta cggattgttc 180

cagatcaact ctcactactg gtgcaacgac tacaaatctt actctgagaa cttgtgccat 240

gtcgattgcc aggacttgtt gaacccaaac ttgttggctg gaatccattg cgccaagaga 300

atcgtctctg gagccagagg aatgaacaac tgggtcgagt ggagattgca ctgctctggt 360

agacctttgt tctattggtt gaccggttgc agattgagat gagcggccgc 410

<170>By hand

<210> 12

<211> 7

<212> PRT

<213>TEV protease recognition site

<400> 12

Glu Asn Leu Tyr Phe Gln Gly

1 5

Claims

1. a kind of high-throughput screening method of New-type wide-spectrum lysozyme, it comprises the following steps：

A, secreting, expressing is carried out by the gene mutation library of target lysozyme in eukaryotic, obtains target containing different activities molten The zymotic fluid of bacterium enzyme；

B, the zymotic fluid of the lysozyme of target containing different activities is added separately to be reacted in reaction system, is filtered out blue to leather The high lysozyme of family name's negative bacterium bactericidal activity；

Wherein, the reaction system includes：Intracellular expression " the recognition site of donor fluorescent protein-protein enzyme-acceptor fluorescence egg Gram-negative bacteria, protease and mmp reaction buffer solution in vain ".

2. according to the method described in claim 1, it is characterised in that according to the signal intensity of donor fluorescent albumen in course of reaction Growth rate, judges the lysozyme in zymotic fluid to Gram-negative bacteria bactericidal activity.

3. method according to claim 1 or 2, it is characterised in that described protease is with recognition sequence specificity Protease.

4. the method according to any one of claim 1-3, it is characterised in that described protease is TEV protease, intestines Kinases or factor Xa；Preferably, described protease is TEV protease.

5. method according to claim 4, it is characterised in that the amino acid sequence of the recognition site of the TEV protease For：Glu-Asn-Leu-Tyr-Phe-Gln-Gly.

6. the method according to any one of claim 1-5, it is characterised in that the target lysozyme gene mutated library Construction method be fallibility PCR and/or DNA reorganization.

7. the method according to any one of claim 1-6, it is characterised in that the donor fluorescent albumen and acceptor fluorescence The distance between albumen is when within 10nm, on energy transfer to the acceptor fluorescent protein of donor fluorescent albumen.

8. method according to claim 7, it is characterised in that described donor fluorescent albumen is cyan fluorescent protein, institute The acceptor fluorescent protein stated is yellow fluorescence protein.

9. the method according to any one of claim 1-8, it is characterised in that the eukaryotic is Pichia pastoris.

10. the method according to any one of claim 1-9, it is characterised in that methods described is further comprising the steps of：

C, secondary screening is carried out to the lysozyme high to Gram-negative bacteria bactericidal activity filtered out, glimmering according to donor in course of reaction The signal intensity growth rate of photoprotein, verifies the activity of lysozyme.