CN107164292B - Clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof - Google Patents
Clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof Download PDFInfo
- Publication number
- CN107164292B CN107164292B CN201710492586.1A CN201710492586A CN107164292B CN 107164292 B CN107164292 B CN 107164292B CN 201710492586 A CN201710492586 A CN 201710492586A CN 107164292 B CN107164292 B CN 107164292B
- Authority
- CN
- China
- Prior art keywords
- pentachlorophenol
- clostridium beijerinckii
- cbei
- gene
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/33—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D3/00—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances
- A62D3/02—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances by biological methods, i.e. processes using enzymes or microorganisms
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
- B09C—RECLAMATION OF CONTAMINATED SOIL
- B09C1/00—Reclamation of contaminated soil
- B09C1/10—Reclamation of contaminated soil microbiologically, biologically or by using enzymes
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
- C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/04—Pesticides, e.g. insecticides, herbicides, fungicides or nematocides
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/20—Organic substances
- A62D2101/28—Organic substances containing oxygen, sulfur, selenium or tellurium, i.e. chalcogen
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F2101/00—Nature of the contaminant
- C02F2101/30—Organic compounds
- C02F2101/36—Organic compounds containing halogen
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Environmental & Geological Engineering (AREA)
- Biodiversity & Conservation Biology (AREA)
- Business, Economics & Management (AREA)
- Water Supply & Treatment (AREA)
- Soil Sciences (AREA)
- Mycology (AREA)
- Biotechnology (AREA)
- Toxicology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Hydrology & Water Resources (AREA)
- Emergency Management (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a recombinant strain of clostridium beijerinckii for efficient reductive dechlorination of pentachlorophenol, which is obtained by inserting and inactivating a Cbei _3304 gene so that the protein can not normally work in clostridium beijerinckii NCIMB 8052. The clostridium beijerinckii recombinant bacterium M-3304 of the invention is in simulated wastewater containing 3.0mg/L pentachlorophenol, 0.15g/L Methyl Viologen (MV) and 6.44g/L ferric citrate, and the reduction dechlorination rate of the pentachlorophenol reaches 90 percent after 60 hours; under the same condition, the reduction dechlorination rate of the starting strain clostridium beijerinckii NCIMB8052 to the pentachlorophenol is only 40 percent; the reductive dechlorination efficiency of the clostridium beijerinckii recombinant bacterium M-3304 to pentachlorophenol is 2.25 times that of the original strain NCIMB 8052. The invention can be applied to the degradation of pentachlorophenol in water, solid garbage, solid waste and soil, and belongs to the field of environmental protection.
Description
Technical Field
The invention belongs to the technical field of environmental protection, and particularly relates to a clostridium beijerinckii recombinant strain for efficiently dechlorinating pentachlorophenol, a construction method thereof and application in the field of environmental protection.
Background
Pentachlorophenol (PCP), also known as pentachlorophenol; often contains one molecule of crystal water, and has strong pungent odor when being slightly hot. Pentachlorophenol is capable of preventing fungal growth and inhibiting bacteria and has long been used as a herbicide, insecticide, fungicide, mildewcide, etc. However, PCP is most toxic in all phenolic toxic substances and has a strong "triogenic" (carcinogenic, teratogenic, mutagenic) effect. In the 1970 s, the United states environmental protection agency has included a list of preferred contaminants (Water Res., 2004, 38: 663-672), and in China, PCP is listed as a list of 68 contaminants for Water environment priority control. Pentachlorophenol is not easily oxidized, is also difficult to hydrolyze, has an accumulative effect, can be enriched in large amounts in organisms, and has a concentration far exceeding that of water. PCP is highly adsorptive on soil or sediments, can be absorbed by plants, and enters the food chain by biological enrichment (Trends in Biotehcnolgoy,20: 243-. The migration, transformation and degradation of the biohazard of PCP in the natural environment has been a focus of research and attention in the industry.
The pentachlorophenol treatment method comprises three main physical methods, a chemical method and a biological method. The physical methods mainly include adsorption method, irradiation method, ultrasonic method, and the like. The chemical method mainly comprises electrochemistry, a Fenton reagent method, a zero-valent metal reduction method, a manganese dioxide method and the like. The biological method comprises a plurality of microorganisms, and different types of microorganisms have different biochemical mechanisms for degrading pollutants, so that the degradation ways of the PCP are diversified, but the degradation process is that firstly dechlorination is converted into low-chlorine compounds and then the compounds are subjected to ring opening to obtain degradation or mineralization. The most important limiting steps in the biodegradation of PCP are the removal of chlorine substituents, and the biological dechlorination of PCP is mainly by oxidative and environmental microbiology,75:5910-5918. Among them, anaerobic reductive dechlorination mechanism is the most common and effective degradation method.
The biological method has the advantages of low cost, high efficiency, no secondary pollution, no environmental damage and the like, and has wide application prospect in the process of treating PCP. Some Fe (III) reducing bacteria Bacillus, Geobacter, Pesudomonas and Clostridium play an extremely important role in the anaerobic reductive dechlorination process (Science of the microbial environment 473: 215-.
Disclosure of Invention
The invention aims to solve the technical problem of providing a clostridium beijerinckii for efficiently dechlorinating p-pentachlorophenol obtained by a two-type intron gene insertional inactivation technology.
The technical problem to be solved by the invention is to provide the application of the clostridium beijerinckii in dechlorinating pentachlorophenol so as to improve the efficiency of degrading PCP by a biological method.
In order to solve the technical problems, the technical scheme adopted by the invention is as follows:
the clostridium beijerinckii-3304 gene is inactivated in clostridium beijerinckii, so that the gene can not be normally expressed in clostridium beijerinckii. The Cbei _3304 gene encodes a suspected membrane protein, and the function of the membrane protein is lost, so that the exchange and the mobility of some substances in cells can be improved, and the dechlorination efficiency of the clostridium beijerinckii to pentachlorophenol is further improved.
Wherein, the nucleotide sequence of the Cbei _3304 gene is shown as SEQ ID NO: 1 is shown.
Wherein the clostridium beijerinckii is clostridium beijerinckii NCIMB 8052.
The construction method of the clostridium beijerinckii for efficiently dechlorinating the pentachlorophenol comprises the following steps:
(1) constructing an intron sequence into a two-type intron gene knockout plasmid to obtain a recombinant plasmid;
(2) and (2) transforming the recombinant plasmid obtained in the step (1) into clostridium beijerinckii, and screening to obtain a strain with inactivated Cbei _3304 gene, thereby obtaining the clostridium beijerinckii with pentachlorophenol dechlorinated efficiently.
Preferably, the nucleotide sequence of the intron sequence is as shown in SEQ ID NO: 2, the insertion site of the intron sequence is SEQ ID No: between 335bp and 336bp in 1.
Preferably, the two-type intron gene knockout plasmid is the pWJ plasmid.
The clostridium beijerinckii is clostridium beijerinckii NCIMB 8052.
The clostridium beijerinckii obtained by the construction method of the clostridium beijerinckii for efficiently dechlorinating the pentachlorophenol is within the protection scope of the invention.
The application of the clostridium beijerinckii in the efficient dechlorination reduction of pentachlorophenol is within the protection scope of the invention. The strain can be used for removing pentachlorophenol in soil and water.
The invention has the beneficial effects that:
after inserting and inactivating a Cbei _3304 gene of a coding membrane protein in clostridium beijerinckii, the gene cannot be normally expressed, so that a recombinant strain with the Cbei _3304 gene inserted and inactivated is obtained, namely the recombinant strain M-3304, and the reductive dechlorination rate of pentachlorophenol reaches 90% within 60 hours in simulated wastewater containing 3.0mg/L pentachlorophenol, 0.15g/L Methyl Viologen (MV) and 6.44g/L ferric citrate formazan; under the same condition, the reduction dechlorination rate of the starting strain clostridium beijerinckii NCIMB8052 to the pentachlorophenol is only 40 percent; the reduction dechlorination efficiency of the clostridium beijerinckii recombinant bacterium M-3304 to pentachlorophenol is 2.25 times of that of the original strain. The recombinant strain obtained by the invention is an excellent strain suitable for pentachlorophenol reductive dechlorination, can be widely applied to degradation of pentachlorophenol in water, solid garbage, solid waste and soil, and belongs to the field of environmental protection.
Drawings
FIG. 1 is a plasmid map of an insertionally inactivated vector pWJ according to the present invention;
FIG. 2 is a diagram of the mechanism of insertional inactivation using the two-type intron of the present invention;
FIG. 3 is a PCR electrophoretogram of transformant colonies; lanes 1, 2 and 4 show the size of the Cbei _3304 gene fragment of the wild-type strain NCIMB8052, lanes 3 show the size of the Cbei _3304 gene fragment of the insertionally inactivated mutant M-3304, and lanes 5 show Marker;
FIG. 4 shows the results of the dechlorination of pentachlorophenol in simulated wastewater by Clostridium beijerinckii M-3304 and initial strain NCIMB8052 of the present invention.
Detailed Description
The invention will be better understood from the following examples. However, those skilled in the art will readily appreciate that the specific material ratios, process conditions and results thereof described in the examples are illustrative only and should not be taken as limiting the invention as detailed in the claims.
Example 1: and (3) constructing a mutant strain with inserted and inactivated Clostridium beijerinckii _3304 gene.
The principle of constructing a Clostridium beijerinckii Cbei _3304 gene insertion-inactivated mutant is shown in FIG. 2, and the specific construction process comprises the following steps:
(1) construction of Cbei _3304 insertion-inactivated vector
1) Design of introns
According to the sequence of the C bei _3304 gene of Clostridium beijerinckii recorded in the NCBI database (shown as SEQ ID No: 1), a suitable insertion gene site is designed by software (http://www.clostron.com) Selecting and inserting between 101 th to 102 th bases, generating an intron sequence, and synthesizing an intron sequence S-304 (the sequence of which is shown as SEQ ID NO: 2) and the following primers were designed.
Cloning a primer:
pWJ-OSC-304-S:5’-ggagtgtcgaggatcctcgagataattatccttacacttcgcc-3', the sequence of which is shown in SEQ ID NO: 3 is shown in the specification;
pWJ-OSC-304-A:5’-ggttctcctacagattgtacaaatgtggtgataacagataag-3', the sequence of which is shown in SEQ ID NO: 4, respectively.
Verifying the primers:
Cbei-3304-T-S: 5'-taaattacctacagcaaaactgtg-3', the sequence is shown in SEQ ID NO: 5 is shown in the specification;
Cbei-3304-T-A: 5'-ggaattaagaaccttgaatctatc-3', the sequence is shown in SEQ ID NO: and 6.
Primer pWJ-OSC-304-S introduces a XhoI cleavage site (underlined), and primer pWJ-OSC-304-A introduces a BsrGI cleavage site (underlined).
2) Construction of Cbei _3304-pWJ-304 recombinant vector
The vector pWJ was digested with Xho I and BsrGI, and the plasmid map of pWJ is shown in FIG. 1, and the sequence is shown in SEQ ID NO: shown at 7. The cleaved product was purified with a purification kit (Takara) and ligated with the intron sequence S-304 by one-step cloning (Clonexpress). And (2) transforming the recombinant plasmid subjected to one-step cloning and connection into Escherichia coli E.coli DH5a, coating the Escherichia coli E.coli DH5 on an LB (Langmuir) plate containing 50 mu g/ml of ampicillin resistance, culturing for 12-16 h at 37 ℃, picking up a transformant, inoculating the transformant into a liquid LB culture medium containing 50 mu g/ml of ampicillin, culturing for 12h at 37 ℃ and 200rpm, extracting a recombinant plasmid (AXYGEN), and performing sequencing verification to obtain a Cbei _3304-pWJ-304 recombinant vector.
3) Methylation of Cbei _3304-pWJ-304 recombinant vectors
Preparing chemical competence of E.coli Top 10/pAN2, transforming the successfully sequenced Cbei _3304-pWJ-304 recombinant vector into E.coli Top 10, coating the recombinant vector on LB plate containing 50 ug/ml ampicillin and 10 ug/ml tetracycline because pAN2 plasmid has tetracycline resistance, culturing at 37 ℃ for 12-16 h, picking up transformants, inoculating the transformants in LB culture medium containing 50 ug/ml ampicillin and 10 ug/ml tetracycline, culturing at 37 ℃ and 200rpm for 12h, and extracting methylated Cbei _3304-pWJ-304 recombinant vector (pAN2 plasmid contains a Bacillus subtilis phage gene, can encode methyltransferase, can achieve methylation of exogenous plasmid in E.coli), i.e. Cbei _3304 is inserted into inactivated vector.
(2) Cbei _3304 insert-inactivated vector transformation of Clostridium beijerinckii (Clostridium beijerinckii NCIMB8052)
1) Inoculating Clostridium beijerinckii NCIMB8052 to YPS medium (yeast powder 3g/L, peptone 5g/L, glucose 1g/L, ammonium acetate 2g/L, sodium chloride 3g/L, magnesium sulfate heptahydrate 3g/L, potassium dihydrogen phosphate 1g/L, dipotassium hydrogen phosphate 1g/L, ferrous sulfate heptahydrate 0.1g/L, pH 6.) for overnight culture at 37 deg.C, inoculating to YPS medium at 5% ratio the next day, culturing at 37 deg.C for 6-8h, inoculating to 2 × YTG medium (yeast powder 16g/L, peptone 10g/L, glucose 5g/L, sodium chloride 5g/L) at 37 deg.C for 3h, OD600nm=1;
2) 50ml of clostridium beijerinckii bacterial liquid is taken, centrifuged for 10min at 5000rpm and 4 ℃, and the supernatant is discarded. In ETM buffer (270mM sucrose, 0.6mM Na)2HPO4,4.4mM Na2HPO4,10mM MgCl2) Resuspending; centrifuging in the same way, removing the supernatant, re-suspending with ETM buffer solution, centrifuging in the same way, and completely taking the supernatant;
3) 1ml of ET buffer (270mM sucrose, 0.6mM Na)2HPO4,4.4mM NaH2PO4Resuspending, taking 200 μ l, adding 1ug of Cbei _3304 insertion inactivation vector, adding 0.2cm precooled electric rotor, and mixing gently;
4) electrically rotating by using a MicroPulser (TM) electric rotating instrument under the conditions of voltage of 1.8kV, resistance of 200 omega and capacitance of 2.5 mu F, immediately adding 1mL of 2 XYTG culture medium after electric shock, and transferring to a sterile centrifuge tube for resuscitation for 2-3 h;
5) 200. mu.l of the above-mentioned bacterial solution was applied to YPS solid medium containing 10. mu.g/ml erythromycin, and cultured for 2 to 3 days.
(3) Screening of Cbei _3304 insertion-inactivated mutant
Selecting the transformant cultured for 2-3 days in the step 5), carrying out colony PCR verification on the transformant by using primers Cbei-3304-T-S and Cbei-3304-T-A, screening out a mutant strain in which an intron is inserted into a genome (after insertion, about 1Kbp of a gene band electrophoresis chart is amplified by PCR), carrying out three passages on the correctly inserted mutant strain as shown in figure 3, simultaneously coating the correctly inserted mutant strain on an YPS solid culture medium containing erythromycin resistance and without the erythromycin resistance, and screening out a mutant strain in which the plasmid loss is knocked out (a mutant strain which cannot grow on an erythromycin resistance plate).
Example 2: clostridium beijerinckii was used for the dechlorination experiment of pentachlorophenol in simulated wastewater.
(1) The formula of the culture medium is as follows:
YPS medium: 3g/L of yeast powder, 5g/L of peptone, 1g/L of glucose, 2g/L of ammonium acetate, 3g/L of sodium chloride, 3g/L of magnesium sulfate heptahydrate, 1g/L of potassium dihydrogen phosphate, 1g/L of dipotassium hydrogen phosphate, 0.1g/L of ferrous sulfate heptahydrate, and the pH value of 6.
Simulating wastewater: 2g/L glucose, 0.9g/L potassium chloride, 1.0g/L ammonium chloride, 0.6g/L sodium dihydrogen phosphate monohydrate, 0.02g/L calcium chloride monohydrate, 0.05g/L yeast extract, 0.15g/L electron Mediator (MV), 6.44g/L ferric citrate, 3mg/L pentachlorophenol and trace elements (H)3BO33g/L,ZnSO4·7H2O 0.9g/L,MnCl2·2H2O 2.4g/L,CuSO4·5H2O0.6g/L,CoCl2·6H2O 3g/L,(NH4)6Mo7O24·2H2O 0.02g/L,NiCl2·6H2O 0.1g/L)5ml/L。
(2) Activating Clostridium beijerinckii M-3304 and initial strain NCIMB8052 in YPS culture medium at 37 deg.C, and anaerobic conditionThe oxygen culture time is 12 h. Then taking 40mL of bacterial liquid, centrifuging at 10000rpm for 5min, pouring off the supernatant, transferring the thallus into 20mL of simulated wastewater, and introducing N 25 minutes, the oxygen is discharged, the sealing is carried out quickly, the culture temperature is 30 ℃, and the shaking culture is carried out at 150 rpm. The reduction dechlorination effect of clostridium beijerinckii on pentachlorophenol in simulated wastewater is shown in figure 4.
It can be seen that at 60h, the reductive dechlorination rate of the clostridium beijerinckii recombinant bacterium M-3304 to pentachlorophenol reaches 90%, and under the same condition, the reductive dechlorination rate of the original strain NCIMB8052 to pentachlorophenol is only about 40%. The reduction dechlorination efficiency of the clostridium beijerinckii recombinant bacterium M-3304 to pentachlorophenol is 2.25 times of that of the original strain.
SEQUENCE LISTING
<110> Nanjing Zhongtai Biotechnology Ltd
<120> clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof
<130>SG20170613
<160>7
<170>PatentIn version 3.5
<210>1
<211>723
<212>DNA
<213> Cbei _3304 Gene
<400>1
atgacaaagg ttaataaatt acctacagca aaactgtgga atccgaaatc atttattata 60
ttttccgtat ttttctcatt tctgccagct ggaatcatgt gtgctttgaa ttatggacga 120
tctggaagtc aaaaaaagaa gtggatattt cttttagcaa gcatcttagt gtttatagca 180
cttatagcac ttctgcctat attatcaatt aatacttcta tcatattttt cagtattaat 240
atagctttag gcataattct tatgtttaca cagttaaagc tgtataatga acatattcaa 300
aatggcgggc aaagtgcttc gtatttattt cctataatca tagggctttt gattttttca 360
ttgtcagctg cttcaattct atactcaatt tacgtgccaa aaaatgctct tgattatggc 420
gaaaatcact tattttatac taataagata acagaatccc aagcgaaaaa acttggagat 480
tatttaaatt cagaaggata cttcactcct agttcaaaag tggacgttaa gattgataaa 540
caagatacac tctatatttt atctctcgtt gtagaaggtg actataaaag tgatacaagc 600
tatgtagaac ctatgaaagc aatatcaaaa gagatttcaa aaaatgtttt tgaaaataat 660
aaagttagaa tagatttatg caatgataga ttcaaggttc ttaattccat caatgttgat 720
taa 723
<210>2
<211>344
<212>DNA
<213>Artificial Sequence
<220>
<223> Intron sequence S-304
<400>2
ctcgagataa ttatccttac acttcgcccg cgtgcgccca gatagggtgt taagtcaagt 60
agtttaaggt actactctgt aagataacac agaaaacagc caacctaacc gaaaagcgaa 120
agctgatacg ggaacagagc acggttggaa agcgatgagt tacctaaaga caatcgggta 180
cgactgagtc gcaatgttaa tcagatataa ggtataagtt gtgtttactg aacgcaagtt 240
tctaatttcg gttaagtgtc gatagaggaa agtgtctgaa acctctagta caaagaaagg 300
taagttatgg cgggcgactt atctgttatc accacatttg taca 344
<210>3
<211>43
<212>DNA
<213>Artificial Sequence
<220>
<223>pWJ-OSC-304-S
<400>3
ggagtgtcga ggatcctcga gataattatc cttacacttc gcc 43
<210>4
<211>42
<212>DNA
<213>Artificial Sequence
<220>
<223>pWJ-OSC-304-A
<400>4
ggttctccta cagattgtac aaatgtggtg ataacagata ag 42
<210>5
<211>24
<212>DNA
<213>Artificial Sequence
<220>
<223>Cbei-3304-T-S
<400>5
taaattacct acagcaaaac tgtg 24
<210>6
<211>24
<212>DNA
<213>Artificial Sequence
<220>
<223>Cbei-3304-T-A
<400>6
ggaattaaga accttgaatc tatc 24
<210>7
<211>8601
<212>DNA
<213> vector pWJ
<400>7
tacagaggaa gaacagaaaa aagaacgtac atgcattaaa tattatgcaa ggagctttaa 60
aaaagctcat gtaaagaaga gtaaaaagaa aaaataattt atttattaat ttaatattga 120
gagtgccgac acagtatgca ctaaaaaata tatctgtggt gtagtgagcc gatacaaaag 180
gatagtcact cgcattttca taatacatct tatgttatga ttatgtgtcg gtgggacttc 240
acgacgaaaa cccacaataa aaaaagagtt cggggtaggg ttaagcatag ttgaggcaac 300
taaacaatca agctaggata tgcagtagca gaccgtaagg tcgttgttta ggtgtgttgt 360
aatacatacg ctattaagat gtaaaaatac ggataccaat gaagggaaaa gtataatttt 420
tggatgtagt ttgtttgttc atctatgggc aaactacgtc caaagccgtt tccaaatctg 480
ctaaaaagta tatcctttct aaaatcaaag tcaagtatga aatcataaat aaagtttaat 540
tttgaagtta ttatgatatt atgtttttct attaaaataa attaagtata tagaatagtt 600
taataatagt atatacttaa tgtgctgcag tataaaatat aaataatttt ctaaaaaact 660
taacttcatg tgaaaagttt gttaaaatat aaatgagcac gttaatcatt taacatagat 720
aattaaatag taaaagggag tgtcgaggat cctcgagata attatcctta aaggacgtag 780
atgtgcgccc agatagggtg ttaagtcaag tagtttaagg tactactctg taagataaca 840
cagaaaacag ccaacctaac cgaaaagcga aagctgatac gggaacagag cacggttgga 900
aagcgatgag ttacctaaag acaatcgggt acgactgagt cgcaatgtta atcagatata 960
aggtataagt tgtgtttact gaacgcaagt ttctaatttc ggtttccttc cgatagagga 1020
aagtgtctga aacctctagt acaaagaaag gtaagttaac atctacgact tatctgttat 1080
caccacattt gtacaatctg taggagaacc tatgggaacg aaacgaaagc gatgccgaga 1140
atctgaattt accaagactt aacactaact ggggataccc taaacaagaa tgcctaatag 1200
aaaggaggaa aaaggctata gcactagagc ttgaaaatct tgcaagggta cggagtactc 1260
gtagtagtct gagaagggta acgcccttta catggcaaag gggtacagtt attgtgtact 1320
aaaattaaaa attgattagg gaggaaaacc tcaaaatgaa accaacaatg gcaattttag 1380
aaagaatcag taaaaattca caagaaaata tagacgaagt ttttacaaga ctttatcgtt 1440
atcttttacg tccagatatt tattacgtgg cgacgcgttg ggaaatggca atgatagcga 1500
aacaacgtaa aactcttgtt gtatgctttc attgtcatcg tcacgtgatt cataaacaca 1560
agtgaatgtc gacagtgaat ttttacgaac gaacaataac agagccgtat actccgagag 1620
gggtacgtac ggttcccgaa gagggtggtg caaaccagtc acagtaatgt gaacaaggcg 1680
gtacctccct acttcaccat atcattttct gcagccccct agaaataatt ttgtttaact 1740
ttaagaagga gatatacata tatggctaga tcgtccattc cgacagcatc gccagtcact 1800
atggcgtgct gctagcgcta tatgcgttga tgcaatttct atgcactcgt agtagtctga 1860
gaagggtaac gccctttaca tggcaaaggg gtacagttat tgtgtactaa aattaaaaat 1920
tgattaggga ggaaaacctc aaaatgaaac caacaatggc aattttagaa agaatcagta 1980
aaaattcaca agaaaatata gacgaagttt ttacaagact ttatcgttat cttttacgtc 2040
cagatattta ttacgtggcg tatcaaaatt tatattccaa taaaggagct tccacaaaag 2100
gaatattaga tgatacagcg gatggcttta gtgaagaaaa aataaaaaag attattcaat 2160
ctttaaaaga cggaacttac tatcctcaac ctgtacgaag aatgtatatt gcaaaaaaga 2220
attctaaaaa gatgagacct ttaggaattc caactttcac agataaattg atccaagaag 2280
ctgtgagaat aattcttgaa tctatctatg aaccggtatt cgaagatgtg tctcacggtt 2340
ttagacctca acgaagctgt cacacagctt tgaaaacaat caaaagagag tttggcggcg 2400
caagatggtt tgtggaggga gatataaaag gctgcttcga taatatagac cacgttacac 2460
tcattggact catcaatctt aaaatcaaag atatgaaaat gagccaattg atttataaat 2520
ttctaaaagc aggttatctg gaaaactggc agtatcacaa aacttacagc ggaacacctc 2580
aaggtggaat tctatctcct cttttggcca acatctatct tcatgaattg gataagtttg 2640
ttttacaact caaaatgaag tttgaccgag aaagtccaga aagaataaca cctgaatatc 2700
gggagctcca caatgagata aaaagaattt ctcaccgtct caagaagttg gagggtgaag 2760
aaaaagctaa agttctttta gaatatcaag aaaaacgtaa aagattaccc acactcccct 2820
gtacctcaca gacaaataaa gtattgaaat acgtccggta tgcggacgac ttcattatct 2880
ctgttaaagg aagcaaagag gactgtcaat ggataaaaga acaattaaaa ctttttattc 2940
ataacaagct aaaaatggaa ttgagtgaag aaaaaacact catcacacat agcagtcaac 3000
ccgctcgttt tctgggatat gatatacgag taaggagatc tggaacgata aaacgatctg 3060
gtaaagtcaa aaagagaaca ctcaatggga gtgtagaact ccttattcct cttcaagaca 3120
aaattcgtca atttattttt gacaagaaaa tagctatcca aaagaaagat agctcatggt 3180
ttccagttca caggaaatat cttattcgtt caacagactt agaaatcatc acaatttata 3240
attctgaact ccgcgggatt tgtaattact acggtctagc aagtaatttt aaccagctca 3300
attattttgc ttatcttatg gaatacagct gtctaaaaac gatagcctcc aaacataagg 3360
gaacactttc aaaaaccatt tccatgttta aagatggaag tggttcgtgg gggatcccgt 3420
atgagataaa gcaaggtaag cagcgccgtt attttgcaaa ttttagtgaa tgtaaatccc 3480
cttatcaatt tacggatgag ataagtcaag ctcctgtatt gtatggctat gcccggaata 3540
ctcttgaaaa caggttaaaa gctaaatgtt gtgaattatg tgggacgtct gatgaaaata 3600
cttcctatga aattcaccat gtcaataagg tcaaaaatct taaaggcaaa gaaaaatggg 3660
aaatggcaat gatagcgaaa caacgtaaaa ctcttgttgtatgctttcat tgtcatcgtc 3720
acgtgattca taaacacaag tgaatgtcga gcacccgttc tcggagcact gtccgaccgc 3780
tttggccgcc gcccagtcct gctcgcttcg ctacttggag ccactatcga ctacgcgatc 3840
atggcgacca cacccgtcct gtggatcgcc aagccgccga tggtagtgtg gggtctcccc 3900
atgcgagagt agggaactgc caggcatcaa ataaaacgaa aggctcagtc gaaagactgg 3960
gcctttcgtt ttatctgttg tttgtcggtg aacgctctcc tgagtaggac aaatccgccg 4020
ggagcggatt tgaacgttgc gaagcaacgg cccggagggt ggcgggcagg acgcccgcca 4080
taaactgcca ggcatcaaat taagcagaag gccatcctga cggatggcct ttttgcgttt 4140
ctacaaactc ttcctgtcgt catatctaca agcatatggt gcactctcag tacaatctgc 4200
tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga 4260
cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc 4320
atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata 4380
cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact 4440
tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg 4500
tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt 4560
atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct 4620
gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 4680
cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 4740
gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 4800
cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 4860
gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 4920
tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 4980
ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 5040
gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 5100
cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct 5160
tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 5220
tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct 5280
cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 5340
acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 5400
tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat 5460
ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg 5520
accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc 5580
aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa 5640
ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag 5700
gtaactggct tcagcagagc gcagatacca aatactgttc ttctagtgta gccgtagtta 5760
ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta 5820
ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag 5880
ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg 5940
gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg 6000
cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag 6060
cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc 6120
cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa 6180
aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg 6240
ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct 6300
gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa 6360
gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctgg 6420
cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttag 6480
ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat gttgtgtgga 6540
attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta cgccaagctt 6600
tggctaacac acacgccatt ccaaccaata gttttctcgg cataaagcca tgctctgacg 6660
cttaaatgca ctaatgcctt aaaaaaacat taaagtctaa cacactagac ttatttactt 6720
cgtaattaag tcgttaaacc gtgtgctcta cgaccaaaag tataaaacct ttaagaactt 6780
tcttttttct tgtaaaaaaa gaaactagat aaatctctca tatcttttat tcaataatcg 6840
catcagattg cagtataaat ttaacgatca ctcatcatgt tcatatttat cagagctcgt 6900
gctataatta tactaatttt ataaggagga aaaaataaag agggttataa tgaacgagaa 6960
aaatataaaa cacagtcaaa actttattac ttcaaaacat aatatagata aaataatgac 7020
aaatataaga ttaaatgaac atgataatat ctttgaaatc ggctcaggaa aagggcattt 7080
tacccttgaa ttagtacaga ggtgtaattt cgtaactgcc attgaaatag accataaatt 7140
atgcaaaact acagaaaata aacttgttga tcacgataat ttccaagttt taaacaagga 7200
tatattgcag tttaaatttc ctaaaaacca atcctataaa atatttggta atatacctta 7260
taacataagt acggatataa tacgcaaaat tgtttttgat agtatagctg atgagattta 7320
tttaatcgtg gaatacgggt ttgctaaaag attattaaat acaaaacgct cattggcatt 7380
atttttaatg gcagaagttg atatttctat attaagtatg gttccaagag aatattttca 7440
tcctaaacct aaagtgaata gctcacttat cagattaaat agaaaaaaat caagaatatc 7500
acacaaagat aaacagaagt ataattattt cgttatgaaa tgggttaaca aagaatacaa 7560
gaaaatattt acaaaaaatc aatttaacaa ttccttaaaa catgcaggaa ttgacgattt 7620
aaacaatatt agctttgaac aattcttatc tcttttcaat agctataaat tatttaataa 7680
gtaagttaag ggatgcataa actgcatccc ttaacttgtt tttcgtgtac ctattttttg 7740
tgaatcgata atttacagaa aagaaaatta tagaatttag tatgattaat tatactcatt 7800
tatgaatgtt taattgaata caaaaaaaaa tacttgttat gtattcaatt acgggttaaa 7860
atatagacaa gttgaaaaat ttaataaaaa aataagtcct cagctcttat atattaagct 7920
accaacttag tatataagcc aaaacttaaa tgtgctacca acacatcaag ccgttagaga 7980
actctatcta tagcaatatt tcaaatgtac cgacatacaa gagaaacatt aactatatat 8040
attcaattta tgagattatc ttaacagata taaatgtaaa ttgcaataag taagatttag 8100
aagtttatag cctttgtgta ttggaagcag tacgcaaagg cttttttatt tgataaaaat 8160
tagaagtata tttatttttt cataattaat ttatgaaaat gaaagggggt gagcaaagtg 8220
acagaggaaa gcagtatctt atcaaataac aaggtattag caatatcatt attgacttta 8280
gcagtaaaca ttatgacttt tatagtgctt gtagctaagt agtacgaaag ggggagcttt 8340
aaaaagctcc ttggaataca tagaattcat aaattaattt atgaaaagaa gggcgtatat 8400
gaaaacttgt aaaaattgca aagagtttat taaagatact gaaatatgca aaatacattc 8460
gttgatgatt catgataaaa cagtagcaac ctattgcagt aaatacaatg agtcaagatg 8520
tttacataaa gggaaagtcc aatgtattaa ttgttcaaag atgaaccgat atggatggtg 8580
tgccataaaa atgagatgtt t 8601
Claims (3)
1. The application of a clostridium beijerinckii genetic engineering bacterium in removing pentachlorophenol in soil and water bodies is characterized in that SEQID NO is inserted between 335bp and 336bp of a Cbei _3304 gene of clostridium beijerinckii NCIMB 8052: 2, and the nucleotide sequence of the Cbei _3304 gene is shown as SEQ ID NO: 1 is shown.
2. The use of claim 1, wherein the clostridium beijerinckii genetically engineered bacterium is constructed by the following method:
(1) constructing an intron sequence into the two-type intron gene knock-out plasmid, wherein the nucleotide sequence of the intron sequence is shown in SEQ ID NO: 2 to obtain recombinant plasmids;
(2) transforming the recombinant plasmid obtained in the step (1) into clostridium beijerinckii NCIMB8052 to obtain a plasmid shown in SEQ ID No: 1 between the 335bp and 336bp insertion intron sequence.
3. The use of claim 2, wherein said two-type intron knockout plasmid is the pWJ plasmid.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710492586.1A CN107164292B (en) | 2017-06-26 | 2017-06-26 | Clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710492586.1A CN107164292B (en) | 2017-06-26 | 2017-06-26 | Clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107164292A CN107164292A (en) | 2017-09-15 |
CN107164292B true CN107164292B (en) | 2020-10-16 |
Family
ID=59826597
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710492586.1A Active CN107164292B (en) | 2017-06-26 | 2017-06-26 | Clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107164292B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106047754A (en) * | 2016-06-07 | 2016-10-26 | 广州甘蔗糖业研究所 | Method for improving power generation capacity of clostridium beijerinckii and application of clostridium beijerinckii |
-
2017
- 2017-06-26 CN CN201710492586.1A patent/CN107164292B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106047754A (en) * | 2016-06-07 | 2016-10-26 | 广州甘蔗糖业研究所 | Method for improving power generation capacity of clostridium beijerinckii and application of clostridium beijerinckii |
Non-Patent Citations (2)
Title |
---|
CP000721;GenBank;《GenBank》;20140128;全文 * |
enhanced abiotic and biotic contributions to dechlorination of pentachlorophenol during Fe(III) reduction by an iron-reducing bacterium clostridium beijerinckii Z;Yan Xu等;《science of the total enviornment》;20141231;全文 * |
Also Published As
Publication number | Publication date |
---|---|
CN107164292A (en) | 2017-09-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107557393B (en) | Magnetic nanomaterial-mediated CRISPR/Cas 9T cell internal delivery system and preparation method and application thereof | |
CN102146371B (en) | High glyphosate resistant variant gene and improvement method and application of high glyphosate resistant variant gene | |
CN108949721B (en) | Recombinant strain for expressing phospholipase D and application | |
CN112251464B (en) | Gene point mutation induction method | |
CN107058367A (en) | The construction method of the recombined bacillus subtilis of high yield Pullulanase | |
CN103911334A (en) | Clostridium beijerinckii with high stress resistance and application thereof | |
CN111748546B (en) | Fusion protein for generating gene point mutation and induction method of gene point mutation | |
CN114317584B (en) | Construction system of novel transposon mutant strain library, novel transposon mutant library and application | |
CN110066801B (en) | Sialic acid induced expression element in bacillus subtilis and construction method | |
CN105567603B (en) | A method of Clostridium beijerinckii is improved to 4- hydroxycinnamic acid resistance | |
CN101157935A (en) | Novel expression enzyme yeast gene engineering system | |
CN111471635B (en) | Method for increasing content of nucleic acid in bacillus subtilis | |
CN107164292B (en) | Clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof | |
CN108586571B (en) | Novel antimycin derivative and preparation method and application thereof | |
KR102064475B1 (en) | Microorganism for producing muconic acid and method for manufacturing the strain | |
CN111118049B (en) | Plasmid vector and application thereof | |
CN109880837B (en) | Method for degrading lignin in tobacco straw | |
CN106676135A (en) | Alb-uPA-teton lentiviral vector and preparation method and application thereof | |
CN107287145B (en) | Clostridium beijerinckii for generating electricity and construction method and application thereof | |
KR102676309B1 (en) | Microorganism for producing shikimic acid and method for producing shikimic acid using the microorganism | |
CN108611312B (en) | New antimycin biosynthesis pathway ketoreductase gene deletion strain, construction method and application | |
CN107603999B (en) | Method for improving electricity production of clostridium beijerinckii and application thereof | |
CN106978445A (en) | The method of the goat EDAR gene knockouts of CRISPER Cas9 System-mediateds | |
CN113481114A (en) | Yeast cell surface display technology-based explosive visualization biosensor and preparation method and application thereof | |
CN112662573B (en) | Microbial strain for efficiently synthesizing L-piperazinic acid and construction method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
TA01 | Transfer of patent application right | ||
TA01 | Transfer of patent application right |
Effective date of registration: 20200915 Address after: Room 4860, building F8, No. 9, Kechuang Avenue, intelligent manufacturing Industrial Park (Zhongshan Park), Jiangbei new district, Nanjing, Jiangsu Province, 210000 Applicant after: Nanjing Zhonghuan Biotechnology Co., Ltd Address before: 706, room 4, 210019 Huijin center, 288 Mount Lu Road, Jianye District, Nanjing, Jiangsu Applicant before: NANJING ZEALOT BIOLOGICAL TECHNOLOGY Co.,Ltd. |
|
GR01 | Patent grant | ||
GR01 | Patent grant |