CN113584036A - CRISPR-Cas9 gene editing tool and editing method thereof - Google Patents
CRISPR-Cas9 gene editing tool and editing method thereof Download PDFInfo
- Publication number
- CN113584036A CN113584036A CN202111031355.3A CN202111031355A CN113584036A CN 113584036 A CN113584036 A CN 113584036A CN 202111031355 A CN202111031355 A CN 202111031355A CN 113584036 A CN113584036 A CN 113584036A
- Authority
- CN
- China
- Prior art keywords
- gene
- cas9
- crispr
- promoter
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000010356 CRISPR-Cas9 genome editing Methods 0.000 title claims abstract description 34
- 238000010362 genome editing Methods 0.000 title claims abstract description 33
- 238000000034 method Methods 0.000 title claims abstract description 28
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 70
- 239000013612 plasmid Substances 0.000 claims abstract description 40
- 108091033409 CRISPR Proteins 0.000 claims abstract description 27
- 239000013604 expression vector Substances 0.000 claims abstract description 25
- 241000209140 Triticum Species 0.000 claims abstract description 23
- 235000021307 Triticum Nutrition 0.000 claims abstract description 23
- 230000011559 double-strand break repair via nonhomologous end joining Effects 0.000 claims abstract description 15
- 230000008439 repair process Effects 0.000 claims abstract description 15
- 102000012410 DNA Ligases Human genes 0.000 claims abstract description 11
- 108010061982 DNA Ligases Proteins 0.000 claims abstract description 11
- 102000021107 DNA end binding proteins Human genes 0.000 claims abstract description 10
- 108091011122 DNA end binding proteins Proteins 0.000 claims abstract description 10
- 102100038222 60 kDa heat shock protein, mitochondrial Human genes 0.000 claims abstract description 5
- 101710154868 60 kDa heat shock protein, mitochondrial Proteins 0.000 claims abstract description 5
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 5
- 239000002773 nucleotide Substances 0.000 claims description 16
- 125000003729 nucleotide group Chemical group 0.000 claims description 16
- 108020004414 DNA Proteins 0.000 claims description 8
- 108091027544 Subgenomic mRNA Proteins 0.000 claims description 8
- 230000008685 targeting Effects 0.000 claims description 8
- 101000619947 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) DNA repair polymerase Proteins 0.000 claims description 6
- 230000008569 process Effects 0.000 claims description 5
- 101150067314 aadA gene Proteins 0.000 claims description 4
- 238000012217 deletion Methods 0.000 claims description 4
- 230000037430 deletion Effects 0.000 claims description 4
- 238000010354 CRISPR gene editing Methods 0.000 claims description 3
- 102000004405 Collectins Human genes 0.000 claims description 3
- 108090000909 Collectins Proteins 0.000 claims description 3
- 241000187473 Mycobacterium aurum Species 0.000 claims description 3
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 3
- 238000003209 gene knockout Methods 0.000 claims description 3
- 230000035772 mutation Effects 0.000 abstract description 8
- 230000009466 transformation Effects 0.000 abstract description 7
- 230000009261 transgenic effect Effects 0.000 abstract description 5
- 238000010353 genetic engineering Methods 0.000 abstract description 2
- 239000013598 vector Substances 0.000 abstract description 2
- 238000005516 engineering process Methods 0.000 description 7
- 238000006243 chemical reaction Methods 0.000 description 6
- 230000009471 action Effects 0.000 description 3
- 241000894006 Bacteria Species 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000001415 gene therapy Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 241000203069 Archaea Species 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 230000008836 DNA modification Effects 0.000 description 1
- 238000012270 DNA recombination Methods 0.000 description 1
- 241000252212 Danio rerio Species 0.000 description 1
- 208000026350 Inborn Genetic disease Diseases 0.000 description 1
- 241000699670 Mus sp. Species 0.000 description 1
- 102000018120 Recombinases Human genes 0.000 description 1
- 108010091086 Recombinases Proteins 0.000 description 1
- 238000010459 TALEN Methods 0.000 description 1
- 108010043645 Transcription Activator-Like Effector Nucleases Proteins 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 230000003044 adaptive effect Effects 0.000 description 1
- 230000004075 alteration Effects 0.000 description 1
- 238000013459 approach Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 108091008324 binding proteins Proteins 0.000 description 1
- 102000023732 binding proteins Human genes 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 230000000052 comparative effect Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 101150110946 gatC gene Proteins 0.000 description 1
- 208000016361 genetic disease Diseases 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 208000014951 hematologic disease Diseases 0.000 description 1
- 208000024200 hematopoietic and lymphoid system neoplasm Diseases 0.000 description 1
- 210000005260 human cell Anatomy 0.000 description 1
- 230000007124 immune defense Effects 0.000 description 1
- 238000000338 in vitro Methods 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 238000002741 site-directed mutagenesis Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a CRISPR-Cas9 gene editing tool and an editing method thereof, comprising a pML-Cas9 plasmid and a pJM-sgRNA plasmid; the pML-Cas9 plasmid comprises a pMV261 expression vector, a TaU3p promoter, a target gene sequence, a sgRNA4TmC +5 structure, a Cas9 gene and a NHEJ repair gene, wherein the pMV261 expression vector, TaU3p promoter, the target gene sequence, the sgRNA4TmC +5 structure, the Cas9 gene and the NHEJ repair gene are sequentially connected according to the sequence, and the Hsp60 promoter on the pMV261 expression vector is replaced by a TaU3p promoter; the NHEJ repair gene comprises a gene encoding DNA end binding protein mku and a gene encoding DNA ligase ligad; the Cas9 gene is positioned at the downstream of TaU3p promoter of pMV261 expression vector and at the upstream of rrnB terminator of pMV261 expression vector, and the invention relates to the technical field of genetic engineering. The CRISPR-Cas9 gene editing tool and the editing method thereof can realize the problems of low mutation rate and difficult acquisition of CRISPR-Cas9 transgenic mutant strains after the transformation of CRISPR-Cas9 vectors of crops such as wheat and the like, save the transformation time and reduce the transformation cost.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a CRISPR-Cas9 gene editing tool and an editing method thereof.
Background
The gene engineering is also called gene splicing technology and DNA recombination technology, and is characterized by that it uses molecular genetics as theoretical basis, and uses the modern methods of molecular biology and microbiology as means, and makes the genes with different sources according to the predesigned blueprint to construct hybrid DNA molecule in vitro, then introduces it into living cell so as to change the original genetic characteristics of organism, obtain new variety and produce new product. The gene engineering technology provides a powerful means for the research of the structure and the function of the gene.
CRISPR-Cas9, a gene therapy approach that enables the treatment of a variety of diseases through DNA splicing techniques. CRISPR-Cas9 is an adaptive immune defense formed during long-term evolution of bacteria and archaea, and can be used to fight invading viruses and foreign DNA. The CRISPR-Cas9 gene editing technology is a technology for carrying out specific DNA modification on a target gene, and the technology is also a method for leading edges in gene editing. The gene editing technology based on the CRISPR-Cas9 shows great application prospect in the application fields of a series of gene therapies, such as blood diseases, tumors and other genetic diseases. The technical result is applied to the precise genome modification of human cells, zebrafish, mice and bacteria.
Wheat is an allohexaploid consisting of A, B, D sets of genomes, the average copy number of genes is 2.8, wherein nearly half of the genes (46%) have 3-4 copies, 12% of the genes have 1-2 copies, and 42% of the gene copy number is more than or equal to 5, so that a recombinase-mediated gene superposition transgenic operation system is urgently needed to be established in the wheat to realize DNA superposition/deletion, and a target strain with independent intellectual property rights is developed in the wheat by utilizing the system. Compared with traditional genome editing technologies ZFN and TALEN, the method has the advantages that the CRISPR-Cas9 site-directed mutagenesis is utilized, the cost is lower, the operation is easier, the efficiency is higher, the homozygote mutant is easier to obtain, and the method has important significance for the research of the wheat gene function.
At present, the mutation rate in crops such as wheat is high, the CRISPR-Cas9 transgenic mutant strain is difficult to obtain, the transformation time is long, and the transformation cost is high, so that the CRISPR-Cas9 gene editing tool and the editing method thereof are provided to solve the problems.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a CRISPR-Cas9 gene editing tool and an editing method thereof, and solves the problems of high mutation rate, difficult acquisition of CRISPR-Cas9 transgenic mutant strains, long transformation time and higher transformation cost in wheat and other crops at present.
In order to achieve the purpose, the invention is realized by the following technical scheme: a CRISPR-Cas9 gene editing tool comprises a pML-Cas9 plasmid and a pJM-sgRNA plasmid; the pML-Cas9 plasmid comprises a pMV261 expression vector, a TaU3p promoter, a target gene sequence, a sgRNA4TmC +5 structure, a Cas9 gene and a NHEJ repair gene, wherein the pMV261 expression vector, TaU3p promoter, the target gene sequence, the sgRNA4TmC +5 structure, the Cas9 gene and the NHEJ repair gene are sequentially connected according to the sequence, and the Hsp60 promoter on the pMV261 expression vector is replaced by a TaU3p promoter; the NHEJ repair gene comprises a gene encoding DNA end binding protein mku and a gene encoding DNA ligase ligad; the Cas9 gene is located at the downstream of TaU3p promoter of pMV261 expression vector and at the upstream of rrnB terminator of pMV261 expression vector, and is driven by TaU3p promoter to express, the pJM-sgRNA plasmid comprises OriM replicon, pMB1 replicon, Pj23119 promoter, sgRNA sequence, rrnB terminator and aadA resistance gene in sequence, the sgRNA sequence is a targeting sequence and can specifically target the targeting sequence; the target sequence refers to the nucleotide sequence of a gene needing to be edited.
Preferably, the nucleotide sequence of the Cas9 gene is shown as SEQ ID No. 1.
Preferably, the nucleotide sequences of the genes of the Pj23119 promoter in the pML-Cas9 plasmid and the pJM-sgRNA plasmid are shown as SEQ ID No. 2.
Preferably, the nucleotide sequence of the TaU3p promoter is shown as SEQ ID NO. 3.
Preferably, the sgRNA4TmC +5 structure has a nucleotide sequence shown in SEQ ID No. 4.
Preferably, the nucleotide sequence of the gene of the DNA terminal collectin mku is shown as SEQ ID NO. 5.
The invention also discloses an editing method of the CRISPR-Cas9 gene editing tool, which specifically comprises the following steps:
s1, plasmid introduction: introducing a pML-Cas9 plasmid in a CRISPR-Cas9 gene editing tool as defined in any one of claims 1 to 6 into wheat to express a Cas9 gene, a gene encoding a DNA end binding protein mku and a gene encoding a DNA ligase LigD on the pML-Cas9 plasmid, and then introducing a pJM-sgRNA plasmid in a CRISPR/Cas9 gene editing system as defined in any one of claims 1 to 5 into wheat;
s2, gene knockout: the deletion of the gene to be edited can cause the DSB of the new mycobacterium aurum gene to be broken, and at the moment, the DSB breakage can be repaired by the expressed DNA end binding protein mku and the DNA ligase LigD on the pML-Cas9 plasmid, so that the wheat gene editing process is completed.
Advantageous effects
The invention provides a CRISPR-Cas9 gene editing tool and an editing method thereof. Compared with the prior art, the method has the following beneficial effects:
the CRISPR-Cas9 gene editing tool and the editing method thereof are characterized in that the tool comprises a pML-Cas9 plasmid and a pJM-sgRNA plasmid; the pML-Cas9 plasmid comprises a pMV261 expression vector, a TaU3p promoter, a target gene sequence, a sgRNA4TmC +5 structure, a Cas9 gene and a NHEJ repair gene, wherein the pMV261 expression vector, TaU3p promoter, the target gene sequence, the sgRNA4TmC +5 structure, the Cas9 gene and the NHEJ repair gene are sequentially connected according to the sequence, and the Hsp60 promoter on the pMV261 expression vector is replaced by a TaU3p promoter; the NHEJ repair gene comprises a gene encoding DNA end binding protein mku and a gene encoding DNA ligase ligad; the Cas9 gene is located at the downstream of TaU3p promoter of pMV261 expression vector and at the upstream of rrnB terminator of pMV261 expression vector, and is driven by TaU3p promoter to express, the pJM-sgRNA plasmid comprises OriM replicon, pMB1 replicon, Pj23119 promoter, sgRNA sequence, rrnB terminator and aadA resistance gene in sequence, the sgRNA sequence is a targeting sequence and can specifically target the targeting sequence; the target sequence is a nucleotide sequence of a gene needing to be edited, so that the problems of low mutation rate and difficult acquisition of a CRISPR-Cas9 transgenic mutant strain after the CRISPR-Cas9 vector in crops such as wheat is converted can be solved, the conversion time is saved, and the conversion cost is reduced.
Drawings
FIG. 1 is a flow chart of an editing method of the present invention.
FIG. 2 is a table comparing wheat planted on the market with that of the embodiment of the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Referring to fig. 1-2, the present invention provides a technical solution: the concrete examples include
Example 1
A CRISPR-Cas9 gene editing tool comprises a pML-Cas9 plasmid and a pJM-sgRNA plasmid; the pML-Cas9 plasmid comprises a pMV261 expression vector, a TaU3p promoter, a target gene sequence, a sgRNA4TmC +5 structure, a Cas9 gene and a NHEJ repair gene, wherein the pMV261 expression vector, TaU3p promoter, the target gene sequence, the sgRNA4TmC +5 structure, the Cas9 gene and the NHEJ repair gene are sequentially connected according to the sequence, and the Hsp60 promoter on the pMV261 expression vector is replaced by a TaU3p promoter; the NHEJ repair gene comprises a gene encoding DNA end binding protein mku and a gene encoding DNA ligase ligad; the Cas9 gene is located at the downstream of TaU3p promoter of pMV261 expression vector and at the upstream of rrnB terminator of pMV261 expression vector, and is driven by TaU3p promoter to express, the pJM-sgRNA plasmid comprises OriM replicon, pMB1 replicon, Pj23119 promoter, sgRNA sequence, rrnB terminator and aadA resistance gene in sequence, the sgRNA sequence is a targeting sequence and can specifically target the targeting sequence; the target sequence refers to the nucleotide sequence of the gene to be edited.
In the embodiment of the invention, the nucleotide sequence of the Cas9 gene is shown as SEQ ID No. 1.
SEQ ID NO.1
atgcccc taagaagaagaaggtgtattcacggcgt tcctgc ggcgatggac aag60
aagtatagtattgstctggacattgggacgatccgttggctseccgtgatcaccgat120
gagtacaaggtccct tccaagagt tagttctgggaacacc gatccacagcatc180
aagaagaatctcattggagcctcctgttcgac tcaggc gagaccgccgaagc aacaagg240
ctcaagagaaccgcaaggagacggtatacaagaggaagaataggatctgc tacctgcag300
gagattttcagcaacgaaatggc gaaggtggacgattcgttctttcatagattggaggag360
agtttcctcgtcgaggaagataagagcacgagaggcatcc tatcttggcaacattgtc420
gacgaggttgcctatcacgaagt acccacaatctatcatctgcggaagaagcttgtg480
gac tc gactga taaggc ggacct tagattgatc tacc tcgc tc tggc ac acatgattaag540
ttcagggc catttctgatc ga888ggatc tacccaggacaatagcgat gtggacaag600
ttgttcatccagctcgtccaacctacaatcagctcttt gagacccaattatgct660
tcaggcgtcgacgccaaggcgatcctgtc tgcacgcttaagtctcgccggcttgag720
aacttgatcgc tc aactccsgscganaagaagaacgecttgt tcssaatctcattgca780
ctttcttgggc tc ac acaaact tcaagagtatttt gatc tc gc tgag gacgcaaag840。
In the embodiment of the invention, the nucleotide sequences of the Pj23119 promoter genes in the pML-Cas9 plasmid and the pJM-sgRNA plasmid are shown as SEQ ID No. 2.
SEQ ID NO.2
ttgacagc tagctcagtcctaggtataatgc tagc35。
In the embodiment of the invention, the nucleotide sequence of the TaU3p promoter is shown as SEQ ID NO. 3.
SEQ ID NO.3
catgaatccaaaccacacggagttcaaat tcccacagattaaggctcgtccgtcgcacaa60
ggtaatgtgtgaatattatacctgtcgtgcaaaattgcctggcctgcacaattgctgtta120
tagttggcggcagggagattttaacattgactagcgtgctgataatttgtgagaaat aa180
taattgacaagtggatactgacatttgagaagagcttctgaactgttattagtaacaaaa240
atggaaagctgatgcacggaaaaggaaagaaaaagccatacttttt tttaggtaggaaa300
agaaagccatacgagactgatgtctctcagatgggccgggatctgtctatctagcagg360
cagcagcccaccaacctcacgggccagcaattacgagtccttctaaaagctcccgccgag420
gggcgctggcgctgctgtgcagcagcacgcctaacattagtcccacctcgccagtttaca480
gggagcagaaccagcttataagccgaggcgcatcctgaggtagc524
In the embodiment of the invention, the nucleotide sequence of the sgRNA4TmC +5 structure is shown in SEQ ID No. 4.
SEQ ID NO.4
gtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgt tatcaac60
ttgaaaaagt ggcaccgagtcggtgcttttt93。
In the embodiment of the invention, the nucleotide sequence of the gene of the DNA terminal collectin mku is shown as SEQ ID NO. 5.
SEQ ID NO.5
atgcgagccatttggacgggttcgatcgccttcgggctggtgaacgtgccggtcaaggtg60
tacagcgctaccgcagaccacgacatcaggttccaccaggtgcacgccaaggacaacgga120
cgcatccggtacaagcgcgtctgcgaggcgtgtggcgaggtggtcgactaccgcgatctt180
gcccgggcctacgagtccggcgacggccaaatggtggcgatcaccgacgacgacatcgcc240
agcttgcctgaagaacgcagccgggagatcgaggtgttggagttcgtccccgccgccgac300
gtggacccgatgatgttcgaccgcagctactttttggagcctgattcgaagtcgtcgaaa360
tcgtatgtgctgctggctaagacactcgccgagaccgaccggatggcgatcgtgcatttc420
acgctgcgcaacaagaccaggctggcggcgttgcgcgtcaaggatttcggcaagcgagag480
gtgatgatggtgcacacgttgctgtggcccgatgagatccgcgaccccgacttcccggtg540
ctggaccagaaggtggagatcaaacccgcggaactcaagatggccggccaggtggtggac600
tcgatggccgacgacttcaatccggaccgctaccacgacacctaccaggagcagttacag660
gagctgatcgacaccaaactcgaaggtgggcaggcatttaccgccgaggaccaaccgagg720
ttgctggacgagcccgaagacgtctccgacctgctcgccaagctggaggccagcgtgaag780
gcgcgctcgaaggccaactcaaacgtcccaacgcctccgtga822。
The invention also discloses an editing method of the CRISPR-Cas9 gene editing tool, which specifically comprises the following steps:
s1, plasmid introduction: firstly, introducing a pML-Cas9 plasmid in a CRISPR-Cas9 gene editing tool of any one of claims 1 to 6 into wheat to express a Cas9 gene, a gene encoding a DNA terminal binding protein mku and a gene encoding a DNA ligase LigD on the pML-Cas9 plasmid, and then introducing a pJM-sgRNA plasmid in a CRISPR/Cas9 gene editing system of any one of claims 1 to 5 into the wheat;
s2, gene knockout: the deletion of the gene to be edited can cause the DSB of the new mycobacterium aurum gene to be broken, and at the moment, the DSB breakage can be repaired by the expressed DNA end binding protein mku and the DNA ligase LigD on the pML-Cas9 plasmid, so that the wheat gene editing process is completed.
Comparative experiment
A certain wheat planting factory selects the wheat planted in the example 1 to perform a comparison experiment of mutation rate and conversion time, and as can be seen from a graph shown in FIG. 2, the wheat planted in the example 1 is low in mutation rate, short in conversion time, high in mutation rate and long in conversion time, so that the planted wheat prepared by the method is low in mutation rate, and short in conversion time and far superior to the wheat planted in the market.
And those not described in detail in this specification are well within the skill of those in the art.
It is noted that, herein, relational terms such as first and second, and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (7)
1. A CRISPR-Cas9 gene editing tool, characterized in that: comprises a pML-Cas9 plasmid and a pJM-sgRNA plasmid; the pML-Cas9 plasmid comprises a pMV261 expression vector, a TaU3p promoter, a target gene sequence, a sgRNA4TmC +5 structure, a Cas9 gene and a NHEJ repair gene, wherein the pMV261 expression vector, TaU3p promoter, the target gene sequence, the sgRNA4TmC +5 structure, the Cas9 gene and the NHEJ repair gene are sequentially connected according to the sequence, and the Hsp60 promoter on the pMV261 expression vector is replaced by a TaU3p promoter; the NHEJ repair gene comprises a gene encoding DNA end binding protein mku and a gene encoding DNA ligase ligad; the Cas9 gene is located at the downstream of TaU3p promoter of pMV261 expression vector and at the upstream of rrnB terminator of pMV261 expression vector, and is driven by TaU3p promoter to express, the pJM-sgRNA plasmid comprises OriM replicon, pMB1 replicon, Pj23119 promoter, sgRNA sequence, rrnB terminator and aadA resistance gene in sequence, the sgRNA sequence is a targeting sequence and can specifically target the targeting sequence; the target sequence refers to the nucleotide sequence of a gene needing to be edited.
2. The CRISPR-Cas9 gene editing tool according to claim 1, characterized in that: the nucleotide sequence of the Cas9 gene is shown as SEQ ID NO. 1.
3. The CRISPR-Cas9 gene editing tool according to claim 1, characterized in that: the nucleotide sequences of the Pj23119 promoter genes in the pML-Cas9 plasmid and the pJM-sgRNA plasmid are shown as SEQ ID NO. 2.
4. The CRISPR-Cas9 gene editing tool according to claim 1, characterized in that: the nucleotide sequence of the TaU3p promoter is shown as SEQ ID NO. 3.
5. The CRISPR-Cas9 gene editing tool according to claim 1, characterized in that: the sgRNA4TmC +5 structure has a nucleotide sequence shown in SEQ ID No. 4.
6. The CRISPR-Cas9 gene editing tool and the editing method thereof according to claim 1, characterized in that: the nucleotide sequence of the gene of the DNA terminal collectin mku is shown as SEQ ID NO. 5.
7. The CRISPR-Cas9 gene editing tool of any one of claims 1-6, wherein: the editing method specifically comprises the following steps:
s1, plasmid introduction: introducing a pML-Cas9 plasmid in a CRISPR-Cas9 gene editing tool as defined in any one of claims 1 to 6 into wheat to express a Cas9 gene, a gene encoding a DNA end binding protein mku and a gene encoding a DNA ligase LigD on the pML-Cas9 plasmid, and then introducing a pJM-sgRNA plasmid in a CRISPR/Cas9 gene editing system as defined in any one of claims 1 to 5 into wheat;
s2, gene knockout: the deletion of the gene to be edited can cause the DSB of the new mycobacterium aurum gene to be broken, and at the moment, the DSB breakage can be repaired by the expressed DNA end binding protein mku and the DNA ligase LigD on the pML-Cas9 plasmid, so that the wheat gene editing process is completed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111031355.3A CN113584036A (en) | 2021-09-03 | 2021-09-03 | CRISPR-Cas9 gene editing tool and editing method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111031355.3A CN113584036A (en) | 2021-09-03 | 2021-09-03 | CRISPR-Cas9 gene editing tool and editing method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113584036A true CN113584036A (en) | 2021-11-02 |
Family
ID=78241027
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111031355.3A Pending CN113584036A (en) | 2021-09-03 | 2021-09-03 | CRISPR-Cas9 gene editing tool and editing method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113584036A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164402A (en) * | 2017-05-31 | 2017-09-15 | 未名兴旺系统作物设计前沿实验室（北京）有限公司 | A kind of gene editing carrier and its application based on CRISPR Cas9 systems |
| CN110066829A (en) * | 2019-04-30 | 2019-07-30 | 江南大学 | A kind of CRISPR/Cas9 gene editing system and its application |
| CN110959043A (en) * | 2017-06-13 | 2020-04-03 | 未名生物农业集团有限公司 | Method for improving agronomic traits of plants by using BCS1L gene and guide RNA/CAS endonuclease system |
| CN111850034A (en) * | 2020-06-24 | 2020-10-30 | 中国农业大学 | Gene editing carrier and method |
-
2021
- 2021-09-03 CN CN202111031355.3A patent/CN113584036A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164402A (en) * | 2017-05-31 | 2017-09-15 | 未名兴旺系统作物设计前沿实验室（北京）有限公司 | A kind of gene editing carrier and its application based on CRISPR Cas9 systems |
| CN110959043A (en) * | 2017-06-13 | 2020-04-03 | 未名生物农业集团有限公司 | Method for improving agronomic traits of plants by using BCS1L gene and guide RNA/CAS endonuclease system |
| CN110066829A (en) * | 2019-04-30 | 2019-07-30 | 江南大学 | A kind of CRISPR/Cas9 gene editing system and its application |
| CN111850034A (en) * | 2020-06-24 | 2020-10-30 | 中国农业大学 | Gene editing carrier and method |
Non-Patent Citations (2)
| Title |
|---|
| JAYAVARADHAN, R等: "CRISPR-Cas9 fusion to dominant-negative 53BP1 enhances HDR and inhibits NHEJ specifically at Cas9 target sites", NATURE COMMUNICATIONS, vol. 10 * |
| 林雅容等: "基因组编辑技术及其在植物遗传改良上的应用", 福建农业学报, vol. 30, no. 5, pages 522 - 527 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7232540B2 (en) | Multiple genome engineering enabled by CRISPR | |
| US20240002835A1 (en) | Genetic tool for the transformation of clostridium bacteria | |
| Walker et al. | Development of both type I–B and type II CRISPR/Cas genome editing systems in the cellulolytic bacterium Clostridium thermocellum | |
| TWI608100B (en) | Cas9 expression plasmid, gene editing system of escherichia coli and method thereof | |
| Li et al. | CRISPR‐based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii | |
| Zhao et al. | Development of a fast and easy method for Escherichia coli genome editing with CRISPR/Cas9 | |
| US10612043B2 (en) | Methods of in vivo engineering of large sequences using multiple CRISPR/cas selections of recombineering events | |
| US11946067B2 (en) | Optimized genetic tool for modifying Clostridium bacteria | |
| JP5203375B2 (en) | Chromosome uptake and DNA sequence replacement in Clostridium bacteria | |
| CN110358767B (en) | Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application thereof | |
| CN109136248B (en) | Multi-target editing vector and construction method and application thereof | |
| CN107236748B (en) | Recombinant plasmid, construction method and application in mycobacterium precise genome modification | |
| CN107365786A (en) | A kind of method and its application being cloned into spacer sequences in CRISPR-Cas9 systems | |
| CN108277231B (en) | CRISPR system for corynebacterium genome editing | |
| Zhang et al. | Markerless genome editing in Clostridium beijerinckii using the CRISPR-Cpf1 system | |
| CN108165581B (en) | Method for repairing HBA2 gene mutation in vitro by using single-stranded nucleotide fragment | |
| CN105567718B (en) | Construction method of vector for simultaneously expressing multiple sgRNAs | |
| WO2021083183A9 (en) | Hematopoietic stem cell hbb gene repair method and product | |
| Cao et al. | The multiplexed CRISPR targeting platforms | |
| WO2019144660A1 (en) | Yeast genome editing vector, construction method therefor and application thereof | |
| CN114075559A (en) | Type 2 CRISPR/Cas9 gene editing system and application thereof | |
| WO2023092731A1 (en) | Mad7-nls fusion protein, and nucleic acid construct for site-directed editing of plant genome and application thereof | |
| US20220243170A1 (en) | Optimized genetic tool for modifying bacteria | |
| JP7555599B2 (en) | Preparation and Use of Genetically Modified Clostridium Bacteria. | |
| CN113584036A (en) | CRISPR-Cas9 gene editing tool and editing method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20230519 Address after: 430000 E108, 5 / F, building B7, biological innovation park, No. 666, Gaoxin Avenue, Donghu New Technology Development Zone, Wuhan, Hubei Applicant after: Wuhan Yikang Gene Technology Co.,Ltd. Applicant after: WUHAN University Address before: 430000 E108, 5 / F, building B7, biological innovation park, No. 666, Gaoxin Avenue, Donghu New Technology Development Zone, Wuhan, Hubei Applicant before: Wuhan Yikang Gene Technology Co.,Ltd. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20211102 |