CN107164457A - A kind of high-throughput screening method of New-type wide-spectrum lysozyme - Google Patents
A kind of high-throughput screening method of New-type wide-spectrum lysozyme Download PDFInfo
- Publication number
- CN107164457A CN107164457A CN201710284625.9A CN201710284625A CN107164457A CN 107164457 A CN107164457 A CN 107164457A CN 201710284625 A CN201710284625 A CN 201710284625A CN 107164457 A CN107164457 A CN 107164457A
- Authority
- CN
- China
- Prior art keywords
- lysozyme
- protease
- gram
- fluorescent protein
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/40—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving amylase
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/924—Hydrolases (3) acting on glycosyl compounds (3.2)
- G01N2333/936—Hydrolases (3) acting on glycosyl compounds (3.2) acting on beta-1, 4 bonds between N-acetylmuramic acid and 2-acetyl-amino 2-deoxy-D-glucose, e.g. lysozyme
Abstract
The present invention relates to a kind of high-throughput screening method of New-type wide-spectrum lysozyme of technical field of molecular biology.This method comprises the following steps:A, secreting, expressing is carried out by the gene mutation library of target lysozyme in eukaryotic, obtains the zymotic fluid of the lysozyme of target containing different activities;B, the zymotic fluid of the lysozyme of target containing different activities is added separately to be reacted in reaction system, filters out the lysozyme high to Gram-negative bacteria bactericidal activity;Wherein, reaction system includes:Gram-negative bacteria, protease and the mmp reaction buffer solution of intracellular expression " the recognition site acceptor fluorescent protein of donor fluorescent protein enzyme ".Screening technique of the present invention significantly improves the sensitivity of detection by the cascade of FRET fluorescins pair and site-specific protease;This method can realize the high flux detection of lysozyme using fluorescence microplate reader and 96 microwell plates simultaneously.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of high flux screening side of New-type wide-spectrum lysozyme
Method.
Background technology
Lysozyme (lysozyme, EC3.2.1.17) is also known as muramidase (muramidase), can specific for hydrolysis protokaryon
Main component peptide glycan in bacteria cell wall, decomposes the cell membrane of microorganism, bacterium is lost the protection of cell membrane and in born of the same parents
Death is ruptured in the presence of interior hyperosmosis, so as to reach sterilization purpose.Nineteen twenty-one, famous Britain bacteriologist Alexander
Fleming is found that lysozyme in the nose liquid of people, and rear confirmation lysozyme is widely present in the egg white of birds and birds, lactation
In each organ-tissue and body fluid of animal, in plant and mollusk and insect bodies.
Lysozyme, as one of antiseptic most powerful in higher organisms tissue and body fluid, is living organism confrontation external source
The important defense factor of pathogen invasion and attack.If human lysozyme is a kind of Small-molecule basic globulin, it by epithelial cell and monokaryon-
Macrophages secrete, can recognize that and destroy the eucaryotic cell structure of pathogen, and attract leucocyte to focus on by signal cascade reaction
Infection site, it is final to eliminate the pathogen for infecting human body.In addition, lysozyme can also directly be tied with negatively charged virus protein
Close, and DNA-RNA apoproteins formation double salt, make virally inactivated.In plant, containing abundant in such as fresh juice of fig
Lysozyme, thus it is speculated that its antivirus action substantial connection with plant.On the other hand, lysozyme is also widely present in microorganism
In, such as various bacteriums and bacteriophage.Phage lysozyme is relevant with the decomposition of bacteria cell wall during Phage Infection.Bacterium
The major function of lysozyme is to participate in the metabolic processes related to cell membrane such as cell division morphologic change.Therefore, bacterium
Repellence truly will not be produced, this is right to the autolysin (autolysin) that contains extensively in this bacterium of lysozyme
In solving increasingly serious bacterial resistance sex chromosome mosaicism, abuse of antibiotics is reduced significant.
Although the powerful of lysozyme, its lytic effect to Gram-negative bacteria is simultaneously bad.This is due to bacterium
Cell membrane is constituted caused by difference.The cell membrane of gram-positive bacteria is mainly made up of peptide glycan, the peptide glycan number of plies it is more and
Thicker, containing a small amount of LTA, and Gram-negative bacteria outer layer is mainly made up of lipopolysaccharides (LPS), and internal layer just contains a small amount of peptide
Glycan.And the main function site of lysozyme is the peptide glycan in cell membrane, β-Isosorbide-5-Nitrae glycosidic bond is hydrolyzed, therefore it is for gram
The action effect of negative bacterium is less desirable.
Among daily life, many pathogenic bacteria that people are touched, such as Escherichia coli, pseudomonas aeruginosa, pneumonia
Bacillus, shigella dysenteriae and Bacillus perfringens etc., belong to Gram-negative bacteria.In order to obtain that there is height to Gram-negative bacteria
The lysozyme of bactericidal activity, can be oriented evolution to lysozyme, build lysozyme gene libraries of random mutants, then therefrom sieve
Select the lysozyme stronger to Gram-negative bacteria bactericidal effect.
Orient in conversion process, on the one hand, required mutant library substantial amounts, high throughput method need to be used to improve
Screening efficiency;On the other hand, lysozyme is poor to Gram-negative bacteria lytic effect, need to using measurement index it is more sensitive, can be effective
Reflect the screening means of lytic effect.And existing screening technique such as flat board inhibition zone method, Odontothrips loti etc., it is impossible to it is same well
When meet more than 2 points requirement.Therefore, a kind of sensitive reliable, easy-operating high-throughput screening method of structure is needed badly, for new
The screening of wide spectrum bacteriolyze enzyme mutant.
The content of the invention
The technical problems to be solved by the invention are to provide a kind of New-type wide-spectrum lysozyme in view of the shortcomings of the prior art
High-throughput screening method, this method is used by the cascade of FRET fluorescins pair and site-specific protease, improves inspection
The sensitivity of survey, while the high flux that can realize lysozyme using fluorescence microplate reader and 96 microwell plates is detected.
Therefore, the invention provides a kind of high-throughput screening method of New-type wide-spectrum lysozyme, it comprises the following steps:
A, secreting, expressing is carried out by the gene mutation library of target lysozyme in eukaryotic, obtains mesh containing different activities
Mark the zymotic fluid of lysozyme;
B, the zymotic fluid of the lysozyme of target containing different activities is added separately to be reacted in reaction system, is filtered out pair
The high lysozyme of Gram-negative bacteria bactericidal activity;
Wherein, the reaction system includes:Intracellular expression " recognition site-acceptor fluorescence of donor fluorescent protein-protein enzyme
Gram-negative bacteria, protease and the mmp reaction buffer solution of albumen ".
In the present invention, according to the signal intensity growth rate of donor fluorescent albumen in course of reaction, judge in zymotic fluid
Lysozyme to Gram-negative bacteria bactericidal activity;Specifically, the signal intensity growth of donor fluorescent albumen is got in course of reaction
It hurry up, the lysozyme in zymotic fluid is higher to Gram-negative bacteria bactericidal activity.
In certain embodiments of the present invention, described protease is with the specific protease of recognition sequence;
In some specific embodiments of the present invention, described protease is TEV protease, enterokinase or factor Xa;In the present invention
Some preferred embodiments in, described protease is TEV protease.
In other embodiments of the present invention, the amino acid sequence of the recognition site of the TEV protease is:Glu-
Asn-Leu-Tyr-Phe-Gln-Gly。
In certain embodiments of the present invention, the construction method of the target lysozyme gene mutated library is fallibility
PCR and/or DNA reorganization.
In the present invention, because the emission spectrum of donor fluorescent albumen and the absorption spectrum of acceptor fluorescent protein are overlapping, because
This is when the distance between donor fluorescent albumen and acceptor fluorescent protein are when within 10nm, it may occur that energy transfer phenomenon, donor
It is much lower when making donor protein fluorescence intensity than its individualism on the energy transfer of fluorescin to acceptor fluorescent protein,
And receptor protein fluorescence intensity is greatly enhanced.
In some specific embodiments of the present invention, described donor fluorescent albumen is cyan fluorescent protein, it is described by
Body fluorescin is yellow fluorescence protein.
In certain specific embodiments of the invention, the eukaryotic is Pichia pastoris.
In other embodiments of the present invention, methods described is further comprising the steps of:
C, carries out secondary screening to the lysozyme high to Gram-negative bacteria bactericidal activity filtered out, is supplied according in course of reaction
The signal intensity growth rate of body fluorescin, verifies the activity of lysozyme.
Beneficial effects of the present invention are:Screening technique of the present invention passes through FRET fluorescins pair and locus specificity egg
The cascade of white enzyme, by detection fluorescence signal, significantly improves the sensitivity of detection, can effectively find Positive mutants, find
Excellent mutator;This method can realize the high flux detection of lysozyme using fluorescence microplate reader and 96 microwell plates simultaneously.
Embodiment
To be readily appreciated that the present invention, the present invention is described more detail below.
Screening technique of the present invention be based on FRET technology (FRET), i.e., two fluorescent protein molecules away from
During from extremely nearly (within 10nm), if the emission spectrum of donor fluorescent albumen is overlapping with the absorption spectrum of acceptor fluorescent protein,
Can occur on energy transfer phenomenon, energy transfer to the acceptor fluorescent protein of donor fluorescent albumen, make donor protein fluorescence intensity
It is much lower during than its individualism, and receptor protein fluorescence intensity is greatly enhanced.With cyan fluorescent protein and yellow fluorescence egg
Exemplified by white, cyan fluorescent protein and yellow fluorescence protein, which are a pair, can occur the albumen of FRET effects, wherein cyan albumen
Emission spectrum is overlapping with the absorption spectrum of xanthoprotein.
With the recognition site of protease as linker sequences, for example, using the recognition site conduct of TEV protease
Linker sequences connect cyan fluorescent protein and yellow fluorescence protein, make cyan fluorescent protein and yellow fluorescence protein formation away from
From extremely near FRET fluorescins pair, i.e. " recognition site-yellow fluorescence protein of cyan fluorescent protein-TEV protease ".TEV
The recognition site of protease is made up of Glu-Asn-Leu-Tyr-Phe-Gln-Gly seven amino acids.
Before reaction, due to the effect of linker sequences (recognition site of TEV protease), cyan fluorescent protein and yellow are glimmering
Photoprotein distance is extremely near, on energy transfer to the yellow fluorescence protein of cyan fluorescent protein, now detects that cyan is presented in signal glimmering
Optical signal is weak, yellow fluorescence signal is strong;Added when by the zymotic fluid of lysozyme in reaction solution, if lysozyme is to substrate strain
(Gram-negative bacteria) has preferable bactericidal activity, then the FRET fluorescins pair for cracking and discharging inside occur for bacterium.The egg
It is white to TEV protease recognition site is by the TEV protease specific recognition in reaction solution and decomposes, obtain independent cyan
Fluorescin and yellow fluorescence protein, FRET phenomenons disappear so that hanced cyan fluorescent signal enhancing.It therefore, it can survey by quantitative
The growth rate of cyan fluorescent protein signal intensity is determined, to judge bactericidal activity of the lysozyme to Gram-negative bacteria.
The concrete operations of the high-throughput screening method of New-type wide-spectrum lysozyme involved in the present invention are as follows:
(1) eukaryotic of construction expression target lysozyme gene mutated library:
The specific species of target lysozyme can be selected according to actual needs.The gene order of encoding target lysozyme passes through core
Sour database lookup simultaneously carries out full genome synthesis, obtains original object lysozyme gene sequence.Build target lysozyme gene with
Machine mutated library is mainly realized by two kinds of means of fallibility PCR and DNA reorganization (also referred to as DNA shuffles).
1) fallibility PCR concrete operation steps are as follows:
Contain the primer of restriction enzyme site for original object lysozyme gene sequences Design, by adjusting PCR reaction systems
With when reaction condition, such as change the concentration of metal ion in reaction system, increase PCR reaction cycle number of times, carry out easily
Wrong PCR amplifications, make the gene order in fallibility PCR primer occur point mutation, so as to cause amino acid change.
2) DNA reorganization concrete operation step is as follows:
Other lysozyme gene sequences that there is homology with original object lysozyme gene are chosen, number can be according to reality
Border needs selected.Every kind of gene order respectively takes 20 μ l to mix, addition 0.2U DNaseI, at 16 DEG C after digestion 15min immediately
6 μ l EDTA are added, 75 DEG C of water-baths, enzyme inactivation 10min are transferred to.Mixed system after digestion is entered into row agarose gel electrophoresis,
Suitable method is chosen, the fragment of required size is subjected to glue reclaim.If templet gene is 2000bp or so, 100- is cut
Blob of viscose at 200bp, glue reclaim is carried out from glue reclaim kit;If templet gene is 1000bp or so, 50bp or so is cut
Locate blob of viscose, low melting-point agarose is chosen because fragment length is small, during electrophoresis and carries out electrophoresis, the blob of viscose cut is dissolved in 3 times of volumes
In TE solution, using phenol chloroform, then ethanol precipitation is carried out, reclaim small fragment DNA.
Using the piece segment DNA after recovery as primer free PCR template, primer free PCR is carried out, the original of genetic recombination is utilized
Reason, making piece segment DNA, primer enters performing PCR each other, and system proportioning is as follows:1 μ l PFU enzymes, 5 μ lbuffer, 10 μ l DNTP, 5 μ l pieces
Segment DNA, 29 μ l ultra-pure waters, totally 50 μ l.PCR programs are:94 DEG C of 5min, 94 DEG C of 30s, 46 DEG C of 1min, 72 DEG C of 30s, 50 circulations,
72℃10min.Wherein 72 DEG C extension of time are selected according to actual needs.Row agarose gel electrophoresis are entered to primer free PCR primer,
The fragment of glue reclaim original object lysozyme gene size.
The primer containing identical restriction enzyme site is designed according to several homologous genes, designed primer is added, utilizes upper one
Primer free PCR primer is walked as template, progress has primer PCR.Routinely PCR system is matched, and is entered according to normal PCR reaction conditions
Performing PCR reacts.There to be primer PCR product to enter row agarose gel electrophoresis again, glue reclaim original object lysozyme gene size
Fragment.
Product after fallibility PCR or DNA are reorganized carries out double digestion, and expression vector also is carried out into double enzymes using same enzyme
Cut, by agarose gel electrophoresis, size fragment, takes 5 μ l recovery products to carry out electrophoresis again, according to band brightness needed for reclaiming
Target gene and expression vector ratio are determined, linked system is prepared, 16 DEG C of connections are stayed overnight, construction recombination plasmid.
Recombinant plasmid is transferred in Top10 competent cells, it is then that the competent cell suspension for being transferred to recombinant plasmid is complete
Portion is applied on flat board, and the competent cell suspension that 100-200 μ l are transferred to recombinant plasmid, 37 are coated with each diameter 90mm flat board
DEG C culture 16h or so.The bacterial strain grown is swept away from flat board with sterilized water, bacteria suspension is formed, bacteria suspension is reclaimed, using carrying
Plasmid kit extracts the recombinant plasmid in bacteria suspension.
Recombinant plasmid is transferred in eucaryote competent cell, for example Pichia pastoris competent cell, restructuring will be transferred to
The eucaryote competent cell suspension of plasmid, which is all divided equally, to be applied on flat board, quiescent culture, obtains lysozyme gene containing target
The eukaryotic of mutated library.
(2) gram-negative of intracellular expression " recognition site-acceptor fluorescent protein of donor fluorescent protein-protein enzyme " is built
Property bacterium:
The donor fluorescent albumen used is cyan fluorescent protein, and acceptor fluorescent protein is photochromic fluorescin, protease
For TEV protease;
The gene order of cyan fluorescent protein and yellow fluorescence protein is found out by ncbi database, TEV albumen is added
The recognition site gene of enzyme designs " the hanced cyan fluorescent egg that two ends carry restriction enzyme site as middle linker sequences
Recognition site-yellow fluorescence protein of in vain-TEV protease " FRET fluorescins are to gene order, by manually being synthesized.
FRET fluorescins are carried out to gene and Gram-negative bacteria intracellular expression carrier to reclaim fragment progress after double digestion, electrophoresis
Connection, construction recombination plasmid.
Recombinant plasmid is imported in Gram-negative bacterium competence cell, induction fermentation expression is identified by SDS-PAGE
FRET fluorescins are expressed in strain success.Thalline is collected by centrifugation, supernatant is abandoned, adds sterilized water and strain is resuspended, then
Sterilized water is added after centrifugation, the bacteria suspension with certain concentration is formed it into.
(3) lysozyme high to Gram-negative bacteria bactericidal activity is screened:
Successful secretion is expressed to the yeast system of target lysozyme gene mutated library, is hole-specifically transferred to equipped with yeast culture medium
96 deep-well plates in, carry out induction fermentation in deep-well plates, obtain the zymotic fluid of the lysozyme containing target.
100 μ l zymotic fluids are drawn per hole, and it is hole-specifically accordingly transferred in transparent ELISA Plate, are added per hole
100 μ l pure water, measure the OD of every hole zymotic fluid in ELIASA after mixing600Value.
To the Gram-negative of intracellular expression " recognition site-yellow fluorescence protein of cyan fluorescent protein-TEV protease "
In the bacteria suspension of bacterium, add TEV protease and TEV protease buffer solution, addition calculated according to needed for detection limit (during detection,
150 μ l bacteria suspensions, 0.8 μ l TEV proteases buffer solutions and 0.5 μ l TEV proteases are added per hole), substrate is formed after mixing and is mixed
Liquid is closed, 151 μ l Substrate cocktails are added per hole into fluorescence ELISA Plate.
Then adding 50 μ l zymotic fluids per hole into fluorescence ELISA Plate, (last holes is added without zymotic fluid, only adds substrate
Mixed liquor is used as negative control), inhale immediately after beating 1-2 times, be put into ELIASA and detected, excitation wavelength is 433nm, launch
Wavelength is 475nm, every 1min detections once, is detected altogether after 45min, reaction 4h, then detects 10min, and one is detected every 1min
It is secondary.
The Treatment Analysis of screening index is as follows:
45min is that abscissa, hanced cyan fluorescent signal strength values do figure as ordinate using the time (min) before reaction, and detection is anti-
Stability when should start.If stable reaction, i.e. reaction tendency gently rises, then can be in the hope of preceding 10min fluorescence signal intensities
Average value, while the average value answered after 4h in 10min of negating.The difference of two average value is again divided by per the OD of hole zymotic fluid600Value,
That is fluorescence signal intensity difference/OD600(the signal intensity growth rate of cyan fluorescent protein), with this data to mutant lysozyme
The height of enzyme activity is ranked up, while the data of the data in each hole and negative control hole are compared.Wherein hanced cyan fluorescent is believed
Number increase faster and higher than control wells numerical value, represent that the lysozyme in zymotic fluid is higher to Gram-negative bacteria bactericidal activity.
To the positive yeast containing the lysozyme high to Gram-negative bacteria bactericidal activity filtered out be amplified culture and
Secondary screening, according to the signal intensity growth rate of cyan fluorescent protein in course of reaction, verifies the activity of lysozyme.Extract final obtain
The full-length genome of the positive yeast arrived, amplifying target genes are simultaneously sequenced, and are obtained with high Gram-negative bacteria bactericidal activity
New lysozyme gene order.
Heretofore described " tussah lysozyme gene " is the tussah lysozyme gene after codon optimization.
Embodiment
To make the present invention easier to understand, the present invention is further described below in conjunction with embodiment, these realities
Apply example only serve it is illustrative, it is not limited to application of the invention.If raw material or component nothing used in the present invention
Specified otherwise can be made by commercial sources or conventional method.
Embodiment 1:Build tussah lysozyme gene mutated library
Tussah is a kind of northern economic insects, tussah lysozyme (Aplyz) has that adaptive temperature scope is wide, optimum temperature compared with
Low characteristic, with good application value.Tussah lysozyme gene sequence, ripe peptide sequence are found in ncbi database
Common 363bp, carries out full genome by company and synthesizes, the gene order after synthesis is as follows:
AAGTGGTTTACCAAATGTGGTCTAGTGCACGAGCTGAGGAGACAAGGCTTCGACGAGAGCCTAATGAGAGACTGGGT
CTGTTTGGTTGAGAACGAAAGCAGCAGATATACTAATAAAATCGGTAAAGTGAATAAGAATGGTTCTCAAGACTACG
GTTTGTTCCAGATCAATGACAAATATTGGTGTAGTAAGACCTCCACCCCCGGAAAGGATTGCAATGTGACTTGTAAT
CAATTGTTGACTGACGATATTACAGTTGCTGCTACCTGTGCGAAGAAGATTTACAAGAGACATAAGTTTAACGCTTG
GTACGGATGGTTAAACCACTGTCAACACTCTCTTCCAGACATTAGCGACTGTTAA;
According to the expression vector pPICZ α A and above-mentioned tussah lysozyme gene sequence to be connected, NotI and XhoI two is selected
Restriction enzyme is planted, the upstream and downstream primer containing restriction enzyme site is designed, primer sequence is as follows:
Aplyz-F:TCTACTCGAGAAAAGAAAGTGGTTTACCA
Aplyz-R:TCGCTGACAATTCGCCGGCGTATAT
Normal PCR is carried out first, expands tussah lysozyme gene, strain is retained after being connected with carrier T, fallibility is selected afterwards
Two methods of PCR and DNA reorganization build the gene mutation library of tussah lysozyme.
Fallibility PCR concrete operation step is as follows:
Using tussah lysozyme gene as template, designed upstream and downstream primer, adjustment system proportioning and reaction bar are added
Part, carries out fallibility PCR, and reaction system proportioning is as follows:
PCR reaction conditions are 94 DEG C of pre-degeneration 3min, 94 DEG C of denaturation 1min, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 50
Individual circulation.1% agarose gel electrophoresis 45min, gel imager detects and records result.
The concrete operation step of DNA reorganization is as follows:
Choose gene and the people for the people source lysozyme gene 4 (LYZL4) that there is homology with tussah lysozyme gene sequence
The gene of source lysozyme gene 6 (LYZL6), reorganizes to tussah lysozyme gene.Wherein, the base of people source lysozyme gene 4
Because sequence is as follows:
GAATTCCTCGAGTACATCTTAGGTAGATGTACTGTCGCAAAGAAACTGCATGACGGAGGTCTGGATTAC
TTCGAAGGATACTCTCTTGAGAATTGGGTGTGCTTGGCCTATTTTGAGTCTAAGTTCAATCCAATGGCCATATATGA
AAATACTAGAGAGGGTTATACCGGATTTGGATTGTTTCAGATGAGAGGTAGTGATTGGTGCGGTGACCATGGTAGAA
ACAGATGTCATATGTCATGTTCCGCATTATTGAACCCAAACCTTGAAAAAACTATTAAGTGCGCTAAAACTATTGTT
AAGGGTAAAGAAGGTATGGGTGCTTGGCCTACCTGGTCTAGATATTGTCAATACAGTGATACATTGGCTAGATGGCT
AGACGGATGTAAGCTTTAAGCGGCCGC
The gene order of people source lysozyme gene 6 is as follows:
GAATTCCTCGAGTCTTTGATTTCTAGATGCGATTTGGCTCAAGTTTTGCAGTTGGAGGACTTGGACGGT
TTCGAGGGTTACTCTTTGTCTGACTGGTTGTGCTTGGCCTTCGTCGAGTCTAAGTTCAACATCTCTAAGATCAACGA
GAACGCCGACGGATCTTTCGACTACGGATTGTTCCAGATCAACTCTCACTACTGGTGCAACGACTACAAATCTTACT
CTGAGAACTTGTGCCATGTCGATTGCCAGGACTTGTTGAACCCAAACTTGTTGGCTGGAATCCATTGCGCCAAGAGA
ATCGTCTCTGGAGCCAGAGGAATGAACAACTGGGTCGAGTGGAGATTGCACTGCTCTGGTAGACCTTTGTTCTATTG
GTTGACCGGTTGCAGATTGAGATGAGCGGCCGC
According to tussah lysozyme gene sequence, the gene order of people source lysozyme gene 4 and the gene sequence of people source lysozyme gene 6
Primer of the row design containing identical restriction enzyme site.Design primer as follows:
Tussah lysozyme gene, people source lysozyme gene 4, people source lysozyme gene 6 respectively take 20 μ l to be mixed, and add 6 μ
L DNaseI buffer solutions, add 0.2U or so DNaseI, digestion 15min, add 10 μ lEDTA, and 75 DEG C of enzymes inactivate 10min.
Mixed system after digestion uses 1.5% low melting-point agarose gel electrophoresis 45min, and gel imager detects and records result.
50bp or so place's band is chosen, blob of viscose is cut under uviol lamp, 3 times of volume TE solution is added, is put into 70 DEG C of water
To gel melt in bath, isometric balance phenol extracting is added once, 12000rpm centrifugations 10min takes supernatant to be transferred to another PE pipes
In, remove unnecessary agar.With isometric phenol:(chloroform:Isoamyl alcohol) (1:And chloroform 1):Isoamyl alcohol (24:1) one is respectively extracted
It is secondary, take supernatant.
Add cumulative volume 1/10 sodium acetate (pH5.2), add the absolute ethyl alcohol of three times volume precooling, after mixing-
Freeze overnight in 20 DEG C of refrigerators.Centrifuge tube is taken out, 4 DEG C of centrifuges of precooling are put into, 13000rpm high speed centrifugation 15min will
After supernatant is absorbed totally as far as possible, into two centrifuge tubes, each ice-cold ethanol for adding 1ml 75%, 13000rpm, centrifuge 10min.
Addition 1ml 75% ice-cold ethanol is repeated, again desalination.Natural air drying at room temperature, into two centrifuge tubes, each 13 μ L that add are gone
Ionized water dissolving DNA, after respectively taken from centrifuge tube 3 μ L DNA solutions run electrophoretic examinations ethanol precipitation after recovering effect.
Small fragment DNA product using recovery is not added with primer as template, using homologous recombination, makes to make mutually between small fragment
For template, primer free PCR is carried out, system is as follows:
PCR reaction conditions are 94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 46 DEG C of annealing 1min, 72 DEG C of extension 30s, totally 50
Individual circulation, last 72 DEG C of extensions 10min.1% agarose gel electrophoresis 45min, gel imager are used to primer free PCR primer
Detect and record result, and 400bp or so place DNA is reclaimed using glue reclaim kit., can be again in order to increase the rich of fragment
It is secondary to have no primer PCR using DNaseI progress digestions, reclaim again.
It is template using primer free PCR primer, adds six kinds of above-mentioned primers, progress has primer PCR, and system is as follows:
PCR reaction conditions are:94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 1min, 55.5 DEG C of annealing 30s, 72 DEG C of extension 30s,
Totally 33 circulations, last 72 DEG C of extensions 10min.Amplified production uses 1% agarose gel electrophoresis 45min, gel imager inspection
Survey and record result, and 400bp or so place DNA is reclaimed using glue reclaim kit.
From NotI and XhoI restriction enzymes, product and expression plasmid are reorganized to fallibility PCR primer and DNA
PPICZ α A carry out double digestion.Electrophoresis is carried out to system after double digestion, size fragment, again enters glue reclaim product needed for reclaiming
Row electrophoresis, concentration ratio is judged according to band brightness, and target gene and expression plasmid connection are stayed overnight, recombination expression matter is constituted
Grain.
Recombinant plasmid is transferred in Top10 competent cells, after will be transferred to recombinant plasmid competent cell suspension it is whole
It is applied on flat board, the competent cell suspension that 100-200 μ l are transferred to recombinant plasmid, 37 DEG C is coated with each diameter 90mm flat board
Cultivate 16h or so.The bacterial strain grown is swept away from flat board with sterilized water, bacteria suspension is formed, bacteria suspension is reclaimed, utilizes upgrading
Grain kit extracts the recombinant plasmid in bacteria suspension.
Embodiment 2:Recombinant expression plasmid is transferred to Pichia pastoris
Pichia yeast expression system is a kind of good eukaryotic expression system, can be realized with reference to pPICZ α A expression plasmids
Good extracellular expression.
It is as follows that Pichia pastoris competent cell prepares concrete operation step:
(1) the Pichia pastoris GS115 monoclonal on picking YPDS flat boards is inoculated in 10ml YPD fluid nutrient mediums, to protect
Throughput is demonstrate,proved, is sealed with 6 layers of gauze, 30 DEG C, 250rpm overnight incubations.
(2) transferred by 1% inoculum concentration in the 250ml band baffle plate conical flasks of the fluid nutrient mediums of YPD containing 50ml.30 DEG C,
250rpm concussion and cultivates about 20h to OD600For 1.3-1.5.
(3) in the 50ml centrifuge tube that bacterium solution is moved into precooling, ice bath at least 30min makes cell sufficiently cool, 4 DEG C, 4
000rpm, centrifugation 5min collects cell.
(4) supernatant is carefully abandoned, thalline, 4 DEG C, 4 000rpm, centrifugation is resuspended with the aseptic deionized water of 50ml ice precoolings
5min。
(5) thalline is resuspended again with the aseptic deionized water of 25ml ice precoolings.
(6) supernatant is carefully abandoned, cell thalline, 4 DEG C, 4 is resuspended with the 1mol/L of 5ml ice precoolings sorbitol solution
000rpm, centrifuges 5min.
(7) supernatant is carefully abandoned, thalline is resuspended with 1ml sorbierites, is dispensed by the often μ L of pipe 80 standby.
Recombinant plasmid electricity is transformed into comprising the following steps that for Pichia pastoris GS115 competent cell:
(1) the recombinant plasmid pPICZ alpha A-ApLyz for linearizing 10 μ L adds 80 μ L Pichia pastoris GS115 competent cells
In, precooling 10min on ice.
(2) electricity of electroporation is turned into voltage Tiao Jiedao 1.5kV.
(3) mixed liquor after ice bath is added in the electric revolving cup of 0.2cm precoolings, gently detain it is several under, mixed liquor is sunk to electricity
Revolving cup bottom, gently wipes the water outside electric revolving cup away.
(4) electric revolving cup is put into electroporation, shock by electricity time about 5.0ms, electric shock adds 1ml precoolings immediately after terminating
1mol/L sorbitol solution.
(5) bacterium solution after electric shock is moved into sterile centrifugation tube, the training of 500 μ LYPD liquid is added after 30 DEG C of quiescent culture 1h
Foster base is gently mixed, and continues to stand recovery 1h.
(6) resuscitation fluid is coated in the YPDS screening flat boards of Zeocin containing low concentration (100 μ g/ml) resistance, Mei Geping
Plate is coated with 200 μ L, and whole resuscitation fluids are painted with.
(7) 30 DEG C of constant temperature quiescent culture 48h.
Embodiment 3:Build intracellular expression " recognition site-yellow fluorescence protein of cyan fluorescent protein-TEV protease "
Escherichia coli
Escherichia coli are a kind of typical Gram-negative bacterias, are conveniently obtained, and easy culture easy to operate, cell membrane has fat many
Sugared outer membrane, lysozyme is poor to its lytic effect.
According to the recognition site gene order of the fluorescence protein gene and TEV protease found in ncbi database, close
" the recognition site of cyan fluorescent protein-TEV protease-yellow fluorescence egg containing XhoI, NocI restriction enzyme site respectively into two ends
Gene order in vain ".Using two kinds of restriction enzymes respectively to containing cloned plasmids and expression plasmid of the albumen to gene
PET28a carries out double digestion, fragment needed for electrophoresis is reclaimed.Linked system is prepared, by fluorescin to gene and expression plasmid
PET28a stays overnight connection, builds recombinant expression plasmid.
Take out BL21 (DE3) competent cell and melt 1-2min on ice, linked system overnight is all added into competence
In cell, 42 DEG C of water-bath 90s are transferred to after ice bath 30min, are transferred to immediately in ice after 2-3min, often pipe adds 900 μ l LB cultures
Base, 37 DEG C of 200rpm recoveries 1h.The bacteria suspension recovered is drawn into 100 μ l to be applied on the LB flat boards containing kanamycins.
Using pET28a universal primers, colony PCR amplification is carried out to growing bacterium colony on flat board, is proved to be successful and is transferred to plasmid
Escherichia coli, are then fermented, and fermentation is comprised the following steps that:
1) Escherichia coli for being successfully transferred to recombinant expression plasmid are transferred to the LB liquid training that 50ml contains appropriate kanamycins
Support base (conical flask, 250ml specifications), 37 DEG C of shaking table cultures to OD600For between 0.4-1, preferably 0.6, about 3h.
2) concentration of enchashment is added in one group of culture medium for 100mM IPTG 0.5ml, and it is 1mM to make its working concentration
(because pET28a contains T7lac promoters, if other plasmids contain T7 promoters, IPTG working concentrations are diluted to
0.4mM);Another group of culture medium is not added with IPTG, compares, by two groups of continuation shaking table culture 3h.
3) by conical flask after 5min is placed on ice, 4 DEG C of 5000 × g centrifuge 5min, abandon supernatant, 1/4 container body of thalline
Strain is resuspended in the pre-cooled sterilized water of product, centrifuges again, and 4 DEG C of 5000 × g centrifuge 5min.
4) strain is resuspended in sterilized water.
Embodiment 4:The screening new tussah lysozyme high to Escherichia coli bactericidal activity
The Pichia pastoris with lysozyme gene grown on YPD flat boards is chosen into 96 equipped with 1ml BMGY culture mediums
In deep-well plates, a strain is chosen in a hole, after cultivating 3 days, 4000rpm centrifugation 20min, abandons supernatant, adds 1ml's per hole
BMMY culture mediums, add 20 μ l methanol, and hair is stopped after 24h adds the expression of 20 μ l methanol induction fermentations, fermentation 72h per hole
Ferment.
The zymotic fluid expressed is drawn into 100 μ l per hole, hole hole is corresponding to be transferred to after transparent normal 96 orifice plate, per hole
100 μ l water are added, piping and druming mixes, is put into ELIASA and measures OD600Value.
Into the Escherichia coli bacteria suspension of intracellular expression fluorescin pair, TEV protease and TEV protease buffering are added
Liquid, addition is calculated according to needed for detection limit (during detection, 150 μ l bacteria suspensions, 0.8 μ l TEV protease buffer solutions is added per hole
With 0.5 μ l TEV proteases), Substrate cocktail is formed after mixing, the mixing of 151 μ l substrates is added per hole into the orifice plate of black 96
Liquid.
Into the orifice plate of black 96, (last holes is added without zymotic fluid to 50 μ l zymotic fluids of every hole addition, only adds substrate mixing
Liquid is used as negative control), inhale beat 1-2 times immediately, be put into ELIASA and detected, excitation wavelength is 433nm, launch wavelength is
475nm, every 1min detections once, is detected in 45min altogether, after reaction 4h, then detects 10min, every 1min detections once.
After detection, data are analyzed and processed through described method above, obtain containing the bacteriolyze high to Escherichia coli bactericidal activity
The barms of enzyme, strain is expanded and cultivated, and induction fermentation carries out secondary screening, and data are analyzed and processed through described method above, tested
Demonstrate,prove its activity.The full-length genome of the positive yeast finally given is extracted, amplifying target genes are simultaneously sequenced, obtained with Gao Ge
The gene order of the new lysozyme of Lan Shi negative bacterium bactericidal activities.
It should be noted that embodiment described above is only used for explaining the present invention, do not constitute to any of the present invention
Limitation.By referring to exemplary embodiments, invention has been described, it should be appreciated that wherein word used is descriptive
With explanatory vocabulary, rather than limited vocabulary.The present invention can be made within the scope of the claims by regulation
Modification, and the present invention is revised in without departing substantially from scope and spirit of the present invention.Although the present invention described in it is related to
And specific method, material and embodiment, it is not intended that the present invention is limited to wherein disclosed particular case, on the contrary, this hair
It is bright to can be extended to other all methods and applications with identical function.
SEQUENCE LISTING
<110>Beijing Technology and Business University
<120>A kind of high-throughput screening method of New-type wide-spectrum lysozyme
<130> 2017
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 29
<212> DNA
<213> Aplyz-F
<400> 1
tctactcgag aaaagaaagt ggtttacca 29
<210> 2
<211> 25
<212> DNA
<213> Aplyz-R
<400> 2
tcgctgacaa ttcgccggcg tatat 25
<210> 3
<211> 29
<212> DNA
<213>Tussah lysozyme sense primer
<400> 3
tctactcgag aaaagaaagt ggtttacca 29
<210> 4
<211> 25
<212> DNA
<213>Tussah lysozyme anti-sense primer
<400> 4
tatatgcggc cgcttaacag tcgct 25
<210> 5
<211> 31
<212> DNA
<213>The sense primer of people source lysozyme 4
<400> 5
tctactcgag tacatcttag gtagatgtac t 31
<210> 6
<211> 23
<212> DNA
<213>The anti-sense primer of people source lysozyme 4
<400> 6
tatatgcggc cgcttaaagc tta 23
<210> 7
<211> 27
<212> DNA
<213>The sense primer of people source lysozyme gene 6
<400> 7
tctactcgag tctttgattt ctagatg 27
<210> 8
<211> 23
<212> DNA
<213>The anti-sense primer of people source lysozyme gene 6
<400> 8
tatatgcggc cgctcatctc aat 23
<210> 9
<211> 363
<212> DNA
<213>Tussah lysozyme gene
<400> 9
aagtggttta ccaaatgtgg tctagtgcac gagctgagga gacaaggctt cgacgagagc 60
ctaatgagag actgggtctg tttggttgag aacgaaagca gcagatatac taataaaatc 120
ggtaaagtga ataagaatgg ttctcaagac tacggtttgt tccagatcaa tgacaaatat 180
tggtgtagta agacctccac ccccggaaag gattgcaatg tgacttgtaa tcaattgttg 240
actgacgata ttacagttgc tgctacctgt gcgaagaaga tttacaagag acataagttt 300
aacgcttggt acggatggtt aaaccactgt caacactctc ttccagacat tagcgactgt 360
taa 363
<210> 10
<211> 404
<212> DNA
<213>People source lysozyme gene 4
<400> 10
gaattcctcg agtacatctt aggtagatgt actgtcgcaa agaaactgca tgacggaggt 60
ctggattact tcgaaggata ctctcttgag aattgggtgt gcttggccta ttttgagtct 120
aagttcaatc caatggccat atatgaaaat actagagagg gttataccgg atttggattg 180
tttcagatga gaggtagtga ttggtgcggt gaccatggta gaaacagatg tcatatgtca 240
tgttccgcat tattgaaccc aaaccttgaa aaaactatta agtgcgctaa aactattgtt 300
aagggtaaag aaggtatggg tgcttggcct acctggtcta gatattgtca atacagtgat 360
acattggcta gatggctaga cggatgtaag ctttaagcgg ccgc 404
<210> 11
<211> 410
<212> DNA
<213>People source lysozyme gene 6
<400> 11
gaattcctcg agtctttgat ttctagatgc gatttggctc aagttttgca gttggaggac 60
ttggacggtt tcgagggtta ctctttgtct gactggttgt gcttggcctt cgtcgagtct 120
aagttcaaca tctctaagat caacgagaac gccgacggat ctttcgacta cggattgttc 180
cagatcaact ctcactactg gtgcaacgac tacaaatctt actctgagaa cttgtgccat 240
gtcgattgcc aggacttgtt gaacccaaac ttgttggctg gaatccattg cgccaagaga 300
atcgtctctg gagccagagg aatgaacaac tgggtcgagt ggagattgca ctgctctggt 360
agacctttgt tctattggtt gaccggttgc agattgagat gagcggccgc 410
<170>By hand
<210> 12
<211> 7
<212> PRT
<213>TEV protease recognition site
<400> 12
Glu Asn Leu Tyr Phe Gln Gly
1 5
Claims (10)
1. a kind of high-throughput screening method of New-type wide-spectrum lysozyme, it comprises the following steps:
A, secreting, expressing is carried out by the gene mutation library of target lysozyme in eukaryotic, obtains target containing different activities molten
The zymotic fluid of bacterium enzyme;
B, the zymotic fluid of the lysozyme of target containing different activities is added separately to be reacted in reaction system, is filtered out blue to leather
The high lysozyme of family name's negative bacterium bactericidal activity;
Wherein, the reaction system includes:Intracellular expression " the recognition site of donor fluorescent protein-protein enzyme-acceptor fluorescence egg
Gram-negative bacteria, protease and mmp reaction buffer solution in vain ".
2. according to the method described in claim 1, it is characterised in that according to the signal intensity of donor fluorescent albumen in course of reaction
Growth rate, judges the lysozyme in zymotic fluid to Gram-negative bacteria bactericidal activity.
3. method according to claim 1 or 2, it is characterised in that described protease is with recognition sequence specificity
Protease.
4. the method according to any one of claim 1-3, it is characterised in that described protease is TEV protease, intestines
Kinases or factor Xa;Preferably, described protease is TEV protease.
5. method according to claim 4, it is characterised in that the amino acid sequence of the recognition site of the TEV protease
For:Glu-Asn-Leu-Tyr-Phe-Gln-Gly.
6. the method according to any one of claim 1-5, it is characterised in that the target lysozyme gene mutated library
Construction method be fallibility PCR and/or DNA reorganization.
7. the method according to any one of claim 1-6, it is characterised in that the donor fluorescent albumen and acceptor fluorescence
The distance between albumen is when within 10nm, on energy transfer to the acceptor fluorescent protein of donor fluorescent albumen.
8. method according to claim 7, it is characterised in that described donor fluorescent albumen is cyan fluorescent protein, institute
The acceptor fluorescent protein stated is yellow fluorescence protein.
9. the method according to any one of claim 1-8, it is characterised in that the eukaryotic is Pichia pastoris.
10. the method according to any one of claim 1-9, it is characterised in that methods described is further comprising the steps of:
C, secondary screening is carried out to the lysozyme high to Gram-negative bacteria bactericidal activity filtered out, glimmering according to donor in course of reaction
The signal intensity growth rate of photoprotein, verifies the activity of lysozyme.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710284625.9A CN107164457B (en) | 2017-04-26 | 2017-04-26 | High-throughput screening method of broad-spectrum lysozyme |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710284625.9A CN107164457B (en) | 2017-04-26 | 2017-04-26 | High-throughput screening method of broad-spectrum lysozyme |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107164457A true CN107164457A (en) | 2017-09-15 |
CN107164457B CN107164457B (en) | 2021-01-26 |
Family
ID=59813247
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710284625.9A Active CN107164457B (en) | 2017-04-26 | 2017-04-26 | High-throughput screening method of broad-spectrum lysozyme |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107164457B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113846076A (en) * | 2021-08-23 | 2021-12-28 | 青岛农业大学 | Screening method of lysozyme with escherichia coli cracking capability and antibiotic |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1088233A2 (en) * | 1998-06-16 | 2001-04-04 | Biosignal Packard Inc. | A bioluminescence resonance energy transfer (bret) system and its use |
CN1396265A (en) * | 2001-05-24 | 2003-02-12 | 香港科技大学 | Process based on green fluoresin for detecting cell wither |
JP2003321314A (en) * | 2002-02-28 | 2003-11-11 | Pharmafoods Kenkyusho:Kk | Antibacterial composition, its manufacturing method and antibacterial agent containing antibacterial composition |
CN101037710A (en) * | 2006-12-27 | 2007-09-19 | 华中科技大学 | Polynucleotide sequence for detecting matrix metal proteinase activity |
US20090324500A1 (en) * | 2006-05-19 | 2009-12-31 | Stephen Andrew Renshaw | Screen for inflammatory response modulators |
CN105861468A (en) * | 2016-06-07 | 2016-08-17 | 江南大学 | Method for improving antibacterial property of pig lysozyme by fusing N-terminal with HLH functional domain |
CN106011110A (en) * | 2016-06-23 | 2016-10-12 | 浙江工商大学 | Lysozyme with covalent modification through acyl-free sophorolipid derivatives and modifying method and application of lysozyme |
-
2017
- 2017-04-26 CN CN201710284625.9A patent/CN107164457B/en active Active
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1088233A2 (en) * | 1998-06-16 | 2001-04-04 | Biosignal Packard Inc. | A bioluminescence resonance energy transfer (bret) system and its use |
CN1396265A (en) * | 2001-05-24 | 2003-02-12 | 香港科技大学 | Process based on green fluoresin for detecting cell wither |
JP2003321314A (en) * | 2002-02-28 | 2003-11-11 | Pharmafoods Kenkyusho:Kk | Antibacterial composition, its manufacturing method and antibacterial agent containing antibacterial composition |
US20090324500A1 (en) * | 2006-05-19 | 2009-12-31 | Stephen Andrew Renshaw | Screen for inflammatory response modulators |
CN101037710A (en) * | 2006-12-27 | 2007-09-19 | 华中科技大学 | Polynucleotide sequence for detecting matrix metal proteinase activity |
CN105861468A (en) * | 2016-06-07 | 2016-08-17 | 江南大学 | Method for improving antibacterial property of pig lysozyme by fusing N-terminal with HLH functional domain |
CN106011110A (en) * | 2016-06-23 | 2016-10-12 | 浙江工商大学 | Lysozyme with covalent modification through acyl-free sophorolipid derivatives and modifying method and application of lysozyme |
Non-Patent Citations (5)
Title |
---|
HU, HAI-YU等: "FRET-based and other fluorescent proteinase probes", 《BIOTECHNOLOGY JOURNAL》 * |
JUCOVIC, M等: "Delineation of an evolutionary salvage pathway by compensatory mutations of a defective lysozyme", 《PROTEIN SCIENCE》 * |
王成等: "《生物医学光学》", 28 February 2017, 东南大学出版社 * |
续丹丹等: "柞蚕溶菌酶真核表达系统的构建及重组蛋白纯化分析", 《饲料研究》 * |
邢艳珑等: "应用荧光分析法检测酶的研究进展", 《生物工程学报》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113846076A (en) * | 2021-08-23 | 2021-12-28 | 青岛农业大学 | Screening method of lysozyme with escherichia coli cracking capability and antibiotic |
Also Published As
Publication number | Publication date |
---|---|
CN107164457B (en) | 2021-01-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104524564B (en) | A kind of crucian Simplex Virus combination vaccine preparation and preparation method and application | |
CN101736062B (en) | Method for preparing recombinant porcine alpha interferon standard substance | |
CN111205359B (en) | Scyreproxcin as antibacterial peptide of scylla paramamosain and application thereof | |
CN110922457B (en) | Plant immune induced resistance protein FgPII1 secreted by fusarium graminearum and application thereof | |
CN104593388B (en) | Crucian herpesvirus disease JDORF25 vaccine as well as preparation method and application thereof | |
CN106834336A (en) | A kind of heterogenous expression and purification process of Trichoderma harzianum acid protease P6281 | |
CN104593346A (en) | Endolysin from vibrio parahaemolyticus phage and application of endolysin | |
CN107254473A (en) | The insecticidal peptide and application of killing gene PPTX-15 and its coding | |
CN104830825A (en) | Endolysin sourced from salmonella bacteriophage and application thereof | |
CN114807060A (en) | Coxsackie virus A6 type strain and immunogenic composition and application thereof | |
CN107164457A (en) | A kind of high-throughput screening method of New-type wide-spectrum lysozyme | |
CN1687420A (en) | Gene hrpNECCS of multifunctional activity of coded plant and signal factor of broad-spectrum resistance cell, and expression production Harpin ECCS | |
CN104131021A (en) | Antibacterial peptide coexpression vector, construction and expression method thereof | |
CN108103036A (en) | A kind of novel laccase enzyme and its gene, engineering bacteria, preparation and application | |
CN115109131B (en) | Application of polyclonal antibody in preparation of reagent for identifying microsporidian | |
CN101182475B (en) | Pichia yeast highly-effective expression of elastase as well as construction method and uses thereof | |
CN109266676A (en) | A kind of method of electroporated Siam bacillus | |
CN105062906B (en) | A kind of production method optimizing organophosphor hydrolytic enzyme Yeast engineering bacteria and its enzyme | |
CN108586585A (en) | A kind of canine distemper genetic engineering subunit vaccine | |
CN109161489B (en) | Aspergillus niger strain with high yield of acid protease | |
CN109837283B (en) | Preparation and application of citrus natural bacteriostatic protein CsLTP1 | |
CN108441458B (en) | Genetically engineered bacillus amyloliquefaciens capable of effectively preventing and treating gray mold as well as preparation method and application thereof | |
CN113150087A (en) | Plant immune activator protein Fg62 secreted by fusarium graminearum and application thereof | |
CN101831452B (en) | Method for efficiently expressing and producing T4 lysozyme through recombinant trichoderma reesei in inductive mode | |
CN113913450B (en) | Method for expressing chitosanase by rhodopseudomonas palustris, chitosanase, recombinant plasmid, recombinant bacteria, fermentation bacteria and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |