CN107164402B - Gene editing vector based on CRISPR-Cas9 system and application thereof - Google Patents

Abstract

The invention provides a genome editing vector based on a CRISPR-Cas9 system and application thereof, belongs to the field of plant genetic engineering, and particularly relates to a wheat genome editing vector based on a CRISPR-Cas9 system and application thereof. According to the invention, by comparing the transformation vectors of the CRISPR-Cas9 system and adopting the gene editing efficiency of different Cas9 promoters, different sgRNA promoters and different sgRNA sequence structures, the CRISPR-Cas9 transformation vector with higher editing efficiency in wheat is obtained. The optimized vector remarkably improves the efficiency of gene editing by using the CRISPR-Cas9 in wheat crops, overcomes the problems of low mutation rate and difficult acquisition of CRISPR-Cas9 transgenic mutant strains after the CRISPR-Cas9 vector is transformed in the crops such as wheat and the like, saves the transformation time, reduces the transformation cost, and lays a better foundation for the popularization and application of a CRISPR-Cas9 gene editing system in the crops.

Description

Gene editing vector based on CRISPR-Cas9 system and application thereof

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a wheat genome editing vector based on a CRISPR-Cas9 system and application thereof.

Background

Since the end of the 80's last century, artificial endonuclease-based genetic modification techniques began to develop, and currently mainly included: the technology comprises a first generation artificial endonuclease Zinc Finger Nuclease (ZFN) technology, a second generation artificial endonuclease transcription activator-like effector nuclease (TALEN) technology and a third generation artificial endonuclease CRISPR-Cas9 nuclease technology. The specific recognition capability of the ZFN technology is poor, and the off-target phenomenon is easy to occur, so that other target gene mutation and chromosome aberration are caused. In addition, design and screening of ZFNs is time consuming, labor intensive, and costly, thus limiting their wider application. Compared with the ZFN technology, the TALEN has small off-target probability and small cytotoxicity, and is widely applied once. As an emerging gene editing technology, CRISPR-Cas9 has the unparalleled advantage of 1. higher targeting accuracy. The RNA targeting sequence and the genomic sequence must be perfectly matched before Cas9 will cleave the DNA. 2. Can realize the simultaneous knockout of a plurality of loci of the target gene. 3. The experimental period is short, and the efficiency is high. 4. Multiple targets and no species limitation.

Wheat is an allohexaploid consisting of A, B, D sets of genomes, the average copy number of genes is 2.8, wherein nearly half of the genes (46%) have 3-4 copies, 12% of the genes have 1-2 copies, and 42% of the gene copy number is more than or equal to 5, so that a recombinase-mediated gene superposition transgenic operation system is urgently needed to be established in the wheat to realize DNA superposition/deletion, and a target strain with independent intellectual property rights is developed in the wheat by utilizing the system. Compared with traditional genome editing technologies ZFN and TALEN, the method has the advantages that the CRISPR-Cas9 site-directed mutagenesis is utilized, the cost is lower, the operation is easier, the efficiency is higher, the homozygote mutant is easier to obtain, and the method has important significance for the research of the wheat gene function.

The high Cabernet Sauvignon laboratory of the institute of genetics and developmental biology of Chinese academy of sciences is engaged in the technical study of the fixed-point editing of plant genomes, and a TALEN nuclease-mediated gene fixed-point mutation technical system is established in plant species such as brachypodium distachyon and rice. In 2014, the laboratory utilizes A CRISPR-Cas9 system to realize site-directed mutation of TaMLO-A in bread wheat protoplasts and transgenic plants. The vector of the CRISPR-Cas9 gene editing system comprises two expression frames, namely a sgRNA expression frame and a Cas9 expression frame, a Cas9 gene expressed by the Cas9 expression frame encodes a nuclease, and the sgRNA with a target sequence expressed by the sgRNA expression frame guides the Cas9 nuclease to cut a DNA double strand at the position of the target sequence on a genome. The expression levels of Cas9 gene and sgRNA, as well as the sequence structure of sgRNA, all affect gene editing efficiency.

Based on the technical background, the CRISPR-Cas9 transformation vector with higher editing efficiency in wheat is obtained by comparing the gene editing efficiency of the transformation vector of the CRISPR-Cas9 system and adopting different Cas9 promoters, different sgRNA promoters and different sgRNA sequence structures. The optimized vector remarkably improves the efficiency of gene editing by using the CRISPR-Cas9 in wheat crops, overcomes the problems of low mutation rate and difficult acquisition of CRISPR-Cas9 transgenic mutant strains after the CRISPR-Cas9 vector is transformed in the crops such as wheat and the like, saves the transformation time, reduces the transformation cost, and lays a better foundation for the popularization and application of a CRISPR-Cas9 gene editing system in the crops.

Disclosure of Invention

All references mentioned herein are incorporated herein by reference.

Unless defined to the contrary, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless indicated to the contrary, the techniques used or referred to herein are standard techniques well known to those of ordinary skill in the art. The materials, methods, and examples are illustrative only and not intended to be limiting.

The invention provides a CRISPR-Cas9 gene editing system with higher gene editing efficiency, which can be widely applied to different crops, wherein the crops comprise but are not limited to corn, wheat, rape, rice, sorghum, soybean, barley, millet and the like.

In order to improve the gene editing efficiency in crops, the sgRNA sequence structure in a CRISPR-Cas9 system is modified and optimized, the modified sgRNA structure is named as sgRNA4TmC +5, and the nucleotide sequence is shown as SEQ ID NO: 20. Experiments show that the gene editing efficiency of the CRRISPR/Cas9 system with the sgRNA structure of sgRNA4TmC +5(SEQ ID NO:20) is superior to that of the traditional sgRNA structure and tRNA-gRNA structure after the system is transferred into a wheat plant.

In the CRISPR-Cas9 gene editing vector provided by the invention, a promoter is also linked in front of a sgRNA4TmC +5 structure, and the promoter comprises, but is not limited to, TaU3p, OsU3p, TaU6, OsU6bp and the like, and is preferably a TaU3 promoter. The CRISPR-Cas9 gene editing system also comprises a Cas9 gene, and the nucleotide sequence of the Cas9 gene is shown as SEQ ID NO. 5. More specifically, the Cas9 gene is operably linked to a promoter in front of it to drive its expression, including but not limited to Ubi and 2 × 35S promoters, preferably Ubi promoter.

The invention also provides a CRISPR-Cas9 editing method of the plant gene, wherein the sgRNA structure in the method is sgRNA4TmC +5, and the nucleotide sequence is shown as SEQ ID NO: 20.

In the CRISPR-Cas9 gene editing method provided by the invention, a promoter is also linked in front of a sgRNA4TmC +5 structure, and the promoter comprises, but is not limited to, TaU3p, OsU3p, TaU6, OsU6bp and the like, and is preferably a TaU3 promoter.

Specifically, the CRISPR-Cas9 gene editing method further comprises a Cas9 gene, and the nucleotide sequence of the Cas9 gene is shown as SEQ ID NO. 5. More specifically, the Cas9 gene is operably linked to a promoter in front of it to drive its expression, including but not limited to Ubi and 2 × 35S promoters, preferably Ubi promoter.

The CRISPR-Cas9 gene editing vector and the method provided by the invention can be applied to editing the genome DNA of different plants, wherein the editing comprises but is not limited to that the base deletion or insertion of the plant genome DNA occurs through the system; it also includes the application in the fields of conditional gene knockout, gene knock-in, gene replacement, point mutation, etc.

The invention also provides a method for obtaining the wheat powdery mildew resistant mutant, which adopts a CRISPR-Cas9 gene editing method and is characterized in that a target sequence of the gene editing system is shown as SEQ ID NO. 2.

The method for obtaining the wheat powdery mildew resistant mutant, provided by the invention, has the advantages that the sgRNA structure in the CRISPR-Cas9 gene editing method is a sgRNA4TmC +5 structure, and the nucleotide sequence of the sgRNA4TmC +5 structure is shown as SEQ ID NO: 20.

Compared with the prior art, the CRISPR-Cas9 gene editing method and the vector provided by the invention have the advantages that: the editing efficiency of the wheat CRISPR-Cas9 is remarkably improved, the problems that the mutation rate is low after the wheat CRISPR-Cas9 vector is transformed, and a CRISPR-Cas9 transgenic mutant strain is difficult to obtain are solved, the transformation time is saved, and the transformation cost is reduced.

Drawings

FIG. 1 is a schematic diagram of the structures of p286 and p294 vectors. TaMLO-A is A target sequence on A wheat TaMLO-A gene, sgRNA is A single guide RNA coding sequence, and Amp is A carrier ampicillin resistance locus.

FIG. 2 is a graph showing the comparison of gene editing efficiency between p286 and p294 vectors. plasmid for plasmid, Dra II restriction enzyme, "+/-" added/not added Dra II endonuclease, respectively, and Mutation rate for Mutation efficiency.

FIG. 3 is a schematic diagram of the carrier structures of p342, p338, p295 and p 341. Target sequence on L475 wheat genome, sgRNA is single guide RNA coding sequence, Amp is carrier ampicillin resistance locus.

FIG. 4 is a graph showing the comparison of gene editing efficiency of p342, p338, p295 and p341 vectors. plasmid for plasmid, BanI restriction enzyme, "+/-" respectively with/without BanI endonuclease, Mutation rate for Mutation efficiency.

FIG. 5 is a schematic diagram of the structures of p345 and p349 carriers. Target sequence on L475 wheat genome, sgRNA is single guide RNA coding sequence, sgRNA4TmC +5 is optimized single guide RNA coding sequence, tRNA is tRNA^GlyCoding sequence, Amp is carrier ampicillin resistance locus.

FIG. 6 is a graph showing the comparison results of gene editing efficiencies of p342, p345 and p349 vectors. plasmid for plasmid, BanI restriction enzyme, "+/-" respectively with/without BanI endonuclease, Mutation rate for Mutation efficiency.

Detailed Description

The present invention will be described in further detail with reference to specific examples, but the present invention is not limited to the following examples. In the present invention, unless otherwise specified, the starting materials are commercially available and the method is a conventional method in the art.

The first embodiment is as follows: selection of promoters for driving Cas9 Gene

In the experiment, A nucleotide sequence on A TaMLO-A gene of A wheat powdery mildew gene is used as A target sequence, and the vector of A CRISPR-Cas9 system is optimized by comparing the gene editing efficiency of the CRISPR-Cas9 system vector when different promoters drive the expression of A Cas9 gene.

1. Description of the vectors

The p286 vector and the p294 vector both comprise two expression frames, namely, an sgRNA expression frame and a Cas9 expression frame, and the difference is that the promoter of the Cas9 expression frame is different, the p286 vector adopts a 2 x 35s promoter to drive the expression of a Cas9 gene, and the p294 vector adopts a ubi promoter to drive the expression of a Cas9 gene. In particular:

the p286 vector included TaU6p: (TaMLO-A-sgRNA) expression cassette and 2 × 35s: (Cas 9) expression cassette. TaU6 < 6 > 6p > the TaMLO-A-sgRNA expression cassette element comprises TaU6 < 6 > 6p promoter (SEQ ID NO:1), target sequence on TaMLO-A gene (SEQ ID NO:2) and sgRNA scaffold (SEQ ID NO: 3); TaU6 promoter 6p is derived from wheat CB037, target sequence on TaMLO-A gene and sgRNA scaffold as artificially synthesized fragments according to published sequences. Cas9 expression cassettes include the 2 x 35s promoter (SEQ ID NO:4), the Cas9 fragment (SEQ ID NO:5) and the CaMV terminator (SEQ ID NO: 6); 2 × 35s promoter and CaMV terminator are respectively derived from plasmids pGIGI and pLGZ2, Cas9 is a fragment artificially synthesized according to published sequences (Yanpeng Wang, Xi Cheng, Qiwei Shan, Yi Zhang, Jinxing Liu, Caixia Gao & Jin-Long Qi. Simultaneous edition of three homo alloles in hexaploid branched broad synthetic genes whose reliability and productivity of products of great benefit mill, Nat. bioto.2014, 32: 947-951). The p286 carrier structure is shown in FIG. 1A.

The p294 vector comprises TaU6p:: TaMLO-A-sgRNA and Ubi:: Cas9 two expression cassettes. TaU6p TaMLO-A-sgRNA expression cassette is as described above, Ubi:: Cas9 expression cassette includes Ubi promoter (SEQ ID NO:7), Cas9 gene (SEQ ID NO:5) and CaMV terminator (SEQ ID NO:6), and Ubi promoter is derived from wheat gene gun conventional transformation vector PAHC 20. The p294 vector structure is shown in FIG. 1B.

2. Comparison of Gene editing efficiency for different vectors

The P286, P294 and GFP plasmids are transformed into wheat leaf protoplast by using a PEG method, and the GFP plasmid is used as a positive control for protoplast transformation and a negative control for gene editing. After culturing at 24 ℃ for 48 hours, protoplasts were collected.

The gene editing efficiency of different plasmids was tested and compared by PCR/RE (Polymerase Chain Reaction/Restriction digest) method.

Firstly, extracting the genome DNA of the protoplast, amplifying TaMLO-A segments, and detecting through agarose gel electrophoresis, wherein the amplified target band is single. The amplification primers were as follows:

P1：5’-TGGCGCTGGTCTTCGCCGTCATGATCATCGTC-3’(SEQ ID NO:8)

P2：5’-TACGATGAGCGCCACCTTGCCCGGGAA-3’(SEQ ID NO:9)

then, the PCR product was cleaved with restriction enzyme DraII (restriction site contained in the target sequence) and detected by electrophoresis. The results are shown in FIG. 2: the GFP sample as a negative control for gene editing was completely cleaved with the enzyme, whereas the PCR products transformed with the p286 and p294 plasmids were not completely cleaved. The percent of uncut DNA fragments to the total amount of digested DNA, i.e.the mutation efficiency of the sample, was calculated by ImageJ software. The mutation rate of the p286 sample is 2.6%, the mutation rate of the p294 sample is 7.6%, and the mutation efficiency of the p294 sample is higher than that of the p286 sample, so the Ubi-Cas9 editing efficiency is better than 2 x 35SCas9 in the wheat CRISPR-Cas9 transformation system. The result shows that in the CRISPR-Cas9 gene editing system for wheat, the Ubi promoter is used for driving the expression of Cas9, so that the editing efficiency of the CRISPR-Cas9 gene editing system can be improved.

Example two selection of promoters for driving sgRNA expression

In order to further improve the editing efficiency of the wheat CRISPR-Cas9, the editing efficiency of the CRISPR-Cas9 vector on wheat genome sequence when different snoRNA promoters drive sgRNA expression in a wheat protoplast system is compared. At present, the methodPlant and method for producing the sameAmong the snoRNA promoters commonly used to drive sgRNA expression are TaU3p (SEQ ID NO:10), OsU3p (SEQ ID NO:11), TaU6(SEQ ID NO:1) and OsU6bp (SEQ ID NO:12), which are also several promoters with which the present experiment focuses on.

1. Description of the vectors

The p342 vector (fig. 3A), the p338 vector (fig. 3B), the p295 vector (fig. 3C), and the p341 vector (fig. 3D) each contained two expression cassettes, a sgRNA expression cassette and a Cas9 expression cassette. Cas9 expression cassettes all include a Ubi promoter (SEQ ID NO:7), a Cas9 fragment (SEQ ID NO:5) and a CaMV terminator (SEQ ID NO:6), and target sequences are all wheat genome sequences L475(SEQ ID NO:13), and differences exist in promoters driving sgRNA expression. The p343 vector uses TaU3 promoter (SEQ ID NO:10) and is derived from spring wheat of China; the p339 vector uses OsU3 promoter (SEQ ID NO:11) and is derived from rice Zhonghua 11; the p340 vector uses TaU6 promoter (SEQ ID NO:1) and is derived from wheat CB 037; the p333 vector used was OsU6b promoter (SEQ ID NO:12), which was derived from Nipponbare rice.

2. Comparison of Gene editing efficiency for different vectors

The p342, p338, p295, p341 and GFP plasmids were transformed into wheat leaf protoplasts by the PEG method, and the GFP plasmid was used as a positive control for protoplast transformation and a negative control for gene editing. After culturing at 24 ℃ for 48 hours, protoplasts were collected. The gene editing efficiency of different plasmids is detected and compared by utilizing a PCR/RE (Polymerase Chain Reaction/Restriction digest) method, and the specific steps are as follows:

first, genomic DNA of protoplasts was extracted, and a DNA fragment containing the target sequence L475 was amplified. Since wheat is an allohexaploid composed of A, B, D three sets of genomes, each containing the target sequence L475(SEQ ID NO.13), it is necessary to amplify DNA fragments containing the target sequence L475 in the three sets of genomes, L475A, L475B and L475D, respectively. The amplification primers were as follows:

P3：5’-TTCGGGGTTTTGCATGTCAGCTAGTACGGAG-3’(SEQ ID NO:14)

P4：5’-GTGGACACGAACCGCTGC-3’(SEQ ID NO:15)

P5：5’-GACGCTGTGATGATCAATGGTGCCGTG-3’(SEQ ID NO:16)

P6：5’-AGCGCGTCCGTGAAGTGCTCCTGGTTC-3’(SEQ ID NO:17)

P7：5’-GACGCTGTGATGACCAATGGTGCCATAC-3’(SEQ ID NO:18)

P8：5’-CGACGTGTCGGCCAGCGCA-3’(SEQ ID NO:19)

wherein P3 and P4 are used for amplification of L475A, P5 and P6 are used for amplification of L475B, and P7 and P8 are used for amplification of L475D. And detecting by agarose gel electrophoresis, wherein amplified target bands are single.

Then, the PCR product was cleaved with restriction enzyme BanI (restriction enzyme site contained in the target sequence) and detected by electrophoresis. The results are shown in FIG. 4: the GFP samples used as negative controls for gene editing were completely cleaved with the enzyme, whereas the PCR products transformed with the p342, p338, p295 and p341 plasmids were not completely cleaved. The percent of uncut DNA fragments to the total amount of digested DNA, i.e.the mutation efficiency of the sample, was calculated by ImageJ software. The mutation rate of L475A is 10.4%, 4.5%, 0.2% and 4.6% in sequence; the mutation rate of L475B is 11.3%, 4.2%, 0% and 3.0% in sequence; the mutation rate of L475D was 9.1%, 3.0%, 0.3%, 3.6% in this order. The result shows that in the CRISPR-Cas9 gene editing system for wheat, expression of sgRNA is driven by the TaU3 promoter, and the editing efficiency of the CRISPR-Cas9 gene editing system can be further improved.

Example screening of different sequence structures of the three sgRNAs

In the research of a rice CRRISPR-Cas9 gene editing system, the expression of sgRNA can be improved by expressing the sgRNA by using a tRNA transcription system, so that the gene editing efficiency of CRRISPR-Cas9 is improved; in human cell research, the gene editing efficiency of the CRISPR-Cas9 system with different sgRNA sequence structures is found to be very different. In wheat, there has been no study and report on the influence of sgRNA expression patterns and sequence structures thereof on gene editing efficiency. In order to further optimize the vector of the wheat CRISPR-Cas9 system and improve the editing efficiency of the wheat genome sequence, the gene editing efficiency of the CRISPR-Cas9 vector containing different sgRNA sequence structures is compared by taking the wheat genome sequence L475 as a target sequence (SEQ ID NO: 13).

1. Description of the vectors

The p342 (fig. 3A), p345 (fig. 5A) and p349 (fig. 5B) and p341 (fig. 3D) vectors each comprise two expression cassettes-a sgRNA expression cassette and a Cas9 expression cassette. Cas9 expression cassettes all comprise a Ubi promoter (SEQ ID NO:7), a Cas9 fragment (SEQ ID NO:5) and a CaMV terminator (SEQ ID NO:6), target sequences are wheat genome sequences L475(SEQ ID NO:13), promoters driving sgRNA expression are TaU3 promoters, and the difference is that the sequence structures of sgRNAs are different. The sgRNA in the p342 vector is the sgRNA sequence most commonly used at present (SEQ ID NO: 3); the sgRNA in the p345 vector is sgRNA4TmC +5(SEQ ID NO:20, artificial synthesis); tRNA (SEQ ID NO:21, from wheat in spring of China) is added in front of sgRNA in the p349 vector, and a target sequence is positioned between the tRNA and the sgRNA.

2. Comparison of Gene editing efficiency for different vectors

The P342, P345, P349 and GFP plasmids are transformed into wheat leaf protoplasts by a PEG method, and the GFP plasmids are used as a positive control for protoplast transformation and a negative control for gene editing. After culturing at 24 ℃ for 48 hours, protoplasts were collected. The gene editing efficiency of different plasmids is detected and compared by utilizing a PCR/RE (Polymerase Chain Reaction/Restriction digest) method, and the specific steps are as follows:

first, genomic DNA of protoplasts was extracted, and a DNA fragment containing the target sequence L475 was amplified. Since wheat is an allohexaploid composed of A, B, D sets of genomes, all of which contain the target sequence L475, it is necessary to amplify DNA fragments containing the target sequence L475 in the sets of genomes, namely L475A, L475B and L475D, respectively. The amplified primers are detected by agarose gel electrophoresis as in the second example, and the amplified target bands are all single.

Then, the PCR product was cleaved with restriction enzyme BanI (restriction enzyme site contained in the target sequence) and detected by electrophoresis. The results are shown in FIG. 6: the GFP samples used as negative controls for gene editing were completely cleaved with the enzyme, whereas the PCR products transformed with the p342, p345 and p349 plasmids were not. The percent of uncut DNA fragments to the total amount of digested DNA, i.e.the mutation efficiency of the sample, was calculated by ImageJ software. The mutation rate of L475A is calculated to be 12.1%, 31.8% and 8.2% in sequence; the mutation rate of L475B is 11.6%, 22.8% and 7.8% in sequence; the mutation rate of L475D was 7.7%, 19.7%, 4.9% in this order. The result shows that in the CRISPR-Cas9 gene editing system for wheat, when sgRNA is sgRNA4TmC +5 sequence (SEQ ID NO:20), the editing efficiency of the CRISPR-Cas9 system can be obviously improved.

In conclusion, the invention systematically compares the influence of the sequence structures of a promoter driving Cas9 gene expression, a promoter driving sgRNA expression and sgRNA on the wheat gene editing efficiency, and the results show that the Ubi promoter is superior to 2 × 35S promoter, the TaU3 promoter is superior to OsU3 promoter, TaU6 promoter and OsU6b promoter, and the sgRNA4TmC +5 is superior to the traditional sgRNA and tRNA-gRNA structures. By combining the results, the optimized vector TaU3p of the wheat CRRISPR-Cas9, SgRNA4TmC +5-Ubi, Cas9-PUC19 are finally obtained. The optimized vector can remarkably improve the editing efficiency of the wheat CRISPR-Cas9, overcome the problems of low transformation mutation rate of the wheat CRISPR-Cas9 and difficulty in obtaining CRISPR-Cas9 transgenic mutant strains, save transformation time and reduce transformation cost.

SEQUENCE LISTING

<110> Ming Xingwang System crop design front laboratory (Beijing) Co., Ltd

<120> gene editing vector based on CRISPR-Cas9 system and application thereof

<130>

<160>21

<170>PatentIn version 3.3

<210>1

<211>360

<212>DNA

<213> wheat (Triticum aestivuml)

<400>1

gaccaagccc gttattctga cagttctggt gctcaacaca tttatattta tcaaggagca 60

cattgttact cactgctagg agggaatcga actaggaata ttgatcagag gaactacgag 120

agagctgaag ataactgccc tctagctctc actgatctgg gcgcatagtg agatgcagcc 180

cacgtgagtt cagcaacggt ctagcgctgg gcttttaggc ccgcatgatc gggctttgtc 240

gggtggtcga cgtgttcacg attggggaga gcaacgcagc agttcctctt agtttagtcc 300

cacctcgcct gtccagcaga gttctgaccg gtttataaac tcgcttgctg catcagactt 360

<210>2

<211>20

<212>DNA

<213> wheat (Triticum aestivuml)

<400>2

ggagattggg tcctgcgtga 20

<210>3

<211>112

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>3

gctcgcaggt gaacacaaca cctgcacacg ttttagagct agaaatagca agttaaaata 60

aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt tt 112

<210>4

<211>766

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>4

cctactccaa aaatgtcaaa gatacagtct cagaagacca aagggctatt gagacttttc 60

aacaaagggt aatttcggga aacctcctcg gattccattg cccagctatc tgtcacttca 120

tcgaaaggac agtagaaaag gaaggtggct cctacaaatg ccatcattgc gataaaggaa 180

aggctatcat tcaagatgcc tctgccgaca gtggtcccaa agatggaccc ccacccacga 240

ggagcatcgt ggaaaaagaa gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg 300

acatctccac tgacgtaagg gatgacgcac aatcccaccc ctactccaaa aatgtcaaag 360

atacagtctc agaagaccaa agggctattg agacttttca acaaagggta atttcgggaa 420

acctcctcgg attccattgc ccagctatct gtcacttcat cgaaaggaca gtagaaaagg 480

aaggtggctc ctacaaatgc catcattgcg ataaaggaaa ggctatcatt caagatgcct 540

ctgccgacag tggtcccaaa gatggacccc cacccacgag gagcatcgtg gaaaaagaag 600

acgttccaac cacgtcttca aagcaagtgg attgatgtga catctccact gacgtaaggg 660

atgacgcacaatcccactat ccttcgcaag acccttcctc tatataagga agttcatttc 720

atttggagag gacagcccaa gcttccacca tggcgtgcag gtcgac 766

<210>5

<211>4206

<212>DNA

<213> Artificial Synthesis

<400>5

atggccccta agaagaagag aaaggtcggt attcacggcg ttcctgcggc gatggacaag 60

aagtatagta ttggtctgga cattgggacg aattccgttg gctgggccgt gatcaccgat 120

gagtacaagg tcccttccaa gaagtttaag gttctgggga acaccgatcg gcacagcatc 180

aagaagaatc tcattggagc cctcctgttc gactcaggcg agaccgccga agcaacaagg 240

ctcaagagaa ccgcaaggag acggtataca agaaggaaga ataggatctg ctacctgcag 300

gagattttca gcaacgaaat ggcgaaggtg gacgattcgt tctttcatag attggaggag 360

agtttcctcg tcgaggaaga taagaagcac gagaggcatc ctatctttgg caacattgtc 420

gacgaggttg cctatcacga aaagtacccc acaatctatc atctgcggaa gaagcttgtg 480

gactcgactg ataaggcgga ccttagattg atctacctcg ctctggcaca catgattaag 540

ttcaggggcc attttctgat cgagggggat cttaacccgg acaatagcga tgtggacaag 600

ttgttcatcc agctcgtcca aacctacaat cagctctttg aggaaaaccc aattaatgct 660

tcaggcgtcg acgccaaggc gatcctgtct gcacgccttt caaagtctcg ccggcttgag 720

aacttgatcg ctcaactccc gggcgaaaag aagaacggct tgttcgggaa tctcattgca 780

ctttcgttgg ggctcacacc aaacttcaag agtaattttg atctcgctga ggacgcaaag 840

ctgcagcttt ccaaggacac ttatgacgat gacctggata accttttggc ccaaatcggc 900

gatcagtacg cggacttgtt cctcgccgcg aagaatttgt cggacgcgat cctcctgagt 960

gatattctcc gcgtgaacac cgagattaca aaggccccgc tctcggcgag tatgatcaag 1020

cgctatgacg agcaccatca ggatctgacc cttttgaagg ctttggtccg gcagcaactc 1080

ccagagaagt acaaggaaat cttctttgat caatccaaga acggctacgc tggttatatt 1140

gacggcgggg catcgcagga ggaattctac aagtttatca agccaattct ggagaagatg 1200

gatggcacag aggaactcct ggtgaagctc aatagggagg accttttgcg gaagcaaaga 1260

actttcgata acggcagcat ccctcaccag attcatctcg gggagctgca cgccatcctg 1320

agaaggcagg aagacttcta cccctttctt aaggataacc gggagaagat cgaaaagatt 1380

ctgacgttca gaattccgta ctatgtcgga ccactcgccc ggggtaattc cagatttgcg 1440

tggatgacca gaaagagcga ggaaaccatc acaccttgga acttcgagga agtggtcgat 1500

aagggcgctt ccgcacagag cttcattgag cgcatgacaa attttgacaa gaacctgcct 1560

aatgagaagg tccttcccaa gcattccctc ctgtacgagt atttcactgt ttataacgaa 1620

ctcacgaagg tgaagtatgt gaccgaggga atgcgcaagc ccgccttcct gagcggcgag 1680

caaaagaagg cgatcgtgga ccttttgttt aagaccaatc ggaaggtcac agttaagcag 1740

ctcaaggagg actacttcaa gaagattgaa tgcttcgatt ccgttgagat cagcggcgtg 1800

gaagacaggt ttaacgcgtc actggggact taccacgatc tcctgaagat cattaaggat 1860

aaggacttct tggacaacga ggaaaatgag gatatcctcg aagacattgt cctgactctt 1920

acgttgtttg aggataggga aatgatcgag gaacgcttga agacgtatgc ccatctcttc 1980

gatgacaagg ttatgaagca gctcaagaga agaagataca ccggatgggg aaggctgtcc 2040

cgcaagctta tcaatggcat tagagacaag caatcaggga agacaatcct tgactttttg 2100

aagtctgatg gcttcgcgaa caggaatttt atgcagctga ttcacgatga ctcacttact 2160

ttcaaggagg atatccagaa ggctcaagtg tcgggacaag gtgacagtct gcacgagcat 2220

atcgccaacc ttgcgggatc tcctgcaatc aagaagggta ttctgcagac agtcaaggtt 2280

gtggatgagc ttgtgaaggt catgggacgg cataagcccg agaacatcgt tattgagatg 2340

gccagagaaa atcagaccac acaaaagggt cagaagaact cgagggagcg catgaagcgc 2400

atcgaggaag gcattaagga gctggggagt cagatcctta aggagcaccc ggtggaaaac 2460

acgcagttgc aaaatgagaa gctctatctg tactatctgc aaaatggcag ggatatgtat 2520

gtggaccagg agttggatat taaccgcctc tcggattacg acgtcgatca tatcgttcct 2580

cagtccttcc ttaaggatga cagcattgac aataaggttc tcaccaggtc cgacaagaac 2640

cgcgggaagt ccgataatgt gcccagcgag gaagtcgtta agaagatgaa gaactactgg 2700

aggcaacttt tgaatgccaa gttgatcaca cagaggaagt ttgataacct cactaaggcc 2760

gagcgcggag gtctcagcga actggacaag gcgggcttca ttaagcggca actggttgag 2820

actagacaga tcacgaagca cgtggcgcag attctcgatt cacgcatgaa cacgaagtac 2880

gatgagaatg acaagctgat ccgggaagtg aaggtcatca ccttgaagtc aaagctcgtt 2940

tctgacttca ggaaggattt ccaattttat aaggtgcgcg agatcaacaa ttatcaccat 3000

gctcatgacg catacctcaa cgctgtggtc ggaacagcat tgattaagaa gtacccgaag 3060

ctcgagtccg aattcgtgta cggtgactat aaggtttacg atgtgcgcaa gatgatcgcc 3120

aagtcagagc aggaaattgg caaggccact gcgaagtatt tcttttactc taacattatg 3180

aatttcttta agactgagat cacgctggct aatggcgaaa tccggaagag accacttatt 3240

gagaccaacg gcgagacagg ggaaatcgtg tgggacaagg ggagggattt cgccacagtc 3300

cgcaaggttc tctctatgcc tcaagtgaat attgtcaaga agactgaagt ccagacgggc 3360

gggttctcaa aggaatctat tctgcccaag cggaactcgg ataagcttat cgccagaaag 3420

aaggactggg acccgaagaa gtatggaggt ttcgactcac caacggtggc ttactctgtc 3480

ctggttgtgg caaaggtgga gaagggaaag tcaaagaagc tcaagtctgt caaggagctc 3540

ctgggtatca ccattatgga gaggtccagc ttcgaaaaga atccgatcga ttttctcgag 3600

gcgaagggat ataaggaagt gaagaaggac ctgatcatta agcttccaaa gtacagtctt 3660

ttcgagttgg aaaacggcag gaagcgcatg ttggcttccg caggagagct ccagaagggt 3720

aacgagcttg ctttgccgtc caagtatgtg aacttcctct atctggcatc ccactacgag 3780

aagctcaagg gcagcccaga ggataacgaa cagaagcaac tgtttgtgga gcaacacaag 3840

cattatcttg acgagatcat tgaacagatt tcggagttca gtaagcgcgt catcctcgcc 3900

gacgcgaatt tggataaggt tctctcagcc tacaacaagc accgggacaa gcctatcaga 3960

gagcaggcgg aaaatatcat tcatctcttc accctgacaa accttggggc tcccgctgca 4020

ttcaagtatt ttgacactac gattgatcgg aagagataca cttctacgaa ggaggtgctg 4080

gatgcaaccc ttatccacca atcgattact ggcctctacg agacgcggat cgacttgagt 4140

cagctcgggg gggataagag accagcggca accaagaagg caggacaagc gaagaagaag 4200

aagtag 4206

<210>6

<211>728

<212>DNA

<213> Artificial Synthesis

<400>6

ggtacgctga aatcaccagt ctctctctac aaatctatct ctctctattt tctccataaa 60

taatgtgtga gtagtttccc gataagggaa attagggttc ttatagggtt tcgctcatgt 120

gttgagcata taagaaaccc ttagtatgta tttgtatttg taaaatactt ctatcaataa 180

aatttctaat tcctaaaacc aaaatccagt actaaaatcc agatctccta aagtccctat 240

agatctttgt cgtgaatata aaccagacac gagacgacta aacctggagc ccagacgccg 300

ttcgaagcta gaagtaccgc ttaggcagga ggccgttagg gaaaagatgc taaggcaggg 360

ttggttacgt tgactccccc gtaggtttgg tttaaatatg atgaagtgga cggaaggaag 420

gaggaagaca aggaaggata aggttgcagg ccctgtgcaa ggtaagaaga tggaaatttg 480

atagaggtac gctactatac ttatactata cgctaaggga atgcttgtat ttatacccta 540

taccccctaa taacccctta tcaatttaag aaataatccg cataagcccc cgcttaaaaa 600

ttggtatcag agccatgaat aggtctatga ccaaaactca agaggataaa acctcaccaa 660

aatacgaaag agttcttaac tctaaagata aaagatcttt caagatcaaa actagttccc 720

tcacaccg 728

<210>7

<211>1988

<212>DNA

<213> corn (Zea mays)

<400>7

gtgcagcgtg acccggtcgt gcccctctct agagataatg agcattgcat gtctaagtta 60

taaaaaatta ccacatattt tttttgtcac acttgtttga agtgcagttt atctatcttt 120

atacatatat ttaaacttta ctctacgaat aatataatct atagtactac aataatatca 180

gtgttttaga gaatcatata aatgaacagt tagacatggt ctaaaggaca attgagtatt 240

ttgacaacag gactctacag ttttatcttt ttagtgtgca tgtgttctcc tttttttttg 300

caaatagctt cacctatata atacttcatc cattttatta gtacatccat ttagggttta 360

gggttaatgg tttttataga ctaatttttt tagtacatct attttattct attttagcct 420

ctaaattaag aaaactaaaa ctctatttta gtttttttat ttaataattt agatataaaa 480

tagaataaaa taaagtgact aaaaattaaa caaataccct ttaagaaatt aaaaaaacta 540

aggaaacatt tttcttgttt cgagtagata atgccagcct gttaaacgcc gtcgacgagt 600

ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa gcagacggca 660

cggcatctct gtcgctgcct ctggacccct ctcgagagtt ccgctccacc gttggacttg 720

ctccgctgtc ggcatccaga aattgcgtgg cggagcggca gacgtgagcc ggcacggcag 780

gcggcctcct cctcctctca cggcaccggc agctacgggg gattcctttc ccaccgctcc 840

ttcgctttcc cttcctcgcc cgccgtaata aatagacacc ccctccacac cctctttccc 900

caacctcgtg ttgttcggag cgcacacaca cacaaccaga tctcccccaa atccacccgt 960

cggcacctcc gcttcaaggt acgccgctcg tcctcccccc ccccccctct ctaccttctc 1020

tagatcggcg ttccggtcca tggttagggc ccggtagttc tacttctgtt catgtttgtg 1080

ttagatccgt gtttgtgtta gatccgtgct gctagcgttc gtacacggat gcgacctgta 1140

cgtcagacac gttctgattg ctaacttgcc agtgtttctc tttggggaat cctgggatgg 1200

ctctagccgt tccgcagacg ggatcgattt catgattttt tttgtttcgt tgcatagggt 1260

ttggtttgcc cttttccttt atttcaatat atgccgtgca cttgtttgtc gggtcatctt 1320

ttcatgcttt tttttgtctt ggttgtgatg atgtggtctg gttgggcggt cgttctagat 1380

cggagtagaa ttctgtttca aactacctgg tggatttatt aattttggat ctgtatgtgt 1440

gtgccataca tattcatagt tacgaattga agatgatgga tggaaatatc gatctaggat 1500

aggtatacat gttgatgcgg gttttactga tgcatataca gagatgcttt ttgttcgctt 1560

ggttgtgatg atgtggtgtg gttgggcggt cgttcattcg ttctagatcg gagtagaata 1620

ctgtttcaaa ctacctggtg tatttattaa ttttggaact gtatgtgtgt gtcatacatc 1680

ttcatagtta cgagtttaag atggatggaa atatcgatct aggataggta tacatgttga 1740

tgtgggtttt actgatgcat atacatgatg gcatatgcag catctattca tatgctctaa 1800

ccttgagtac ctatctatta taataaacaa gtatgtttta taattatttt gatcttgata 1860

tacttggatg atggcatatg cagcagctat atgtggattt ttttagccct gccttcatac 1920

gctatttatt tgcttggtac tgtttctttt gtcgatgctc accctgttgt ttggtgttac 1980

ttctgcag 1988

<210>8

<211>32

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>8

tggcgctggt cttcgccgtc atgatcatcg tc 32

<210>9

<211>27

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>9

tacgatgagc gccaccttgc ccgggaa 27

<210>10

<211>524

<212>DNA

<213> wheat (Triticum aestivuml)

<400>10

catgaatcca aaccacacgg agttcaaatt cccacagatt aaggctcgtc cgtcgcacaa 60

ggtaatgtgt gaatattata cctgtcgtgc aaaattgcct ggcctgcaca attgctgtta 120

tagttggcgg cagggagagt tttaacattg actagcgtgc tgataatttg tgagaaataa 180

taattgacaa gtggatactg acatttgaga agagcttctg aactgttatt agtaacaaaa 240

atggaaagct gatgcacgga aaaaggaaag aaaaagccat actttttttt aggtaggaaa 300

agaaaaagcc atacgagact gatgtctctc agatgggccg ggatctgtct atctagcagg 360

cagcagccca ccaacctcac gggccagcaa ttacgagtcc ttctaaaagc tcccgccgag 420

gggcgctggc gctgctgtgc agcagcacgc ctaacattag tcccacctcg ccagtttaca 480

gggagcagaa ccagcttata agccgaggcg catcctgagg tagc 524

<210>11

<211>437

<212>DNA

<213> Rice (Oryza sativa)

<400>11

agtaattcat ccaggtctcc aagttctagg attttcagaa ctgcaactta ttttatcaag 60

gaatctttaa acatacgaac agatcactta aagttcttct gaagcaactt aaagttatca 120

ggcatgcatg gatcttggag gaatcagatg tgcagtcagg gaccatagca caagacaggc 180

gtcttctact ggtgctacca gcaaatgctg gaagccggga acactgggta cgttggaaac 240

cacgtgatgt gaagaagtaa gataaactgt aggagaaaag catttcgtag tgggccatga 300

agcctttcag gacatgtatt gcagtatggg ccggcccatt acgcaattgg acgacaacaa 360

agactagtat tagtaccacc tcggctatcc acatagatca aagctgattt aaaagagttg 420

tgcagatgat ccgtggc 437

<210>12

<211>333

<212>DNA

<213> Rice (Oryza sativa)

<400>12

tgcaagaacg aactaagccg gacaaaaaaa aaaaggagca catatacaaa ccggttttat 60

tcatgaatgg tcacgatgga tgatggggct cagacttgag ctacgaggcc gcaggcgaga 120

gaagcctagt gtgctctctg cttgtttggg ccgtaacgga ggatacggcc gacgagcgtg 180

tactaccgcg cgggatgccg ctgggcgctg cgggggccgt tggatgggga tcggtgggtc 240

gcgggagcgt tgaggggaga caggtttagt accacctcgc ctaccgaaca atgaagaacc 300

caccttataa ccccgcgcgc tgccgcttgt gtt 333

<210>13

<211>20

<212>DNA

<213> wheat (Triticum aestivuml)

<400>13

ggtgcccgct ggcggcgacg 20

<210>14

<211>31

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>14

ttcggggttt tgcatgtcag ctagtacgga g 31

<210>15

<211>18

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>15

gtggacacga accgctgc 18

<210>16

<211>27

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>16

gacgctgtga tgatcaatgg tgccgtg 27

<210>17

<211>27

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>17

agcgcgtccg tgaagtgctc ctggttc 27

<210>18

<211>28

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>18

gacgctgtga tgaccaatgg tgccatac 28

<210>19

<211>19

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>19

cgacgtgtcg gccagcgca 19

<210>20

<211>93

<212>DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400>20

gtttcagagc tatgctggaa acagcatagc aagttgaaat aaggctagtc cgttatcaac 60

ttgaaaaagt ggcaccgagt cggtgctttt ttt 93

<210>21

<211>76

<212>DNA

<213> Rice (Oryza sativa)

<400>21

acaaagcacc agtggtctag tggtagaata gtaccctgcc acggtacaga cccgggttcg 60

attcccggct ggtgca 76

Claims (3)

1. A vector for genome editing comprises an TaU3p promoter, a target gene sequence, a sgRNA4TmC +5 structure, a Ubi promoter and a Cas9 gene, and is characterized in that the elements are sequentially connected according to the sequence, wherein the nucleotide sequence of the TaU3p promoter is shown as SEQ ID NO:10, the nucleotide sequence of the target gene sequence is shown as SEQ ID NO:13, the nucleotide sequence of the sgRNA4TmC +5 structure is shown as SEQ ID NO:20, the nucleotide sequence of the Ubi promoter is shown as SEQ ID NO:7, and the nucleotide sequence of the Cas9 gene is shown as SEQ ID NO: 5.

2. A method of genome editing accomplished by a CRISPR-Cas9 system characterized in that the CRISPR-Cas9 system contains the vector of claim 1.

3. Use of the vector of claim 1, the method of genome editing of claim 2 in plant genome editing.

Images