CN107164292B

CN107164292B - Clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof

Info

Publication number: CN107164292B
Application number: CN201710492586.1A
Authority: CN
Inventors: 郭亭; 席梓淇; 朱刚强; 李永
Original assignee: Nanjing Zhonghuan Biotechnology Co Ltd
Current assignee: Nanjing Zhonghuan Biotechnology Co., Ltd
Priority date: 2017-06-26
Filing date: 2017-06-26
Publication date: 2020-10-16
Anticipated expiration: 2037-06-26
Also published as: CN107164292A

Abstract

The invention discloses a recombinant strain of clostridium beijerinckii for efficient reductive dechlorination of pentachlorophenol, which is obtained by inserting and inactivating a Cbei _3304 gene so that the protein can not normally work in clostridium beijerinckii NCIMB 8052. The clostridium beijerinckii recombinant bacterium M-3304 of the invention is in simulated wastewater containing 3.0mg/L pentachlorophenol, 0.15g/L Methyl Viologen (MV) and 6.44g/L ferric citrate, and the reduction dechlorination rate of the pentachlorophenol reaches 90 percent after 60 hours; under the same condition, the reduction dechlorination rate of the starting strain clostridium beijerinckii NCIMB8052 to the pentachlorophenol is only 40 percent; the reductive dechlorination efficiency of the clostridium beijerinckii recombinant bacterium M-3304 to pentachlorophenol is 2.25 times that of the original strain NCIMB 8052. The invention can be applied to the degradation of pentachlorophenol in water, solid garbage, solid waste and soil, and belongs to the field of environmental protection.

Description

Clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof

Technical Field

The invention belongs to the technical field of environmental protection, and particularly relates to a clostridium beijerinckii recombinant strain for efficiently dechlorinating pentachlorophenol, a construction method thereof and application in the field of environmental protection.

Background

Pentachlorophenol (PCP), also known as pentachlorophenol; often contains one molecule of crystal water, and has strong pungent odor when being slightly hot. Pentachlorophenol is capable of preventing fungal growth and inhibiting bacteria and has long been used as a herbicide, insecticide, fungicide, mildewcide, etc. However, PCP is most toxic in all phenolic toxic substances and has a strong "triogenic" (carcinogenic, teratogenic, mutagenic) effect. In the 1970 s, the United states environmental protection agency has included a list of preferred contaminants (Water Res., 2004, 38: 663-672), and in China, PCP is listed as a list of 68 contaminants for Water environment priority control. Pentachlorophenol is not easily oxidized, is also difficult to hydrolyze, has an accumulative effect, can be enriched in large amounts in organisms, and has a concentration far exceeding that of water. PCP is highly adsorptive on soil or sediments, can be absorbed by plants, and enters the food chain by biological enrichment (Trends in Biotehcnolgoy,20: 243-. The migration, transformation and degradation of the biohazard of PCP in the natural environment has been a focus of research and attention in the industry.

The pentachlorophenol treatment method comprises three main physical methods, a chemical method and a biological method. The physical methods mainly include adsorption method, irradiation method, ultrasonic method, and the like. The chemical method mainly comprises electrochemistry, a Fenton reagent method, a zero-valent metal reduction method, a manganese dioxide method and the like. The biological method comprises a plurality of microorganisms, and different types of microorganisms have different biochemical mechanisms for degrading pollutants, so that the degradation ways of the PCP are diversified, but the degradation process is that firstly dechlorination is converted into low-chlorine compounds and then the compounds are subjected to ring opening to obtain degradation or mineralization. The most important limiting steps in the biodegradation of PCP are the removal of chlorine substituents, and the biological dechlorination of PCP is mainly by oxidative and environmental microbiology,75:5910-5918. Among them, anaerobic reductive dechlorination mechanism is the most common and effective degradation method.

The biological method has the advantages of low cost, high efficiency, no secondary pollution, no environmental damage and the like, and has wide application prospect in the process of treating PCP. Some Fe (III) reducing bacteria Bacillus, Geobacter, Pesudomonas and Clostridium play an extremely important role in the anaerobic reductive dechlorination process (Science of the microbial environment 473: 215-.

Disclosure of Invention

The invention aims to solve the technical problem of providing a clostridium beijerinckii for efficiently dechlorinating p-pentachlorophenol obtained by a two-type intron gene insertional inactivation technology.

The technical problem to be solved by the invention is to provide the application of the clostridium beijerinckii in dechlorinating pentachlorophenol so as to improve the efficiency of degrading PCP by a biological method.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

the clostridium beijerinckii-3304 gene is inactivated in clostridium beijerinckii, so that the gene can not be normally expressed in clostridium beijerinckii. The Cbei _3304 gene encodes a suspected membrane protein, and the function of the membrane protein is lost, so that the exchange and the mobility of some substances in cells can be improved, and the dechlorination efficiency of the clostridium beijerinckii to pentachlorophenol is further improved.

Wherein, the nucleotide sequence of the Cbei _3304 gene is shown as SEQ ID NO: 1 is shown.

Wherein the clostridium beijerinckii is clostridium beijerinckii NCIMB 8052.

The construction method of the clostridium beijerinckii for efficiently dechlorinating the pentachlorophenol comprises the following steps:

(1) constructing an intron sequence into a two-type intron gene knockout plasmid to obtain a recombinant plasmid;

(2) and (2) transforming the recombinant plasmid obtained in the step (1) into clostridium beijerinckii, and screening to obtain a strain with inactivated Cbei _3304 gene, thereby obtaining the clostridium beijerinckii with pentachlorophenol dechlorinated efficiently.

Preferably, the nucleotide sequence of the intron sequence is as shown in SEQ ID NO: 2, the insertion site of the intron sequence is SEQ ID No: between 335bp and 336bp in 1.

Preferably, the two-type intron gene knockout plasmid is the pWJ plasmid.

The clostridium beijerinckii is clostridium beijerinckii NCIMB 8052.

The clostridium beijerinckii obtained by the construction method of the clostridium beijerinckii for efficiently dechlorinating the pentachlorophenol is within the protection scope of the invention.

The application of the clostridium beijerinckii in the efficient dechlorination reduction of pentachlorophenol is within the protection scope of the invention. The strain can be used for removing pentachlorophenol in soil and water.

The invention has the beneficial effects that:

after inserting and inactivating a Cbei _3304 gene of a coding membrane protein in clostridium beijerinckii, the gene cannot be normally expressed, so that a recombinant strain with the Cbei _3304 gene inserted and inactivated is obtained, namely the recombinant strain M-3304, and the reductive dechlorination rate of pentachlorophenol reaches 90% within 60 hours in simulated wastewater containing 3.0mg/L pentachlorophenol, 0.15g/L Methyl Viologen (MV) and 6.44g/L ferric citrate formazan; under the same condition, the reduction dechlorination rate of the starting strain clostridium beijerinckii NCIMB8052 to the pentachlorophenol is only 40 percent; the reduction dechlorination efficiency of the clostridium beijerinckii recombinant bacterium M-3304 to pentachlorophenol is 2.25 times of that of the original strain. The recombinant strain obtained by the invention is an excellent strain suitable for pentachlorophenol reductive dechlorination, can be widely applied to degradation of pentachlorophenol in water, solid garbage, solid waste and soil, and belongs to the field of environmental protection.

Drawings

FIG. 1 is a plasmid map of an insertionally inactivated vector pWJ according to the present invention;

FIG. 2 is a diagram of the mechanism of insertional inactivation using the two-type intron of the present invention;

FIG. 3 is a PCR electrophoretogram of transformant colonies;

lanes

1, 2 and 4 show the size of the Cbei _3304 gene fragment of the wild-type strain NCIMB8052, lanes 3 show the size of the Cbei _3304 gene fragment of the insertionally inactivated mutant M-3304, and lanes 5 show Marker;

FIG. 4 shows the results of the dechlorination of pentachlorophenol in simulated wastewater by Clostridium beijerinckii M-3304 and initial strain NCIMB8052 of the present invention.

Detailed Description

The invention will be better understood from the following examples. However, those skilled in the art will readily appreciate that the specific material ratios, process conditions and results thereof described in the examples are illustrative only and should not be taken as limiting the invention as detailed in the claims.

Example 1: and (3) constructing a mutant strain with inserted and inactivated Clostridium beijerinckii _3304 gene.

The principle of constructing a Clostridium beijerinckii Cbei _3304 gene insertion-inactivated mutant is shown in FIG. 2, and the specific construction process comprises the following steps:

(1) construction of Cbei _3304 insertion-inactivated vector

1) Design of introns

According to the sequence of the C bei _3304 gene of Clostridium beijerinckii recorded in the NCBI database (shown as SEQ ID No: 1), a suitable insertion gene site is designed by software (http://www.clostron.com) Selecting and inserting between 101 th to 102 th bases, generating an intron sequence, and synthesizing an intron sequence S-304 (the sequence of which is shown as SEQ ID NO: 2) and the following primers were designed.

Cloning a primer:

pWJ-OSC-304-S：5’-ggagtgtcgaggatcctcgagataattatccttacacttcgcc-3', the sequence of which is shown in SEQ ID NO: 3 is shown in the specification;

pWJ-OSC-304-A：5’-ggttctcctacagattgtacaaatgtggtgataacagataag-3', the sequence of which is shown in SEQ ID NO: 4, respectively.

Verifying the primers:

Cbei-3304-T-S: 5'-taaattacctacagcaaaactgtg-3', the sequence is shown in SEQ ID NO: 5 is shown in the specification;

Cbei-3304-T-A: 5'-ggaattaagaaccttgaatctatc-3', the sequence is shown in SEQ ID NO: and 6.

Primer pWJ-OSC-304-S introduces a XhoI cleavage site (underlined), and primer pWJ-OSC-304-A introduces a BsrGI cleavage site (underlined).

2) Construction of Cbei _3304-pWJ-304 recombinant vector

The vector pWJ was digested with Xho I and BsrGI, and the plasmid map of pWJ is shown in FIG. 1, and the sequence is shown in SEQ ID NO: shown at 7. The cleaved product was purified with a purification kit (Takara) and ligated with the intron sequence S-304 by one-step cloning (Clonexpress). And (2) transforming the recombinant plasmid subjected to one-step cloning and connection into Escherichia coli E.coli DH5a, coating the Escherichia coli E.coli DH5 on an LB (Langmuir) plate containing 50 mu g/ml of ampicillin resistance, culturing for 12-16 h at 37 ℃, picking up a transformant, inoculating the transformant into a liquid LB culture medium containing 50 mu g/ml of ampicillin, culturing for 12h at 37 ℃ and 200rpm, extracting a recombinant plasmid (AXYGEN), and performing sequencing verification to obtain a Cbei _3304-pWJ-304 recombinant vector.

3) Methylation of Cbei _3304-pWJ-304 recombinant vectors

Preparing chemical competence of E.coli Top 10/pAN2, transforming the successfully sequenced Cbei _3304-pWJ-304 recombinant vector into E.coli Top 10, coating the recombinant vector on LB plate containing 50 ug/ml ampicillin and 10 ug/ml tetracycline because pAN2 plasmid has tetracycline resistance, culturing at 37 ℃ for 12-16 h, picking up transformants, inoculating the transformants in LB culture medium containing 50 ug/ml ampicillin and 10 ug/ml tetracycline, culturing at 37 ℃ and 200rpm for 12h, and extracting methylated Cbei _3304-pWJ-304 recombinant vector (pAN2 plasmid contains a Bacillus subtilis phage gene, can encode methyltransferase, can achieve methylation of exogenous plasmid in E.coli), i.e. Cbei _3304 is inserted into inactivated vector.

(2) Cbei _3304 insert-inactivated vector transformation of Clostridium beijerinckii (Clostridium beijerinckii NCIMB8052)

1) Inoculating Clostridium beijerinckii NCIMB8052 to YPS medium (yeast powder 3g/L, peptone 5g/L, glucose 1g/L, ammonium acetate 2g/L, sodium chloride 3g/L, magnesium sulfate heptahydrate 3g/L, potassium dihydrogen phosphate 1g/L, dipotassium hydrogen phosphate 1g/L, ferrous sulfate heptahydrate 0.1g/L, pH 6.) for overnight culture at 37 deg.C, inoculating to YPS medium at 5% ratio the next day, culturing at 37 deg.C for 6-8h, inoculating to 2 × YTG medium (yeast powder 16g/L, peptone 10g/L, glucose 5g/L, sodium chloride 5g/L) at 37 deg.C for 3h, OD₆₀₀nm＝1；

2) 50ml of clostridium beijerinckii bacterial liquid is taken, centrifuged for 10min at 5000rpm and 4 ℃, and the supernatant is discarded. In ETM buffer (270mM sucrose, 0.6mM Na)₂HPO₄，4.4mM Na₂HPO₄，10mM MgCl₂) Resuspending; centrifuging in the same way, removing the supernatant, re-suspending with ETM buffer solution, centrifuging in the same way, and completely taking the supernatant;

3) 1ml of ET buffer (270mM sucrose, 0.6mM Na)₂HPO₄，4.4mM NaH₂PO₄Resuspending, taking 200 μ l, adding 1ug of Cbei _3304 insertion inactivation vector, adding 0.2cm precooled electric rotor, and mixing gently;

4) electrically rotating by using a MicroPulser (TM) electric rotating instrument under the conditions of voltage of 1.8kV, resistance of 200 omega and capacitance of 2.5 mu F, immediately adding 1mL of 2 XYTG culture medium after electric shock, and transferring to a sterile centrifuge tube for resuscitation for 2-3 h;

5) 200. mu.l of the above-mentioned bacterial solution was applied to YPS solid medium containing 10. mu.g/ml erythromycin, and cultured for 2 to 3 days.

(3) Screening of Cbei _3304 insertion-inactivated mutant

Selecting the transformant cultured for 2-3 days in the step 5), carrying out colony PCR verification on the transformant by using primers Cbei-3304-T-S and Cbei-3304-T-A, screening out a mutant strain in which an intron is inserted into a genome (after insertion, about 1Kbp of a gene band electrophoresis chart is amplified by PCR), carrying out three passages on the correctly inserted mutant strain as shown in figure 3, simultaneously coating the correctly inserted mutant strain on an YPS solid culture medium containing erythromycin resistance and without the erythromycin resistance, and screening out a mutant strain in which the plasmid loss is knocked out (a mutant strain which cannot grow on an erythromycin resistance plate).

Example 2: clostridium beijerinckii was used for the dechlorination experiment of pentachlorophenol in simulated wastewater.

(1) The formula of the culture medium is as follows:

YPS medium: 3g/L of yeast powder, 5g/L of peptone, 1g/L of glucose, 2g/L of ammonium acetate, 3g/L of sodium chloride, 3g/L of magnesium sulfate heptahydrate, 1g/L of potassium dihydrogen phosphate, 1g/L of dipotassium hydrogen phosphate, 0.1g/L of ferrous sulfate heptahydrate, and the pH value of 6.

Simulating wastewater: 2g/L glucose, 0.9g/L potassium chloride, 1.0g/L ammonium chloride, 0.6g/L sodium dihydrogen phosphate monohydrate, 0.02g/L calcium chloride monohydrate, 0.05g/L yeast extract, 0.15g/L electron Mediator (MV), 6.44g/L ferric citrate, 3mg/L pentachlorophenol and trace elements (H)₃BO₃3g/L，ZnSO₄·7H₂O 0.9g/L,MnCl₂·2H₂O 2.4g/L,CuSO₄·5H₂O0.6g/L,CoCl₂·6H₂O 3g/L,(NH₄)₆Mo₇O₂₄·2H₂O 0.02g/L,NiCl₂·6H₂O 0.1g/L)5ml/L。

(2) Activating Clostridium beijerinckii M-3304 and initial strain NCIMB8052 in YPS culture medium at 37 deg.C, and anaerobic conditionThe oxygen culture time is 12 h. Then taking 40mL of bacterial liquid, centrifuging at 10000rpm for 5min, pouring off the supernatant, transferring the thallus into 20mL of simulated wastewater, and introducing N ₂5 minutes, the oxygen is discharged, the sealing is carried out quickly, the culture temperature is 30 ℃, and the shaking culture is carried out at 150 rpm. The reduction dechlorination effect of clostridium beijerinckii on pentachlorophenol in simulated wastewater is shown in figure 4.

It can be seen that at 60h, the reductive dechlorination rate of the clostridium beijerinckii recombinant bacterium M-3304 to pentachlorophenol reaches 90%, and under the same condition, the reductive dechlorination rate of the original strain NCIMB8052 to pentachlorophenol is only about 40%. The reduction dechlorination efficiency of the clostridium beijerinckii recombinant bacterium M-3304 to pentachlorophenol is 2.25 times of that of the original strain.

SEQUENCE LISTING

<110> Nanjing Zhongtai Biotechnology Ltd

<120> clostridium beijerinckii for efficiently dechlorinating pentachlorophenol and construction method and application thereof

<130>SG20170613

<160>7

<170>PatentIn version 3.5

<210>1

<211>723

<212>DNA

<213> Cbei _3304 Gene

<400>1

atgacaaagg ttaataaatt acctacagca aaactgtgga atccgaaatc atttattata 60

ttttccgtat ttttctcatt tctgccagct ggaatcatgt gtgctttgaa ttatggacga 120

tctggaagtc aaaaaaagaa gtggatattt cttttagcaa gcatcttagt gtttatagca 180

cttatagcac ttctgcctat attatcaatt aatacttcta tcatattttt cagtattaat 240

atagctttag gcataattct tatgtttaca cagttaaagc tgtataatga acatattcaa 300

aatggcgggc aaagtgcttc gtatttattt cctataatca tagggctttt gattttttca 360

ttgtcagctg cttcaattct atactcaatt tacgtgccaa aaaatgctct tgattatggc 420

gaaaatcact tattttatac taataagata acagaatccc aagcgaaaaa acttggagat 480

tatttaaatt cagaaggata cttcactcct agttcaaaag tggacgttaa gattgataaa 540

caagatacac tctatatttt atctctcgtt gtagaaggtg actataaaag tgatacaagc 600

tatgtagaac ctatgaaagc aatatcaaaa gagatttcaa aaaatgtttt tgaaaataat 660

aaagttagaa tagatttatg caatgataga ttcaaggttc ttaattccat caatgttgat 720

taa 723

<210>2

<211>344

<212>DNA

<213>Artificial Sequence

<220>

<223> Intron sequence S-304

<400>2

ctcgagataa ttatccttac acttcgcccg cgtgcgccca gatagggtgt taagtcaagt 60

agtttaaggt actactctgt aagataacac agaaaacagc caacctaacc gaaaagcgaa 120

agctgatacg ggaacagagc acggttggaa agcgatgagt tacctaaaga caatcgggta 180

cgactgagtc gcaatgttaa tcagatataa ggtataagtt gtgtttactg aacgcaagtt 240

tctaatttcg gttaagtgtc gatagaggaa agtgtctgaa acctctagta caaagaaagg 300

taagttatgg cgggcgactt atctgttatc accacatttg taca 344

<210>3

<211>43

<212>DNA

<213>Artificial Sequence

<220>

<223>pWJ-OSC-304-S

<400>3

ggagtgtcga ggatcctcga gataattatc cttacacttc gcc 43

<210>4

<211>42

<212>DNA

<213>Artificial Sequence

<220>

<223>pWJ-OSC-304-A

<400>4

ggttctccta cagattgtac aaatgtggtg ataacagata ag 42

<210>5

<211>24

<212>DNA

<213>Artificial Sequence

<220>

<223>Cbei-3304-T-S

<400>5

taaattacct acagcaaaac tgtg 24

<210>6

<211>24

<212>DNA

<213>Artificial Sequence

<220>

<223>Cbei-3304-T-A

<400>6

ggaattaaga accttgaatc tatc 24

<210>7

<211>8601

<212>DNA

<213> vector pWJ

<400>7

tacagaggaa gaacagaaaa aagaacgtac atgcattaaa tattatgcaa ggagctttaa 60

aaaagctcat gtaaagaaga gtaaaaagaa aaaataattt atttattaat ttaatattga 120

gagtgccgac acagtatgca ctaaaaaata tatctgtggt gtagtgagcc gatacaaaag 180

gatagtcact cgcattttca taatacatct tatgttatga ttatgtgtcg gtgggacttc 240

acgacgaaaa cccacaataa aaaaagagtt cggggtaggg ttaagcatag ttgaggcaac 300

taaacaatca agctaggata tgcagtagca gaccgtaagg tcgttgttta ggtgtgttgt 360

aatacatacg ctattaagat gtaaaaatac ggataccaat gaagggaaaa gtataatttt 420

tggatgtagt ttgtttgttc atctatgggc aaactacgtc caaagccgtt tccaaatctg 480

ctaaaaagta tatcctttct aaaatcaaag tcaagtatga aatcataaat aaagtttaat 540

tttgaagtta ttatgatatt atgtttttct attaaaataa attaagtata tagaatagtt 600

taataatagt atatacttaa tgtgctgcag tataaaatat aaataatttt ctaaaaaact 660

taacttcatg tgaaaagttt gttaaaatat aaatgagcac gttaatcatt taacatagat 720

aattaaatag taaaagggag tgtcgaggat cctcgagata attatcctta aaggacgtag 780

atgtgcgccc agatagggtg ttaagtcaag tagtttaagg tactactctg taagataaca 840

cagaaaacag ccaacctaac cgaaaagcga aagctgatac gggaacagag cacggttgga 900

aagcgatgag ttacctaaag acaatcgggt acgactgagt cgcaatgtta atcagatata 960

aggtataagt tgtgtttact gaacgcaagt ttctaatttc ggtttccttc cgatagagga 1020

aagtgtctga aacctctagt acaaagaaag gtaagttaac atctacgact tatctgttat 1080

caccacattt gtacaatctg taggagaacc tatgggaacg aaacgaaagc gatgccgaga 1140

atctgaattt accaagactt aacactaact ggggataccc taaacaagaa tgcctaatag 1200

aaaggaggaa aaaggctata gcactagagc ttgaaaatct tgcaagggta cggagtactc 1260

gtagtagtct gagaagggta acgcccttta catggcaaag gggtacagtt attgtgtact 1320

aaaattaaaa attgattagg gaggaaaacc tcaaaatgaa accaacaatg gcaattttag 1380

aaagaatcag taaaaattca caagaaaata tagacgaagt ttttacaaga ctttatcgtt 1440

atcttttacg tccagatatt tattacgtgg cgacgcgttg ggaaatggca atgatagcga 1500

aacaacgtaa aactcttgtt gtatgctttc attgtcatcg tcacgtgatt cataaacaca 1560

agtgaatgtc gacagtgaat ttttacgaac gaacaataac agagccgtat actccgagag 1620

gggtacgtac ggttcccgaa gagggtggtg caaaccagtc acagtaatgt gaacaaggcg 1680

gtacctccct acttcaccat atcattttct gcagccccct agaaataatt ttgtttaact 1740

ttaagaagga gatatacata tatggctaga tcgtccattc cgacagcatc gccagtcact 1800

atggcgtgct gctagcgcta tatgcgttga tgcaatttct atgcactcgt agtagtctga 1860

gaagggtaac gccctttaca tggcaaaggg gtacagttat tgtgtactaa aattaaaaat 1920

tgattaggga ggaaaacctc aaaatgaaac caacaatggc aattttagaa agaatcagta 1980

aaaattcaca agaaaatata gacgaagttt ttacaagact ttatcgttat cttttacgtc 2040

cagatattta ttacgtggcg tatcaaaatt tatattccaa taaaggagct tccacaaaag 2100

gaatattaga tgatacagcg gatggcttta gtgaagaaaa aataaaaaag attattcaat 2160

ctttaaaaga cggaacttac tatcctcaac ctgtacgaag aatgtatatt gcaaaaaaga 2220

attctaaaaa gatgagacct ttaggaattc caactttcac agataaattg atccaagaag 2280

ctgtgagaat aattcttgaa tctatctatg aaccggtatt cgaagatgtg tctcacggtt 2340

ttagacctca acgaagctgt cacacagctt tgaaaacaat caaaagagag tttggcggcg 2400

caagatggtt tgtggaggga gatataaaag gctgcttcga taatatagac cacgttacac 2460

tcattggact catcaatctt aaaatcaaag atatgaaaat gagccaattg atttataaat 2520

ttctaaaagc aggttatctg gaaaactggc agtatcacaa aacttacagc ggaacacctc 2580

aaggtggaat tctatctcct cttttggcca acatctatct tcatgaattg gataagtttg 2640

ttttacaact caaaatgaag tttgaccgag aaagtccaga aagaataaca cctgaatatc 2700

gggagctcca caatgagata aaaagaattt ctcaccgtct caagaagttg gagggtgaag 2760

aaaaagctaa agttctttta gaatatcaag aaaaacgtaa aagattaccc acactcccct 2820

gtacctcaca gacaaataaa gtattgaaat acgtccggta tgcggacgac ttcattatct 2880

ctgttaaagg aagcaaagag gactgtcaat ggataaaaga acaattaaaa ctttttattc 2940

ataacaagct aaaaatggaa ttgagtgaag aaaaaacact catcacacat agcagtcaac 3000

ccgctcgttt tctgggatat gatatacgag taaggagatc tggaacgata aaacgatctg 3060

gtaaagtcaa aaagagaaca ctcaatggga gtgtagaact ccttattcct cttcaagaca 3120

aaattcgtca atttattttt gacaagaaaa tagctatcca aaagaaagat agctcatggt 3180

ttccagttca caggaaatat cttattcgtt caacagactt agaaatcatc acaatttata 3240

attctgaact ccgcgggatt tgtaattact acggtctagc aagtaatttt aaccagctca 3300

attattttgc ttatcttatg gaatacagct gtctaaaaac gatagcctcc aaacataagg 3360

gaacactttc aaaaaccatt tccatgttta aagatggaag tggttcgtgg gggatcccgt 3420

atgagataaa gcaaggtaag cagcgccgtt attttgcaaa ttttagtgaa tgtaaatccc 3480

cttatcaatt tacggatgag ataagtcaag ctcctgtatt gtatggctat gcccggaata 3540

ctcttgaaaa caggttaaaa gctaaatgtt gtgaattatg tgggacgtct gatgaaaata 3600

cttcctatga aattcaccat gtcaataagg tcaaaaatct taaaggcaaa gaaaaatggg 3660

aaatggcaat gatagcgaaa caacgtaaaa ctcttgttgtatgctttcat tgtcatcgtc 3720

acgtgattca taaacacaag tgaatgtcga gcacccgttc tcggagcact gtccgaccgc 3780

tttggccgcc gcccagtcct gctcgcttcg ctacttggag ccactatcga ctacgcgatc 3840

atggcgacca cacccgtcct gtggatcgcc aagccgccga tggtagtgtg gggtctcccc 3900

atgcgagagt agggaactgc caggcatcaa ataaaacgaa aggctcagtc gaaagactgg 3960

gcctttcgtt ttatctgttg tttgtcggtg aacgctctcc tgagtaggac aaatccgccg 4020

ggagcggatt tgaacgttgc gaagcaacgg cccggagggt ggcgggcagg acgcccgcca 4080

taaactgcca ggcatcaaat taagcagaag gccatcctga cggatggcct ttttgcgttt 4140

ctacaaactc ttcctgtcgt catatctaca agcatatggt gcactctcag tacaatctgc 4200

tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga 4260

cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc 4320

atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata 4380

cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact 4440

tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg 4500

tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt 4560

atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct 4620

gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 4680

cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 4740

gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 4800

cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 4860

gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 4920

tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 4980

ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 5040

gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 5100

cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct 5160

tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 5220

tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct 5280

cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 5340

acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 5400

tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat 5460

ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg 5520

accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc 5580

aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa 5640

ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag 5700

gtaactggct tcagcagagc gcagatacca aatactgttc ttctagtgta gccgtagtta 5760

ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta 5820

ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag 5880

ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg 5940

gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg 6000

cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag 6060

cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc 6120

cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa 6180

aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg 6240

ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct 6300

gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa 6360

gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctgg 6420

cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttag 6480

ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat gttgtgtgga 6540

attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta cgccaagctt 6600

tggctaacac acacgccatt ccaaccaata gttttctcgg cataaagcca tgctctgacg 6660

cttaaatgca ctaatgcctt aaaaaaacat taaagtctaa cacactagac ttatttactt 6720

cgtaattaag tcgttaaacc gtgtgctcta cgaccaaaag tataaaacct ttaagaactt 6780

tcttttttct tgtaaaaaaa gaaactagat aaatctctca tatcttttat tcaataatcg 6840

catcagattg cagtataaat ttaacgatca ctcatcatgt tcatatttat cagagctcgt 6900

gctataatta tactaatttt ataaggagga aaaaataaag agggttataa tgaacgagaa 6960

aaatataaaa cacagtcaaa actttattac ttcaaaacat aatatagata aaataatgac 7020

aaatataaga ttaaatgaac atgataatat ctttgaaatc ggctcaggaa aagggcattt 7080

tacccttgaa ttagtacaga ggtgtaattt cgtaactgcc attgaaatag accataaatt 7140

atgcaaaact acagaaaata aacttgttga tcacgataat ttccaagttt taaacaagga 7200

tatattgcag tttaaatttc ctaaaaacca atcctataaa atatttggta atatacctta 7260

taacataagt acggatataa tacgcaaaat tgtttttgat agtatagctg atgagattta 7320

tttaatcgtg gaatacgggt ttgctaaaag attattaaat acaaaacgct cattggcatt 7380

atttttaatg gcagaagttg atatttctat attaagtatg gttccaagag aatattttca 7440

tcctaaacct aaagtgaata gctcacttat cagattaaat agaaaaaaat caagaatatc 7500

acacaaagat aaacagaagt ataattattt cgttatgaaa tgggttaaca aagaatacaa 7560

gaaaatattt acaaaaaatc aatttaacaa ttccttaaaa catgcaggaa ttgacgattt 7620

aaacaatatt agctttgaac aattcttatc tcttttcaat agctataaat tatttaataa 7680

gtaagttaag ggatgcataa actgcatccc ttaacttgtt tttcgtgtac ctattttttg 7740

tgaatcgata atttacagaa aagaaaatta tagaatttag tatgattaat tatactcatt 7800

tatgaatgtt taattgaata caaaaaaaaa tacttgttat gtattcaatt acgggttaaa 7860

atatagacaa gttgaaaaat ttaataaaaa aataagtcct cagctcttat atattaagct 7920

accaacttag tatataagcc aaaacttaaa tgtgctacca acacatcaag ccgttagaga 7980

actctatcta tagcaatatt tcaaatgtac cgacatacaa gagaaacatt aactatatat 8040

attcaattta tgagattatc ttaacagata taaatgtaaa ttgcaataag taagatttag 8100

aagtttatag cctttgtgta ttggaagcag tacgcaaagg cttttttatt tgataaaaat 8160

tagaagtata tttatttttt cataattaat ttatgaaaat gaaagggggt gagcaaagtg 8220

acagaggaaa gcagtatctt atcaaataac aaggtattag caatatcatt attgacttta 8280

gcagtaaaca ttatgacttt tatagtgctt gtagctaagt agtacgaaag ggggagcttt 8340

aaaaagctcc ttggaataca tagaattcat aaattaattt atgaaaagaa gggcgtatat 8400

gaaaacttgt aaaaattgca aagagtttat taaagatact gaaatatgca aaatacattc 8460

gttgatgatt catgataaaa cagtagcaac ctattgcagt aaatacaatg agtcaagatg 8520

tttacataaa gggaaagtcc aatgtattaa ttgttcaaag atgaaccgat atggatggtg 8580

tgccataaaa atgagatgtt t 8601

Claims

1. The application of a clostridium beijerinckii genetic engineering bacterium in removing pentachlorophenol in soil and water bodies is characterized in that SEQID NO is inserted between 335bp and 336bp of a Cbei _3304 gene of clostridium beijerinckii NCIMB 8052: 2, and the nucleotide sequence of the Cbei _3304 gene is shown as SEQ ID NO: 1 is shown.

2. The use of claim 1, wherein the clostridium beijerinckii genetically engineered bacterium is constructed by the following method:

(1) constructing an intron sequence into the two-type intron gene knock-out plasmid, wherein the nucleotide sequence of the intron sequence is shown in SEQ ID NO: 2 to obtain recombinant plasmids;

(2) transforming the recombinant plasmid obtained in the step (1) into clostridium beijerinckii NCIMB8052 to obtain a plasmid shown in SEQ ID No: 1 between the 335bp and 336bp insertion intron sequence.

3. The use of claim 2, wherein said two-type intron knockout plasmid is the pWJ plasmid.